Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Avaliar as alterações teratogênicos em um modelo de Zebrafish de exposição fetal ao álcool

doi: 10.3791/3704 Published: March 20, 2012

Summary

A fim de compreender os mecanismos moleculares dos danos induzida por etanol de desenvolvimento, temos desenvolvido um modelo de peixe-zebra de exposição ao etanol e estão explorando as características físicas, as alterações celulares e genéticas que ocorrem após a exposição ao etanol

Abstract

Síndrome Alcoólica Fetal (SAF) é uma manifestação grave da exposição ao etanol embrionário. Apresenta-se com defeitos característicos para o rosto e órgãos, incluindo retardo mental devido ao desenvolvimento do cérebro desordenado e danificados. Fetal álcool espectro desordem (FASD) é um termo usado para cobrir um continuum de defeitos congênitos que ocorrem devido ao consumo de álcool materno, e ocorre em aproximadamente 4% das crianças nascidas nos Estados Unidos. Com 50% das mulheres em idade fértil relatar o consumo de álcool, e metade de todas as gestações sendo planejada, a exposição involuntária é uma emissão contínua 2. A fim de melhor compreender os danos produzidos pelo etanol, além de produzir um modelo com o qual para testar potenciais intervenções, foi desenvolvido um modelo de exposição ao etanol de desenvolvimento utilizando o embrião do peixe-zebra. Zebrafish são ideais para este tipo de estudo teratogênico 3-8. Cada par estabelece centenas de ovos, o que pode então ser recolhidos sem prejudicar o adultopeixe. O embrião do peixe-zebra é transparente e pode ser prontamente fotografada com qualquer número de manchas. A análise destes embriões após a exposição ao etanol em doses diferentes e os tempos de duração e mostra aplicação de que os defeitos brutas de desenvolvimento produzidos por etanol são consistentes com o defeito de nascença humano. Aqui descritas são as técnicas básicas utilizadas para estudar e manipular o modelo FAS zebrafish.

Protocol

1. O tratamento de etanol de Embriões

  1. Embriões derivados de peixe-zebra de tipo selvagem acasalamentos foram levantadas a 28 ° C em 5 ml de água embrião. (Água Milli-Q com 60 mg / L instantânea Oceano). Diferentes cepas de tipo selvagem embriões têm tolerâncias ligeiramente diferentes para etanol exposição 9.
  2. A exposição ao etanol foi iniciada a fase de cúpula (~ 4,3 fertilização pós horas, HPF) para o período de tempo desejado, até a um pulso de 24 horas. Esta fase inicial é aproximadamente equivalente à fase de implantação de embriões de mamíferos, pouco antes da gastrulação. As concentrações de etanol utilizado gama de 0,2% -2,5%, em volume / volume. Testes demonstraram que entre 25-50% da solução na água acaba no embrião em desenvolvimento 10, 11. Os embriões são mantidos a 28 ° C durante o período de tempo desejado. Após o comprimento desejado de exposição ao etanol, a solução de etanol-água é removido e substituído com três lavagens de água de peixe zebra regular e mantida for do comprimento de tempo desejado. A especificidade do defeito depende do tempo de início, a dose, eo comprimento do impulso de etanol.

2. Colecção de embriões para RNA, a hibridização in situ, Anticorpo e coloração Cartilagem

  1. Para a coleta de mRNA para qPCR, idade embriões encontrados são coletados em tubos de eppendorf. Após a remoção da água do peixe-zebra, tampão de lise com TCEP é adicionado. Um pulverizador motorizado é utilizado para dissociar fisicamente os embriões na solução de lise. Este é então passada através de uma coluna preclear, que remove todos os pedaços não dissolvidas grandes. A solução resultante contém todas as macromoléculas libertada pelo processo de lise. O RNA é então extraída através da execução desta solução sobre uma coluna, seguido por lavagens e tratamento de DNAse. A eluição é então realizado utilizando água ou uma solução de eluição fornecido pelo fabricante (5'-Prime). O RNA pode ser convertido em ADNc utilizando técnicas padrão para qPCR ou utilizados em microA análise de matriz.
  2. Para hibridação in situ e coloração do anticorpo, os embriões de 6 a 24 hpf foram fixadas em paraformaldeído a 4% durante a noite a 4 ° C. Isto é seguido por 3 lavagens em PBS + 0,1% de Tween (PBT), para manter os embriões colem. Os embriões são então transferidos através de uma série de metanol a 3: PBT lava em metanol a 100%, ponto em que eles podem ser armazenados a -20 ° C. Estes embriões podem ser utilizados para hibridação in situ ou a coloração do anticorpo. Alguns anticorpos não funcionam após o tratamento de metanol, de modo que este ressalva precisa de ser tidas em conta eo seu anticorpo específico testado para determinar se ele vai trabalhar após o tratamento metanol.
  3. Para a coloração de cartilagem, os embriões precisam de ser aumentado para 5 ou 6 dias pós fertilização (dpf). Eles são em seguida fixados em paraformaldeído a 4% durante a noite a 4 ° C, seguido de 3 lavagens em PBT.

3. Avaliando induzidas por etanol Gene alterações de expressão e consequências desenvolvimentais

    e hibridação in situ. qPCR é conseguido usando primers desenhados com Integrated DNA Technologies (IDT), software, então validado com 3 diferentes amostras biológicas. Uma vez que os primers foram validadas, qPCR é realizada em cDNA produzido a partir de amostras recolhidas de RNA. Cada amostra é executado em triplicata. As reacções de PCR são executados Platinum SYBR Green qPCR Super mistura (Invitrogen) em uma máquina de PCR Chroma-4 (BioRad) ou máquina de PCR semelhante com um sistema de detecção de multicolor. Para além dos genes a ser interrogado, é crítico que um conjunto de iniciadores de controlo é usado para equilibrar pequenas diferenças na preparação de cDNA ou RNA. Para os nossos embriões do zebrafish, usamos GAPDH: 5'GAAGGTGGGAAACTGGTCAT3 'e 5'TTGCACCACCCTTAATGTGA3'. Genes sendo analisadas são, então, normalizada para níveis de GAPDH uma quantificação relativa de expressão do gene é calculada usando a variação do método Pfaffl em 2 12. O cálculo normais assume que todos os genes são duplicar o DNA duas vezes para cada ciclo e, portanto, expressa os dados como a razão entre a mudança no gene experimental sobre a mudança no gene de referência, expresso como cálculos de potência durante o inteiro "2", que é a eficiência de duplicação da população de DNA por ciclo visto numa reacção de PCR perfeito. O método Pfaffl substitui o "2" genérico com o experimentador gerada eficiência verdadeiro para o primers PCR escolhido. Isto reflete uma reflexão mais precisa da diferença nas reacções de PCR. A fórmula completa é:
    (Eficiência do gene experimental) (Ct do controle de amostra-Ct da amostra tratada)
    -------------------------------------------------- -----------------------------------
    (Eficiência do gene de referência) (Ct deamostra de controlo - Ct da amostra tratada)
  1. Para hibridação in situ, digoxigenina (DIG)-rotulados riboprobes são construídos a partir de plasmídeos contendo porções do gene de interesse. Da mesma idade embriões são expostos a riboprobes usando condições padrão 13 e detectado utilizando anticorpos anti-dig anticorpos acoplados com fosfatase alcalina que permite que a localização dos riboprobes rotulados com uma reacção de cor (NBT / BCIP). Os embriões são então visualizada utilizando um microscópio de dissecação Leica (Figura 1B-G).
  2. Para avaliar o desenvolvimento morfogênica, os embriões são recolhidos no momento desejado e examinadas ao microscópio de dissecação. Para somito forma, embriões vivos são gravadas 14. Para distância ocular inter e comprimento do corpo, os embriões são fixadas em PFA. Em todos os casos, as imagens da região desejada são capturados sobre um microscópio de dissecação com uma ampliação fixa e medições tomadas usando o Adobe Photoshop software 10,14.
  3. Para examinar os efeitos do tratamento sobre as estruturas de cartilagem em desenvolvimento no peixe-zebra larval, usamos coloração com azul Alcian. Larvas do peixe fixo são tratados com solução de azul Alcian dissolvido em etanol a 80%: 20% de ácido acético glacial (álcool de ácido), durante várias horas ou durante a noite. As larvas são descorados em várias lavagens de álcool de ácido antes de ser transferido para um KOH a 1%: solução de peróxido de hidrogénio a 3% para a compensação adicional de células de pigmento. Zebrafish precisam de ser pelo menos 4 dias de idade para mostrar as estruturas de cartilagem, e estes são melhor definida em peixes que têm 5 ou 6 dias de idade.
  4. A morte celular em embriões vivos é avaliada através de laranja de acridina (AO). AO não é permeável célula para as células vivas, e se liga ao DNA em células comprometidas com as membranas, incluindo aqueles apoptose e necrose. Embriões vivos são incubadas com 5 mg / AO ml em PBS durante 1 hora, seguido de 3 lavagens em PBS. Os embriões são então trabalhada usando o microscópio confocal. Digital Z-Series imagens são combinadas para criar composições.

4. Manipulação do Embrião Zebrafish

  1. Após a identificação de genes que são diminuídos por exposição ao etanol, é possível para tentar substituir-las utilizando a injecção de ARNm concebido para substituir o gene em falta. MRNA capped é transcrito a partir de plasmídeos ADN linearizado usando polimerase de RNA em kits de transcrição in vitro, de acordo com as instruções dos fabricantes (mMessage Machine, Applied Biosystems). Entre 25-200 pg / nl de RNA é injectado 1-2 celulares ovos peixe-zebra fase, em uma solução de 0,1 M de KCl. Os embriões são então deixados a recuperar, antes de ser tratado com etanol como descrito acima (Figura 5).
  2. Para quaisquer transcritos do gene que são aumentados por exposição ao etanol, eles podem ser reduzidos, ou "bateu-down" usando um anti-sentido tecnologia morfolino. Antisense morpholinos (AMOS) são projetados nas ferramentas Gene da empresa, e bloquear a tradução do RNA em proteína, ou block maturação e splicing de RNA, dependendo da necessidade experimental. Esta acção de morpholinos limitar a quantidade de proteína activa para o gene alvo, um défice que pode ser medido utilizando anitibodies se estiverem disponíveis. A eficiência de morpholinos de splicing de RNA pode ser medido utilizando RT-PCR para detectar as quantidades relativas de transcrições splicing e unspliced. Titulando do morfolino pode resultar em actividade dependente da dose 15. AMOS são diluídas para concentrações de trabalho (titulada pg a concentração ng) em Danieau solução (58 mM de NaCl, 0,7 mM de KCl, 0,4 mM MgSO4, 0,6 mM de Ca (NO3) 2, 5 mM de HEPES, pH 7,6). Injecção tem lugar na fase 1-2-célula, em seguida, os embriões são permitidos para desenvolver antes de ser submetido a tratamento etanol como descrito acima.

5. Os resultados representativos

Exposição de embriões de peixe zebra para os resultados de etanol em um número de defeitos do desenvolvimento e genéticos que estão relacionados comos fenótipos encontrada em outros vertebrados. Temos documentado desenvolvimento anormal de tecidos axiais, incluindo o notocórdio (dados não mostrados 14). O atraso do desenvolvimento produzido por etanol aparentemente leva a perturbações de alongamento notocórdio adequada, conduzindo a um notocórdio encurtado e, ocasionalmente, interrompido (dados não mostrados 14). Este atraso no início e defeito notocórdio provável conduz, em parte, as anormalidades posteriormente nas sómitos (Figura 2), que perderam a sua forma de divisa forte, como visto nos controlos não tratados, e estão mais próximas dos somitos em forma de U característicos de fenótipos observados quando se sónica sinalização é reduzida 14. O ângulo das sómitos pode ser medida utilizando software padrão, e os aumentos do ângulo a partir de 92,1 ± 4,6 ° nos controlos não tratados para 122,6 ± 6,6 ° nos embriões de etanol tratado (p <0,001).

Uma outra consequência da exposição ao etanol que pode ser downstream de atraso no desenvolvimento precoce e defeitos posteriores notocórdio é um comprimento reduzido do embrião (Figura 3). Mesmo medindo embriões para ter em conta a curvatura produzida por exposição ao etanol, a exposição ao etanol conduz a um tronco encurtado que é dependente da dose de etanol no embrião foi exposto a (Figura 3E 14). Este achado é semelhante à persistência da pré-puberdade baixa estatura encontrada em crianças expostas à etanol durante o desenvolvimento 16, 17, sugerindo que o modelo de peixe-zebra é relevante para a compreensão do defeito de nascença humano.

Uma das características clássicas da FAS é uma fácies clássicos, incluindo uma mandíbula reduzida, a abertura dos olhos pequenos, e um filtro suave. Grande parte destas características estão relacionados com uma redução nos tecidos da linha média. Tem sido demonstrado em modelos animais de que a exposição de etanol grave leva a fenótipos ainda mais pronunciada, incluindo synopthalmia e ciclopia. Quando expocante embriões peixe-zebra a doses crescentes de etanol, a distância intra-ocular (IOD) diminui de uma forma dependente da dose (Figura 4) consistente com a natureza do defeito de nascença humano. Cyclopia é encontrado apenas com doses muito elevadas, mas as doses mais baixas não produzem uma redução significativa na IOD (Figura 4), ​​sugerindo que este modelo animal tem um defeito semelhante em desenvolvimento facial linha média 10.

A fim de compreender o mecanismo subjacente aos defeitos de corpo e rosto produzido pela exposição ao etanol, buscou-se estabelecer as alterações de expressão gênica que ocorrem no início do desenvolvimento e que se pode razoavelmente esperar contribuir para defeitos de desenvolvimento posteriores. Fazemos isso de duas maneiras, a extracção de mRNA a partir de embriões permite uma avaliação quantitativa dos níveis de expressão do gene em embriões de etanol tratados em comparação com os controlos (Figura 1A). Além disso, pode-se realizar in situhibridação a olhar para o padrão de genes, independentemente de estar ou não o sinal é diminuída (Figura 1B-G 18). Neste exemplo, dois genes cuja expressão é diminuída após a exposição ao etanol são mostrados, gli1 e six3b. Quando examinámos o padrão em situ para six3b, notou-se uma redução na extensão espacial da expressão deste gene (Figura 1 EG) em embriões expostos ao etanol. Uma redução semelhante foi encontrado no SGC gene (Figura BD). Ambos six3b e gsc são expressos em tecidos destinados a contribuir para craniofaciais tecidos da linha média. Assim, a redução destes genes em 8 hpf é consistente com a redução na IOD encontrado mais tarde, como mostrado na Figura 4.

Uma vez que os genes que são afectados por etanol são identificados, existem mecanismos pelos quais a expressão deles pode ser aumentado ou diminuído. Em particular, este example, mostrámos 2 genes que são diminuídos (gli1 e six3b) por qPCR. Optou-se por injetar mRNA para determinar se a inversão dessas alterações genéticas podem melhorar os resultados. Para esta experiência, em vez de injetar gli1, optou-se por injetar shh, um ligante que aumenta gli1 níveis. Para six3b, fomos capazes de injetar six3b si. Não foram encontradas alterações quando injectados six3b (dados não mostrados), mas eram capazes de fundamentalmente resgatar os defeitos bruto em embriões com peixe-zebra suplementar shh injecções (Figura 5).

A Figura 1
A Figura 1 exposição ao etanol. Muda o padrão precoce e níveis de expressão dos genes seleccionados genes de desenvolvimento. A) resultados para qPCR embriões em 8hpf. Os resultados de dois genes são exibidas: six3b e gli1. Resultados apresentados como média de três experiências separadas,ea dose de etanol mostrado é de 2,5%. Ambos os genes são reduzidos de uma maneira que é significativo de controlo (teste t, p <0,05). BG) A hibridação in situ de 8 embriões peixe-zebra HPF. Ambos gsc e padrões six3b são alterados neste ponto do tempo em comparação aos controles. (Modificado com a permissão de Loucks et al. De 2007).

A Figura 2
Figura 2. Desenvolvimento somito é alterada em embriões tratados. Somito estrutura e os ângulos são examinados em 48 hpf. Em embriões de controlo (A), sómitos têm uma forma Chevron e um ângulo agudo. Zebrafish etanol expostos têm mais ângulos I ou U-shaped somitos, e menos acentuada. (Modificado com a permissão de Loucks e Ahlgren 2009).

A Figura 3
3 A Figura. Tratamento com etanol diminui significativamente o comprimento do corpo em peixes-zebra.O comprimento de embriões não tratados e etanol-exposto foram medidos em 5 dias pós-fertilização. Uma redução significativa de comprimento foi visto em todos os embriões tratados (ANOVA, p <0,001). BD. Houve uma redução ligeira, mas significativa, o comprimento total de embriões tratados com 1,0% e 1,5% de etanol, enquanto que uma maior redução foi observada em embriões doseados com 2,0% e 2,5% de etanol. E. Para controlar as diferenças de tamanho em cada embraiagem, os embriões de controlo para cada experiência foram normalizados para 100, e os embriões tratados com irmãos expresso como uma percentagem de 100. (Modificado com a permissão de Loucks e Ahlgren 2009).

A Figura 4
Figura 4. Resultados Etanol de exposição a uma redução na distância intra-ocular (IOD) em embriões de peixe-zebra. A) vista frontal de embriões demonstrar fenótipos olhos normais e fundida. B) doses Diferentes de etanol administrado durante 3 horas durante res gastrulaçãoÜLTS na diminuição IOD quando os peixes são examinados 24 horas depois. Olhos fundido e ciclopia só são vistas na dose mais elevada testada (2,4%). * Indica uma redução significativa na IOD comparativamente aos controlos. (Modificado com a permissão de Ahlgren, 2004).

A Figura 5
Figura 5. Injecção mARN SHH-N resgata os defeitos brutos produzidos por exposição ao etanol de peixe-zebra. Embriões uma-duas células foram injectados com 100 pg / nl mRNA SHH-N e metade dos embriões injectados foram expostas para as doses de etanol padrão de 4,3-24 hpf. Os embriões foram analisadas em 5 dpf. Os embriões tratados com etanol 2,0% exibem dorsalmente curvo caudas mais curtas, eu em forma de somitos e defeitos oculares, incluindo ciclopia. Resgate de estes fenótipos é visto em 71/76 de embriões injectados (93%). Nestes embriões, o corpo é reta, os somitos são chevron em forma, e os olhos estão completamente separadas.

Discussion

Os métodos aqui descritos e os resultados mostrados demonstrar apenas a ponta do peixe-zebra como pode ser usado para interrogar defeitos de desenvolvimento. Por causa da acessibilidade do embrião, elevado número de ovos postos por cada embraiagem, e elevada reprodutibilidade dos resultados, estes vertebrados são ideais para estudos teratogénicos. Os peixes podem também ser manipulada para conter moléculas fluorescentes para usar como um repórter visual para um gene particular, ou via de interesse 19. Nos estudos de etanol, as doses utilizadas aparecem bastante elevada em comparação com os níveis de álcool de mamíferos de sangue. No entanto, estes níveis de reflectir o que está presente na água, e não todo o etanol é entregue ao embrião.

Tomados em conjunto, os métodos descritos e detalhados acima sugerem que os embriões do zebrafish são muito úteis na modelagem de defeitos congênitos humanos relacionados à exposição ao etanol. Além disso, as alterações da expressão do gene encontrados no peixe-zebra foram confirmados por outrosnos sistemas modelo de mamífero 20, sugerindo que os efeitos no desenvolvimento de etanol são retidos através vertebrados. Muitas das técnicas demonstradas acima pode ser usado com outros insultos ambientais ou farmacêutica para rápida e facilmente detectar teratógenos potenciais e determinar os mecanismos subjacentes que contribuem para a teratogênese de uma substância em particular.

Disclosures

Não temos nada a divulgar.

Acknowledgments

Queremos agradecer Monte Westerfield, Makoto Kobayashi e Jacek Topczewski para os presentes de plasmídeos para a hibridização in situ e microinjeções de mRNA. Somos gratos a Steph Erhard para aparecer no vídeo. Gostaríamos também de agradecer a ajuda de William Goossens com a microscopia confocal mostrado no vídeo. Tyler Schwend fornecido as imagens usadas no vídeo, e Rodney Dale assistida com a preparação para o vídeo. Reconhecemos também a equipe de cuidados de CMRC animal para seu trabalho com a criação de peixe-zebra. Este trabalho foi financiado pelo NIH concessão R21 AA13596 a SCA.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
Avaliar as alterações teratogênicos em um modelo de Zebrafish de exposição fetal ao álcool
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter