Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Évaluer les changements tératogènes dans un modèle de poisson zèbre de l'exposition d'alcoolisation fœtale

doi: 10.3791/3704 Published: March 20, 2012

Summary

Afin de comprendre les mécanismes moléculaires des dommages induite par l'éthanol de développement, nous avons développé un modèle de poisson zèbre de l'exposition et l'éthanol sont à explorer les caractéristiques physiques, des altérations cellulaires et génétiques qui se produisent après exposition à l'éthanol

Abstract

Le syndrome d'alcoolisme fœtal (SAF) est une manifestation grave de l'exposition embryonnaire à l'éthanol. Il présente des défauts caractéristiques sur le visage et les organes, y compris un retard mental dû à des troubles du développement du cerveau et abîmés. Spectre de l'alcoolisation fœtale (ETCAF) est un terme utilisé pour couvrir un continuum d'anomalies congénitales qui se produisent en raison de la consommation maternelle d'alcool, et se produit dans environ 4% des enfants nés aux États-Unis. Avec 50% des femmes en âge de procréer état ​​d'une consommation d'alcool, et la moitié de toutes les grossesses non planifiées étant, l'exposition involontaire est un problème constant 2. Afin de mieux comprendre les dommages produits par l'éthanol, ainsi que de produire un modèle permettant de tester les interventions possibles, nous avons développé un modèle de développement exposition à l'éthanol en utilisant l'embryon du poisson zèbre. Le poisson zèbre sont idéales pour ce genre d'étude tératogène 3-8. Chaque paire pond des centaines d'oeufs, qui peuvent ensuite être collectées sans nuire à l'adultepoissons. L'embryon du poisson zèbre est transparent et peut être facilement visualisés avec n'importe quel nombre de taches. L'analyse de ces embryons après une exposition à l'éthanol à des doses et des temps différents de durée et de spectacles d'application que les défauts de développement bruts produits par de l'éthanol sont compatibles avec le défaut de naissance de l'homme. Décrites ici sont les techniques de base utilisées pour étudier et manipuler le modèle FAS poisson-zèbre.

Protocol

1. Traitement à l'éthanol d'embryons

  1. Embryons de poisson zèbre dérivés de type sauvage accouplements ont été soulevées à 28 ° C dans 5 ml d'eau embryon. (Eau Milli-Q avec 60 mg / L instantanée océan). Différentes souches de type sauvage embryons ont des tolérances légèrement différentes à l'éthanol d'exposition 9.
  2. L'exposition à l'éthanol a été amorcé au stade dôme (~ 4,3 après la fécondation heures, HPF) pour la durée souhaitée, à une impulsion de 24 h. Cette étape de départ est à peu près équivalent à l'étape d'implantation d'embryons de mammifères, juste avant la gastrulation. Concentrations d'éthanol utilisés vont de 0,2% -2,5%, en volume / volume. Des tests ont démontré que, entre 25-50% de la solution dans l'eau se retrouve dans l'embryon en développement 10, 11. Embryons sont maintenus à 28 ° C pendant la durée désirée du temps. Après la longueur désirée de l'exposition éthanol, la solution d'éthanol-eau est éliminée et remplacée par trois lavages de l'eau ordinaire et le poisson-zèbre maintenu fir la longueur de temps souhaitée. La spécificité du défaut dépend du temps d'apparition, la dose, et la longueur de l'impulsion de l'éthanol.

2. Collecte d'embryons pour l'ARN, hybridation in situ, les anticorps et la coloration du cartilage

  1. Pour recueillir des ARNm de la qPCR, l'âge des embryons présents sont recueillis dans des tubes eppendorf. Après élimination de l'eau le poisson-zèbre, un tampon de lyse avec le PTCE est ajouté. Un pulvérisateur motorisé est utilisé pour dissocier les embryons physiquement dans la solution de lyse. Il est ensuite passé à travers une colonne de préclair, ce qui supprime tous les morceaux non dissociés grandes. La solution résultante contient tous les macromolécules libérés par le processus de lyse. ARN est ensuite extrait en exécutant cette solution sur une colonne, suivie par des lavages et traitement à la DNase. L'élution est ensuite effectuée en utilisant de l'eau ou une solution d'élution fourni par le fabricant (5'-Premier). L'ARN peut être converti en ADNc en utilisant des techniques classiques pour qPCR ou utilisation de microl'analyse réseau.
  2. Pour l'hybridation in situ et la coloration des anticorps, des embryons de 6 à 24 HPF ont été fixés dans du paraformaldéhyde à 4% pendant une nuit à 4 ° C. Il est suivi par 3 lavages en PBS + 0,1% (PBT), les Tween de conserver des embryons de coller ensemble. Les embryons sont ensuite transférés à travers une série de 3 méthanol: PBT lave dans du méthanol à 100%, à quel point ils peuvent être stockés à -20 ° C. Ces embryons peuvent être utilisés pour l'hybridation in situ ou marquage par anticorps. Certains anticorps ne fonctionnent pas après le traitement du méthanol, de sorte cette mise en garde doit être pris en compte et votre anticorps spécifique testés afin de déterminer si cela va fonctionner après le traitement du méthanol.
  3. Pour la coloration du cartilage, les embryons doivent être porté à 5 ou 6 jours après la fécondation (DPF). Ils sont ensuite fixés dans du paraformaldéhyde à 4% pendant une nuit à 4 ° C, suivie de 3 lavages en PBT.

3. Évaluation induite par l'éthanol changements d'expression génétique et les conséquences développementales

    et hybridation in situ. qPCR est réalisé en utilisant des amorces conçues avec Integrated DNA Technologies (IDT) du logiciel, puis validée à l'aide de 3 échantillons biologiques distinctes. Une fois les amorces ont été validées, qPCR est effectuée sur l'ADNc créé à partir d'échantillons d'ARN recueilli. Chaque échantillon est testé en triple exemplaire. Les réactions de PCR sont gérés Platinum SYBR Green qPCR Super Mix (Invitrogen) sur une machine Chroma-4 PCR (BioRad) ou similaire machine à PCR avec un système de détection multicolore. En plus des gènes étant interrogés, il est essentiel que d'une sélection d'amorces est utilisée pour équilibrer de petites différences dans la préparation d'ADNc ou d'ARN. Pour nos embryons de poisson zèbre, nous utilisons GAPDH: 5'GAAGGTGGGAAACTGGTCAT3 »et 5'TTGCACCACCCTTAATGTGA3». Gènes étant analysés sont ensuite normalisées à des niveaux de quantification GAPDH une par rapport l'd'expression génique est calculée en utilisant la variation Procédé Pfaffl sur deux 12. Le calcul normale suppose que tous les gènes sont de l'ADN double emploi deux fois pour chaque cycle, et exprime ainsi les données en tant que rapport de la variation dans le gène expérimentale sur la variation dans le gène de référence, exprimé en calculs de puissance plus le nombre entier "2", qui est l'efficacité de doublement de l'ADN par cycle vu dans une réaction PCR parfaite. La méthode Pfaffl remplace le générique de "2" avec l'expérimentateur a généré une efficacité réelle pour les amorces de PCR choisi. Il reflète une réflexion plus précise de la différence dans les réactions PCR. La formule complète est la suivante:
    (Efficacité du gène expérimental) (Ct de l'échantillon de contrôle-Ct de l'échantillon traité)
    -------------------------------------------------- -----------------------------------
    (Efficacité du gène de référence) (Ct deéchantillon de contrôle - Ct de l'échantillon traité)
  1. Pour l'hybridation in situ, la digoxigénine (DIG)-étiquetés ribosondes sont construits à partir des plasmides contenant des portions du gène d'intérêt. Âge correspondant embryons sont exposés à des conditions standard à l'aide ribosondes 13 et détecté à l'aide d'anticorps anti-DIG couplés à la phosphatase alcaline qui permet l'emplacement du ribosondes marquées en utilisant une réaction colorée (NBT / BCIP). Les embryons sont ensuite visualisés à l'aide d'un microscope Leica dissection (figure 1B-G).
  2. Pour évaluer le développement morphogénétique, les embryons sont recueillis à l'heure souhaitée et examinés au microscope binoculaire. Pour la forme somite, embryons vivants sont imagés 14. Pour la distance oculaire inter et la longueur du corps, les embryons sont fixés en PFA. Dans tous les cas, les images de la région désirée sont capturées sur un microscope à dissection à un grossissement fixe et les mesures prises à l'aide d'Adobe Photoshop software 10,14.
  3. Pour examiner les effets du traitement sur les structures cartilagineuses en développement dans le poisson-zèbre larvaire, nous utilisons Alcian coloration bleue. Les larves du poisson zèbre fixe sont traitées avec une solution bleu alcian dissous dans l'éthanol à 80%: 20% d'acide acétique glacial (acide alcool) pendant plusieurs heures ou toute la nuit. Les larves sont décolorés dans plusieurs lavages de l'alcool l'acide avant d'être transféré à un 1% de KOH: solution à 3% de peroxyde d'hydrogène pour la compensation supplémentaire de cellules pigmentaires. Le poisson zèbre doivent être au moins 4 jours anciens pour montrer les structures cartilagineuses, et ceux-ci sont mieux définis dans les poissons qui sont 5 ou 6 jours.
  4. La mort cellulaire chez les embryons de vie est évaluée à l'aide d'acridine orange (AO). AO n'est pas perméable aux cellules pour les cellules vivantes, et se lie à l'ADN dans les cellules avec des membranes compromis, y compris ceux qui subissent l'apoptose et nécrose. Les embryons vivants sont incubées avec 5 mg / ml dans du PBS AO pendant 1 heure, suivie de 3 lavages en PBS. Les embryons sont ensuite imagé à l'aide du microscope confocal. Numérique Z-Serimages ies sont combinés pour créer des composites.

4. Manipulation de l'embryon du poisson zèbre

  1. Après l'identification des gènes qui sont diminués par exposition à l'éthanol, il est possible d'essayer de les remplacer par injection de l'ARNm conçu pour remplacer le gène manquant. ARNm plafonné est transcrit à partir des plasmides d'ADN en utilisant l'ARN polymérase linéarisées dans les kits de transcription in vitro, selon les instructions du fabricant (mMessage machine, Applied Biosystems). Entre 25-200 pg / nl d'ARN est injecté dans des oeufs de cellules 1-2 étape de poisson-zèbre, dans une solution de 0,1 M de KCl. Les embryons sont ensuite autorisés à récupérer avant d'être traitée avec de l'éthanol comme décrit ci-dessus (Figure 5).
  2. Pour toutes les transcriptions des gènes qui augmentent par exposition à l'éthanol, ils peuvent être réduits, ou «knock-down" en utilisant une technologie antisens morpholino. Antisens morpholinos (OMA) sont conçus par les outils de Gene entreprise, et de bloquer la traduction de l'ARN en protéines, ou block la maturation et d'épissage de l'ARN, en fonction de la nécessité expérimentale. Cette action de morpholinos limiter la quantité de protéine active pour le gène ciblé, un déficit qui peut être mesurée à l'aide anitibodies si elles sont disponibles. L'efficacité de morpholinos d'épissage des ARN peut être mesurée en utilisant la RT-PCR afin de détecter les quantités relatives de transcrits épissés et non épissés. Titration du morpholino peut entraîner dose-dépendante l'activité 15. OMA sont dilués aux concentrations de travail (titré pg à la concentration ng) dans une solution Danieau (58 mM de NaCl, 0,7 mM de KCl, 0,4 mM MgSO 4, 0,6 mM de Ca (NO 3) 2, 5 mM de HEPES, pH 7,6). L'injection a lieu au stade 1-2-cellule, puis les embryons sont autorisés à développer avant d'être soumis à un traitement éthanol comme ci-dessus.

5. Les résultats représentatifs

L'exposition à des résultats embryon du poisson zèbre éthanol dans un certain nombre de défauts de développement et génétiques qui sont liés àles phénotypes trouve chez les autres vertébrés. Nous avons documenté le développement anormal des tissus axiaux, y compris la notocorde (données non présentées 14). Le retard de développement par l'éthanol conduit apparemment à la perturbation de notocorde allongement appropriée, conduisant à une raccourcie et parfois perturbé notocorde (données non présentées 14). Ce retard au début et vice notochorde conduit probablement en partie à des anomalies plus tard dans les somites (figure 2), qui ont perdu leur forme forte chevron comme on le voit dans les témoins non traités, et sont plus proches des somites en forme de U caractéristiques des phénotypes observés lorsque sonique signalisation est réduite 14. L'angle des somites peut être mesurée en utilisant un logiciel standard, et l'angle augmente de 92,1 ± 4,6 ° dans les témoins non traités à 122,6 ± 6,6 ° dans les embryons d'éthanol traités (p <0,001).

Une autre conséquence de l'exposition d'éthanol qui pourrait être downstream de retard de développement précoce et plus tard les défauts notochorde est une longueur raccourcie de l'embryon (Figure 3). Même mesure embryons de prendre en compte la courbure produite par exposition à l'éthanol, l'éthanol exposition conduit à un tronc raccourcie qui dépend de la dose de l'éthanol de l'embryon a été exposé à (Figure 3E 14). Cette constatation est similaire à la persistance de la prépuberté petite taille chez les enfants exposés à l'éthanol au cours du développement 16, 17, suggérant que le modèle de poisson zèbre est pertinente pour la compréhension de l'anomalie congénitale de l'homme.

Une des caractéristiques classiques de la SAF est un faciès classiques, y compris une mâchoire réduite, ouverture des yeux petits, et un philtrum lisse. Une grande partie de ces caractéristiques sont liées à une réduction dans les tissus médianes. Il a été démontré dans des modèles animaux que l'exposition éthanol sévère conduit à des phénotypes encore plus prononcées, y compris synopthalmia et cyclopie. Lorsque expochanter embryons de poisson zèbre à des doses accrues d'éthanol, la distance intra-oculaire (IOD) diminue de façon dose-dépendante (figure 4) conforme à la nature de l'anomalie congénitale de l'homme. Cyclopia n'est observé avec des doses très élevées, mais des doses plus faibles ne produisent une réduction significative de l'IOD (Figure 4), ce qui suggère que ce modèle animal a un défaut similaire dans le développement facial ligne médiane 10.

Afin de comprendre le mécanisme sous-tendant les défauts à la fois dans le corps et le visage produite par exposition à l'éthanol, nous avons cherché à établir les variations d'expression des gènes qui se produisent tôt dans le développement et qui pourraient raisonnablement être tenus de contribuer à des défauts de développement plus tard. Nous faisons cela de deux manières, l'extraction de l'ARNm à partir d'embryons permet une évaluation quantitative des niveaux d'expression des gènes dans les embryons traités d'éthanol par rapport aux témoins (figure 1A). En outre, nous pouvons effectuer in situl'hybridation à comparer à la configuration des gènes, indépendamment de si oui ou non le signal est diminué (figure 1B-G 18). Dans cet exemple, deux gènes dont l'expression est diminuée après une exposition à l'éthanol sont présentés, et Gli1 six3b. Lorsque nous avons examiné le modèle en place pour six3b, nous avons trouvé une réduction de l'étendue spatiale de l'expression de ce gène (Figure 1 EG) dans les embryons exposés à l'éthanol. Une réduction similaire a été trouvé au sein du SGC gène (Figure BD). Les deux six3b et la CGC sont exprimés dans les tissus destinés à contribuer à la ligne médiane craniofaciales tissus. Donc, la réduction de ces gènes à 8 HPF est compatible avec la réduction de la IOD retrouvé plus tard comme le montre la figure 4.

Une fois que les gènes qui sont touchés par de l'éthanol sont identifiés, il existe des mécanismes par lesquels l'expression d'entre eux peuvent être augmentés ou diminués. Dans ce EXA particuliermple, nous avons montré 2 gènes qui sont diminués (Gli1 et six3b) par qPCR. Nous avons choisi d'injecter l'ARNm afin de déterminer si l'inversion de ces modifications géniques peuvent améliorer les résultats. Pour cette expérience, au lieu d'injecter Gli1, nous avons choisi d'injecter chut, un ligand qui augmente Gli1 niveaux. Pour six3b, nous étions en mesure d'injecter six3b lui-même. Nous avons trouvé aucun changement lorsque nous avons injecté six3b (données non présentées), mais ont réussi à sauver les défauts fondamentalement bruts dans embryons de poisson zèbre avec droit de reprise chut injections (Figure 5).

Figure 1
Exposition à l'éthanol Figure 1. Modifie le modèle précoce et les niveaux d'expression des gènes sélectionnés d'gènes du développement. A) les résultats de qPCR pour les embryons à 8hpf. Les résultats pour deux gènes sont affichés: six3b et Gli1. Les résultats présentés dans la moyenne de trois expériences distinctes,et la dose d'éthanol indiquée est de 2,5%. Les deux gènes sont réduits d'une manière qui soit significative du contrôle (test t, p <0,05). BG) L'hybridation in situ de 8 embryons de poisson zèbre HPF. De la CGC et les modèles sont modifiés six3b à ce point dans le temps par rapport aux témoins. (Mise à jour avec la permission de Loucks et al. 2007).

Figure 2
Figure 2. Développement somite est altérée chez les embryons traités. La structure des somites et les angles sont examinés à 48 HPF. Dans les embryons de contrôle (A), les somites ont une forme en chevron et un angle aigu. Le poisson-zèbre éthanol exposés ont des angles plus ou I-U somites, et moins forte. (Mise à jour avec la permission de Loucks et Ahlgren 2009).

Figure 3
Figure 3. Traitement à l'éthanol diminue de manière significative la longueur du corps chez le poisson zèbre.La longueur des embryons non traités et de l'éthanol-exposée ont été mesurées à 5 post-fécondation jours. Une réduction significative de la longueur a été observée dans tous les embryons traités (ANOVA, p <0,001). BD. Il y avait une réduction légère mais significative de la longueur totale des embryons traités avec 1,0% et 1,5% d'éthanol, tandis qu'une plus grande réduction a été observée chez les embryons ayant reçu 2,0% et 2,5% d'éthanol. E. Afin de contrôler les différences de taille dans chaque embrayage, les embryons de contrôle pour chaque expérience ont été normalisés à 100, et les embryons traités frères et sœurs, exprimée en pourcentage de 100. (Mise à jour avec la permission de Loucks et Ahlgren 2009).

Figure 4
Figure 4. Résultats exposition à l'éthanol à une réduction de la distance intra-oculaire (IOD) dans des embryons de poisson zèbre. A) des vues frontales de démontrer embryons phénotypes oculaires normales et fondue. B) différentes doses d'éthanol administré pendant 3 heures au cours res gastrulationÜLTS diminué Iod lorsque les poissons sont examinés 24 heures plus tard. Yeux Fondus et cyclopie ne sont vus à la plus forte dose testée (2,4%). * Indique une réduction significative de iod par rapport aux témoins. (Modifiée avec la permission de Ahlgren, 2004).

Figure 5
Figure 5. D'injection d'ARNm chut-N sauve les défauts bruts produits par exposition à l'éthanol du poisson zèbre. Embryons de cellules Une-deux ont été injectés avec 100 pg / nl chut-N ARNm et la moitié des embryons injectés ont été exposés à des doses d'éthanol standards de 4,3 à 24 HPF. Les embryons ont été analysés à 5 dpf. Les embryons traités avec de l'éthanol 2,0% présentent dorsalement courbe des extrémités plus courtes, je forme somites, et les défauts oculaires, y compris cyclopie. Sauvetage de ces phénotypes est vu dans 71/76 d'embryons injectés (93%). Dans ces embryons, le corps est droit, les somites sont chevron en forme, et les yeux sont complètement séparés.

Discussion

Les méthodes décrites ici et les résultats présentés démontrent que la pointe de la façon dont le poisson-zèbre peut être utilisé pour interroger des anomalies du développement. En raison de l'accessibilité de l'embryon, le nombre élevé d'œufs pondus pour chaque embrayage, et une reproductibilité élevée des résultats, ces vertébrés sont idéales pour des études tératogènes. Les poissons peuvent aussi être manipulés pour contenir des molécules fluorescentes pour l'utiliser comme un journaliste visuel pour un gène particulier ou d'une filière d'intérêts 19. Dans les études d'éthanol, les doses utilisées semblent assez élevé par rapport à un taux d'alcoolémie de mammifères. Toutefois, ces niveaux reflètent ce qui est présent dans l'eau, et non l'ensemble de l'éthanol est livré à l'embryon.

Pris dans leur ensemble, les méthodes décrites et détaillées ci-dessus suggèrent que les embryons de poisson zèbre sont très utiles dans la modélisation des anomalies congénitales de l'homme liés à l'exposition d'éthanol. En outre, les changements d'expression des gènes trouvés chez le poisson zèbre ont été confirmés par d'autresdans les systèmes modèles mammifères 20, suggérant que les effets sur le développement de l'éthanol sont conservées à travers les vertébrés. Bon nombre des techniques démontrées ci-dessus peut être utilisé avec d'autres agressions de l'environnement ou de la pharmacie à rapidement et facilement détecter des agents tératogènes potentiels et de déterminer les mécanismes sous-jacents qui contribuent à la tératogenèse d'une substance particulière.

Disclosures

Nous n'avons rien à communiquer.

Acknowledgments

Nous tenons à remercier Monte Westerfield, Makoto Kobayashi et Jacek Topczewski pour les dons de plasmides pour l'hybridation in situ et micro-injections d'ARNm. Nous sommes reconnaissants à Steph pour Erhard apparaissant dans la vidéo. Nous tenons également à souligner l'aide de William Goossens avec la microscopie confocale montré dans la vidéo. Tyler Schwend fourni des images utilisées dans la vidéo, et Rodney Dale a aidé à la préparation pour la vidéo. Nous reconnaissons également le personnel de soins des animaux CMRC pour leur travail d'élevage avec le poisson zèbre. Ce travail a été financé par le NIH subvention R21 AA13596 SCA.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter