Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Het beoordelen van Teratogene Veranderingen in een zebravis model van foetale blootstelling aan alcohol

doi: 10.3791/3704 Published: March 20, 2012

Summary

Om de moleculaire mechanismen van de ethanol-geïnduceerde ontwikkelingsschade begrijpen, hebben we een zebravis model van ethanol blootstelling en het verkennen van de fysieke, cellulaire en genetische veranderingen die optreden na blootstelling aan ethanol

Abstract

Foetaal alcohol syndroom (FAS) is een ernstige uiting van embryonale blootstelling aan ethanol. Het presenteert met karakteristieke gebreken aan het gezicht en de organen, waaronder mentale retardatie als gevolg van ontregelde en beschadigde ontwikkeling van de hersenen. Foetale alcohol spectrum stoornis (FASD) is een term die gebruikt wordt om een ​​continuüm van aangeboren afwijkingen die optreden als gevolg van de moeder alcoholgebruik te dekken, en komt voor bij ongeveer 4% van de kinderen geboren in de Verenigde Staten. Met 50% van de vruchtbare leeftijd vrouwen rapporteren consumptie van alcohol, en de helft van alle zwangerschappen zijn ongepland, onopzettelijke blootstelling is een permanente uitgifte 2. Met het oog op de beste de schade die door ethanol te begrijpen, plus produceren een model waarmee de potentiële interventies te testen hebben we een model ontwikkeld van ontwikkelings-ethanol blootstelling met behulp van de zebravis embryo. Zebravis zijn ideaal voor dit soort teratogeen studie 3-8. Elk paar legt honderden eieren, die vervolgens kunnen worden opgevangen zonder nadelige gevolgen voor de volwassenvis. De zebravisembryo is transparant en kan gemakkelijk worden afgebeeld met een aantal vlekken. Analyse van deze embryo's na blootstelling aan ethanol in verschillende doses en tijden duur en toepassing blijkt dat de grove ontwikkelingsstoornissen door ethanol zijn met de menselijke geboorteafwijking. Hier beschreven zijn de belangrijkste technieken die gebruikt worden om te studeren en te manipuleren de zebravis FAS model.

Protocol

1. Ethanol behandeling van embryo's

  1. Zebravissen embryo's uit wild-type paringen zijn gerezen bij 28 ° C in 5 ml water embryo. (Milli-Q water met 60 mg / L Instant Ocean). Verschillende stammen van wild-type embryo's hebben een iets andere toleranties van de blootstelling 9 ethanol.
  2. Blootstelling aan ethanol werd gestart op koepel fase (~ 4,3 uur na bevruchting HPF) voor de gewenste tijd tot 24 uur puls. Deze eerste fase is ongeveer gelijk aan de implantatie fase van zoogdieren embryo's, net voor gastrulatie. Ethanol gebruikte concentraties variëren van 0,2% -2,5%, volume / volume. Proeven hebben aangetoond dat tussen 25-50% van de oplossing in water eindigt in het ontwikkelende embryo 10, 11. Embryo's gehandhaafd op 28 ° C voor de gewenste tijdsduur. Nadat de gewenste lengte van ethanol belichting wordt het ethanol-water oplossing verwijderd en vervangen door drie wassingen regelmatige zebravis water en gehandhaafd for de gewenste duur. De specificiteit van het defect afhankelijk van het tijdstip van aanvang, de dosis en de lengte van de impuls van ethanol.

2. Het verzamelen van embryo's voor RNA, in situ hybridisatie, antilichaam, en kraakbeen Staining

  1. Om mRNA voor qPCR verzamelen, leeftijd De gekoppeld embryo in Eppendorf-buizen. Na verwijdering van de zebravis water wordt lysis buffer TCEP toegevoegd. Een gemotoriseerde verstuiver wordt gebruikt voor het fysiek scheiden van de embryo's in de lysis oplossing. Dit wordt vervolgens door een preclear kolom, die een niet gedissocieerde grote stukken verwijderd. De resulterende oplossing bevat alle macromoleculen vrijgegeven door de lysis proces. RNA wordt geëxtraheerd door het uitvoeren van deze oplossing op een kolom, gevolgd door wassen en DNAse behandeling. Elutie wordt uitgevoerd met water of een elutie-oplossing door de fabrikant (5'-Prime). De RNA kan worden omgezet cDNA met behulp van standaard technieken qPCR of in microarray analyse.
  2. In situ hybridisatie en antilichaam kleuring embryo 6-24 hpf werden gefixeerd in 4% paraformaldehyde overnacht bij 4 ° C. Dit wordt gevolgd door 3 wasbeurten in PBS + 0,1% Tween (PBT), embryo's niet aan elkaar plakken. Embryo worden vervolgens via een serie van 3 methanol: PBT wast in 100% methanol, waarna ze kunnen worden opgeslagen bij -20 ° C. Deze embryo's kunnen worden gebruikt in situ hybridisatie of antilichaam kleuring. Sommige antilichamen werken niet na methanol behandeling, dus dit voorbehoud moet rekening worden gehouden met en uw specifieke antilichamen getest om te bepalen of het zal werken na methanol behandeling.
  3. Voor kraakbeen vlekken, de embryo's moeten worden verhoogd tot 5 of 6 dagen na de bevruchting (DPF). Ze worden gefixeerd in 4% paraformaldehyde overnacht bij 4 ° C, gevolgd door 3 wasbeurten in PBT.

3. Het beoordelen van ethanol-geïnduceerde Gene Expression Wijzigingen en Ontwikkelings-gevolgen

    in situ hybridisatie. qPCR wordt bereikt met behulp van primers ontworpen met Integrated DNA Technologies (IDT) software, vervolgens gevalideerd met behulp van 3 aparte biologische monsters. Zodra primers zijn gevalideerd, wordt qPCR uitgevoerd op cDNA gemaakt van RNA-monsters verzameld. Elk monster wordt uitgevoerd in drievoud. PCR-reacties worden uitgevoerd Platinum SYBR Green qPCR Super mix (Invitrogen) op een Chroma-4 PCR-machine (BioRad) of soortgelijke PCR-machine met een multicolor detectiesysteem. Naast genen ondervraagd, is het essentieel dat een controle set primers gebruikt om kleine verschillen in cDNA of RNA-bereiding evenwicht. Voor onze zebravis embryo's, gebruiken we GAPDH: 5'GAAGGTGGGAAACTGGTCAT3 'en 5'TTGCACCACCCTTAATGTGA3'. Genen geanalyseerd worden vervolgens genormaliseerd tot GAPDH niveau een van de relatieve kwantificering van genexpressie wordt berekend volgens de methode Pfaffl variatie op 2 12. De normale berekening aangenomen dat alle genen DNA tweemaal dupliceren voor elke cyclus, en dus drukt de gegevens een verhouding van de verandering van de experimentele gen over de verandering in de referentie-gen uitgedrukt powerberekeningen via integer "2" dat de efficiëntie van verdubbeling van DNA per cyclus gezien in een perfecte PCR-reactie. De Pfaffl methode vervangt de generieke "2" met de experimentator gegenereerd ware efficiëntie voor de gekozen PCR-primers. Het geeft een goed beeld van het verschil in de PCR-reacties. De volledige formule:
    (Efficiëntie van de experimentele gen) (Ct van controle monster-Ct van het behandelde monster)
    -------------------------------------------------- -----------------------------------
    (Efficiëntie van de referentie-gen) (Ct vancontrolemonster - Ct van het behandelde monster)
  1. In situ hybridisatie, digoxigenine (DIG)-gemerkte riboprobes zijn opgebouwd uit plasmiden die gedeelten van het gen van belang. Dezelfde leeftijd embryo's blootgesteld aan riboprobes met standaard omstandigheden 13 en gedetecteerd met anti-dig antilichamen gekoppeld aan alkaline fosfatase de locatie van de gelabelde riboprobes met een kleurreactie (NBT / BCIP) toestaat. Embryo's worden vervolgens gevisualiseerd met behulp van een Leica stereomicroscoop (Figuur 1B-G).
  2. Om morfogenisch ontwikkeling te beoordelen, worden embryo's op het gewenste tijdstip en onderzocht onder de stereomicroscoop. Voor somiet vorm, zijn levende embryo's afgebeeld 14. Voor inter oculaire afstand en lichaamslengte, worden embryo's vast in PFA. In alle gevallen worden de beelden van het gewenste gebied opgevangen op een dissectie microscoop tegen een vaste vergroting en metingen die met behulp van Adobe Photoshop software 10,14.
  3. Om de effecten van de behandeling op de ontwikkeling van kraakbeen structuren in het larvale zebravissen te onderzoeken, gebruiken we alcianblauwkleuring. Vaste zebravis larven behandeld met alcianblauw oplossing opgelost in 80% ethanol: 20% ijsazijn (zuur alcohol) enkele uren of een nacht. Larven ontkleurd in verschillende wassen van zuur alcohol alvorens te worden overgebracht naar een 1% KOH: 3% waterstofperoxideoplossing verder ruimen van pigment cellen. Zebravis moeten ten minste 4 dagen oud zijn om het kraakbeen structuren laten zien, en deze worden beter gedefinieerd in vis die 5 of 6 dagen oud.
  4. Celdood in levende embryo's wordt beoordeeld op basis acridine oranje (AO). AO niet cel permeabel levende cellen en bindt aan DNA in cellen met verminderde membranen, waaronder het ondergaan van apoptose en necrose. Levende embryo worden geïncubeerd met 5 mg / ml AO in PBS gedurende 1 uur, gevolgd door 3 wasbeurten in PBS. Embryo's worden dan afgebeeld met de confocale microscoop. Digital Z-sers beelden worden gecombineerd composieten te maken.

4. Het manipuleren van de zebravis embryo

  1. Na identificatie van genen die worden verlaagd door ethanol belichting, is het mogelijk om te proberen te vervangen met injectie mRNA om de ontbrekende gen te vervangen. Capped mRNA wordt getranscribeerd vanaf lineair DNA plasmiden met RNA-polymerase in vitro transcriptie kits volgens de instructies van de fabrikant (mMessage Machine, Applied Biosystems). Tussen 25 tot 200 pg / nl van RNA wordt geïnjecteerd 1-2 cel stadium zebravis eieren in een oplossing van 0,1 M KCl. Embryo's worden dan kunnen herstellen voordat behandeling met ethanol zoals hierboven beschreven (figuur 5).
  2. Voor gentranscripten die verhoogd ethanol belichting, kunnen worden verminderd of "knock-down" een antisense morfolino techniek gebruikt. Antisense morpholinos (Amos) zijn ontworpen door het bedrijf Gene Tools, en blokkeren de vertaling van RNA naar eiwit, of block de rijping en splitsen van RNA, afhankelijk van de experimentele behoefte. Deze actie van morpholinos beperken de hoeveelheid van het actieve eiwit voor doelgerichte het gen, een tekort dat kan worden gemeten met behulp van anitibodies indien deze beschikbaar zijn. De efficiëntie van RNA morpholinos kan worden gemeten met RT-PCR om de relatieve hoeveelheden van gestript en unspliced ​​transcripten detecteren. Titreren van de morfolino kan resulteren in een dosis-afhankelijke activiteit 15. AMOS verdund be concentraties (getitreerd op pg ng concentratie) in Danieau oplossing (58 mM NaCl, 0,7 mM KCl, 0,4 mM MgSÛ4, 0,6 mM Ca (NO3) 2, 5 mM HEPES, pH 7,6). Injectie plaatsvindt bij de 1-2-cellen worden, waarna het embryo's kunnen ontwikkelen alvorens ondergaat ethanol als hierboven.

5. Representatieve resultaten

Zebravis embryo blootstelling aan ethanol leidt tot een aantal van ontwikkelings-en genetische afwijkingen die gerelateerd zijn aande fenotypes in andere gewervelde dieren. We hebben aangetoond abnormale groei van axiale weefsels zoals notochorda de (gegevens niet getoond 14). De vertraging in de ontwikkeling die door ethanol leidt blijkbaar tot een verstoring van de juiste notochorda rek, wat leidt tot een verkorte en af en toe verstoord notochorda (gegevens niet getoond 14). Deze eerste vertraging en notochorda defect tot waarschijnlijk ten dele aan de later afwijkingen in de somieten (figuur 2), die verloren sterk chevron vorm gezien in de onbehandelde controles en zijn dichter bij de U-vormige somieten kenmerkend fenotypen gezien als sonic signaal wordt verminderd 14. De hoek van de somieten kan gemeten worden met standaard software en de hoek toeneemt van 92,1 ± 4,6 ° in de onbehandelde controles 122,6 ± 6,6 ° in ethanol behandeld embryo (p <0,001).

Een ander gevolg van blootstelling aan ethanol, dat zou kunnen zijn downstream van vroege ontwikkelingsachterstand en later notochorda gebreken is een verkorte lengte van het embryo (figuur 3). Zelfs meten embryo's rekening gehouden met de kromming door ethanol blootstelling ethanol blootstelling leidt tot een kortere stam die afhankelijk van de dosis ethanol embryo blootgesteld aan (figuur 3E 14). Deze bevinding is vergelijkbaar met de hardnekkigheid van prepuberteit een kleine gestalte bij kinderen blootgesteld aan ethanol tijdens de ontwikkeling 16, 17, wat suggereert dat de zebravis model relevant is voor het begrijpen van de menselijke geboorteafwijking.

Een van de kenmerken van klassieke FAS is een klassiek facies, waaronder een lagere kaak klein oog opening en een glad philtrum. Veel van deze kenmerken aan een vermindering in de middellijn weefsels. Het is aangetoond in diermodellen die zware ethanol blootstelling leidt tot nog duidelijker fenotypes zoals synopthalmia en cyclopie. Wanneer expozingen zebravis embryo's tot een verhoogde doses van ethanol, de intra-oculaire afstand (IOD) af op een dosis afhankelijke wijze (figuur 4) in overeenstemming met de aard van het menselijk geboorteafwijking. Cyclopie wordt alleen gevonden met erg hoge doses, maar lagere doseringen geen grote vermindering van de IOD (figuur 4) te produceren, waardoor dit diermodel een vergelijkbare fout in middellijn gezicht ontwikkeling 10 heeft.

Om het mechanisme achter de gebreken in zowel het lichaam en het gezicht door ethanol blootstelling te begrijpen, we wilden genexpressie veranderingen die optreden in het begin van ontwikkeling en dat redelijkerwijs kan worden verwacht dat zij bijdragen aan de latere defecten in de ontwikkeling vast te stellen. We doen dit op twee manieren, de winning van mRNA van embryo's zorgt voor een kwantitatieve evaluatie van de niveaus van genexpressie in ethanol behandeld embryo's in vergelijking met controles (figuur 1a). Bovendien, kunnen wij in situhybridisatie te kijken naar het patroon van genen, ongeacht of de signaal verlaagd (Figuur 1B G-18). In dit voorbeeld worden twee genen waarvan de expressie verminderd na blootstelling aan ethanol weergegeven gli1 en six3b. Wanneer we onderzocht in situ patroon six3b vonden we een vermindering van de ruimtelijke omvang van de expressie van dit gen (Figuur 1 EG) in embryo blootgesteld aan ethanol. Een overeenkomstige vermindering werd gevonden in het gen gsc (figuur BD). Zowel six3b en het SGR zijn uitgedrukt in weefsels bestemd om bij te dragen aan craniofaciale middellijn weefsels. Dus vermindering van deze genen 8 hpf is met de vermindering van IOD later gevonden zoals getoond in figuur 4.

Zodra genen die worden beïnvloed door ethanol geïdentificeerd, zijn mechanismen die de expressie daarvan kan worden verhoogd of verlaagd. In dit EXAmple, hebben we laten zien 2 genen die worden afgenomen (gli1 en six3b) door qPCR. We kozen ervoor om mRNA te injecteren om te bepalen of een omkering van die genen veranderingen kunnen de resultaten te verbeteren. Voor dit experiment, in plaats van het injecteren van gli1, hebben we ervoor gekozen om shh, een ligand dat gli1 niveau verhoogt injecteren. Voor six3b, konden we six3b zelf te injecteren. We vonden geen wijzigingen als we six3b (gegevens niet getoond) geïnjecteerd, maar waren in staat om fundamenteel de bruto gebreken in de zebravis embryo's te redden met extra shh injecties (figuur 5).

Figuur 1
Figuur 1. Ethanol belichting verandert het begin van de patroon en gen-expressie niveau van de geselecteerde ontwikkelings-genen. A) qPCR resultaten embryo's in 8hpf. De resultaten van twee genen worden weergegeven: six3b en gli1. Resultaten getoond als gemiddelde van drie afzonderlijke experimentenDe dosis ethanol getoond is 2,5%. Beide genen zijn verminderd een wijze die significant controle (t-test, p <0,05). BG) In situ hybridisatie van 8 HPF zebravis embryo's. Zowel de SGR en six3b patronen worden veranderd op dit tijdstip in vergelijking met de controlegroep. (Gewijzigd met toestemming van Loucks et al. 2007)..

Figuur 2
Figuur 2. Somiet ontwikkeling wordt gewijzigd behandelde embryo's. Somiet structuur en de hoeken zijn onderzocht op 48 hpf. In controle-embryo's (A), somieten hebben een chevron vorm en een scherpe hoek. Ethanol blootgesteld zebravis meer I-of U-vormige somieten, en minder scherpe hoeken. (Gewijzigd met toestemming van Loucks en Ahlgren 2009).

Figuur 3
Figuur 3. Ethanol behandeling vermindert aanzienlijk lichaamslengte in de zebravis.De lengte van onbehandelde en ethanol-blootgestelde embryo's werden gemeten bij 5 dagen postfertilization. Een aanzienlijke reductie in lengte gezien in alle behandelde embryo (ANOVA, p <0,001). BD. Er was een lichte maar significante vermindering van de totale lengte van embryo behandeld met 1,0% en 1,5% ethanol, dat een grotere vermindering werd waargenomen bij embryo gedoseerd met 2,0% en 2,5% ethanol. E. controle maat verschillen in elke koppeling werden de controle embryo voor elk experiment genormaliseerd tot 100, en sibling behandelde embryo uitgedrukt als een percentage van 100. (Gewijzigd met toestemming van Loucks en Ahlgren 2009).

Figuur 4
Figuur 4. Ethanol blootstelling resulteert in een vermindering van de intraoculaire afstand (IOD) in zebravisembryo's. A) frontaal uitzicht op de embryo's te tonen normale en gesmolten ogen fenotypes. B) Verschillende doses van ethanol toegediend gedurende 3 uur tijdens de gastrulatie resULT's in een verminderde iod wanneer de vis 24 uur later onderzocht. Fused ogen en cyclopie worden alleen gezien bij de hoogst geteste dosis (2,4%). * Duidt op een aanzienlijke vermindering iod vergelijking met controles. (Gewijzigd met toestemming van Ahlgren, 2004).

Figuur 5
Figuur 5. Shh-N mRNA injectie redt het bruto gebreken die door ethanol blootstelling van de zebravis. Een-twee-cel embryo's werden geïnjecteerd met 100 pg / nl shh-N mRNA en de helft van de geïnjecteerde embryo's werden blootgesteld aan de standaard ethanol doses 4,3 tot 24 HPF. Embryo's werden geanalyseerd op 5 dpf. Embryo's die behandeld worden met 2,0% ethanol vertonen dorsaal gebogen kortere staarten, I-vormige somieten en oogafwijkingen waaronder cyclopie. Redding van deze fenotypen wordt gezien in 71/76 van geïnjecteerde embryo's (93%). In deze embryo's is het lichaam recht de somieten zijn chevron gevormd, en de ogen volledig gescheiden.

Discussion

De hier beschreven methoden en de daarin vermelde resultaten tonen aan het uiteinde van hoe zebravis kan worden ontwikkelingsstoornissen ondervragen. Door de toegankelijkheid van de embryo, groot aantal eieren per koppeling en hoge reproduceerbaarheid van de resultaten, die vertebraten ideaal voor teratogeniteitsonderzoek. Vissen kunnen ook worden gemanipuleerd met fluorescerende moleculen bevatten die als een visuele reporter voor een gen of route van belang 19. In de ethanol studies, de gebruikte doses lijken vrij hoog in vergelijking met zoogdieren alcoholgehalte in het bloed. Echter, deze niveaus geven dat aanwezig is in het water en niet alle ethanol wordt aan de embryo.

Al met al, de methoden en vooral gedetailleerd suggereren dat zebravis embryo's zijn zeer nuttig in het modelleren van de mens aangeboren afwijkingen met betrekking tot ethanol blootstelling. Bovendien hebben de genexpressie veranderingen in de zebravis bevestigd door anderein de zoogdieren modelsystemen 20, wat suggereert dat de effecten op de ontwikkeling van ethanol worden behouden gedurende gewervelde dieren. Veel van de technieken uit het bovenstaande blijkt kan worden gebruikt met andere milieu-of farmaceutische beledigingen snel en gemakkelijk te detecteren potentieel teratogeen en bepalen de onderliggende mechanismen die bijdragen aan de teratogenese van een bepaalde stof.

Disclosures

Wij hebben niets te onthullen.

Acknowledgments

We willen Monte Westerfield, Makoto Kobayashi en Jacek Topczewski bedanken voor de gaven van plasmiden voor in situ hybridisatie en mRNA micro-injecties. Wij zijn dankbaar dat Steph Erhard voor het verschijnen in de video. Wij willen ook de hulp van William Goossens erkent met de confocale microscopie getoond in de video. Tyler Schwend die beelden die in de video, en Rodney Dale geholpen met de voorbereiding voor de video. We hebben ook erkennen de CMRC dierenverzorgers voor de fokkerij werk met de zebravis. Dit werk werd gefinancierd door NIH-subsidie ​​R21 AA13596 tot SCA.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
Het beoordelen van Teratogene Veranderingen in een zebravis model van foetale blootstelling aan alcohol
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter