Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Fetal Alkol Pozlama bir Zebra balığı Modelinde teratojenik değişiklikler değerlendirilmesi

doi: 10.3791/3704 Published: March 20, 2012

Summary

Etanol bağlı gelişimsel hasar moleküler mekanizmalarını anlayabilmek için, biz etanol maruz kalma zebrabalıkları modeli geliştirdik ve etanol maruz kaldıktan sonra meydana gelen fiziksel, hücresel ve genetik değişimler keşfediyoruz

Abstract

Fetal alkol sendromu (FEF) etanol embriyonik maruz kalma ciddi bir tezahürüdür. Özellikle yüz ve düzensiz ve hasarlı beyin gelişimi nedeniyle zeka geriliği de dahil olmak üzere organlara karakteristik kusurları ile sunuyor. Fetal alkol spektrum bozukluğu (FASD) anne alkol tüketimi nedeniyle meydana doğum kusurları bir süreklilik karşılamak için kullanılan bir terimdir ve Amerika Birleşik Devletleri'nde doğan çocukların yaklaşık% 4'ünde görülür. Doğurganlık çağındaki kadınların% 50 alkol tüketimi, raporlama ve tüm gebeliklerin yarısı plansız olmak, kasıtsız maruz devam eden bir sorun 2'dir. Iyi etanol tarafından üretilen hasar anlamak, artı potansiyel müdahalelerin test etmek ile bir model üretmek için, biz zebrabalıkları embriyo kullanarak gelişimsel etanol maruz kalma bir model geliştirmiştir. Zebra balığı teratojen çalışmanın 3-8 bu tür için idealdir. Her bir çifti daha sonra yetişkin zarar vermeden alınabilir yüzlerce yumurta, bırakırbalık. Zebra balığı embriyo şeffaf ve lekeleri kolayca herhangi bir sayı ile görüntülenebilir. Bu embriyoların Analizi etanol üretilen brüt gelişimsel kusurlar insan doğum defekti ile uyumlu olduğunu süresi ve uygulama şovlarının farklı doz ve zamanlarda etanol maruz kaldıktan sonra. Zebra balığı FEF modelini incelemek ve işlemek için kullanılan temel teknikleri burada nitelendirdi.

Protocol

1. Embriyoların Etanol tedavisi

  1. Vahşi tip çiftleşmelerin türetilen zebrafish embriyosu 28 yetiştirilen edildi embriyo 5 ml kadar su içinde ° C. (Milli-Q 60 mg / L Instant Ocean ile su). Vahşi tip embriyoların farklı suşları maruz 9 etanol biraz farklı toleranslar var.
  2. Etanol maruz kalmak kadar 24 saatlik bir nabız, zaman istenilen uzunluğu kubbe kademeli (~ 4.3 saat sonra döllenme, hpf) başlanmıştır. Bu, başlangıç ​​aşamasında gastrulasyon hemen önce memeli embriyolarının, implantasyonu aşamasına eşdeğerdir. Etanol konsantrasyonu 0.2 'den% -2.5%, hacim / hacim aralığı kullanılır. Testler su içinde çözelti 25-50 arasında% gelişen embriyonun 10, 11 kadar biter olduğunu göstermiştir. Embriyolar zaman istenen uzunluğu için 28 ° C'da muhafaza edilmiştir. Etanol maruz kalma süresini istenen sonra, etanol-su çözeltisi çıkarıldı ve yerine düzenli zebrafish su ile yıkama ve üç fo korunurzaman r istenilen uzunluğa. Kusurun spesifisite başlangıç, doz, ve etanol puls uzunluğu zamanına bağlıdır.

2. In situ Hibridizasyon, Antikor ve Kıkırdak Boyanma RNA embriyolar toplanması,

  1. QPCR için mRNA toplamak için, yaş uyumlu embriyoların eppendorf tüpleri toplanır. Zebrafish su uzaklaştırıldıktan sonra, TCEP lizis tamponu ile birlikte ilave edilir. Bir motorlu pulvarizatür fiziksel lizis çözelti içinde embriyo ayırmak için kullanılır. Bu, daha sonra herhangi bir ayrışmamış büyük parçalar kaldıran bir preclear sütun içinden geçirilir. Meydana gelen çözelti, lizis proses tarafından yayınlanan her makromoleküller içerir. RNA sonra yıkama ve DNAz tedavisi takiben, bir kolon üzerinde, bu çözüm çalıştırarak ekstrakte edilir. Elüsyon, daha sonra su ya da imalatçı (5'-Prime) tarafından sağlanan bir elüsyon çözeltisi kullanılarak gerçekleştirilir. RNA mikro qPCR için standart teknikler kullanılarak cDNA ya dönüştürülür kullanılabilmektedirdizi analizi.
  2. In situ hibridizasyon ve antikor boyama, 6 ile 24 embriyolarında için hpf 4 ° C'de gece boyunca% 4 paraformaldehit tespit edildi Bu PBS içinde 3 yıkar +% 0.1 Tween (PBT), birbirine yapışmasını embriyo tutmak için takip eder. Embriyolar daha sonra 3 metanol bir dizi transfer edilir: PBT da -20 ° C'de saklanabilir ve bu noktada,% 100 metanol içine yıkayan Bu embriyo situ hibridizasyon veya antikor boyama için kullanılabilir. Bazı antikorlar metanol tedavi sonrasında, bu nedenle bu uyarı dikkate alınır ve spesifik antikor o metanol tedaviden sonra çalışacak olmadığını belirlemek için test gerekir çalışmaz.
  3. Kıkırdak boyama için, embriyolar 5 veya 6 gün sonra döllenme (dpf) yükseltilmiş gerekir. Bunlar daha sonra 4 'de bir gece 4% paraformaldehit giderilen ° C, PBT 3 yıkama izledi.

3. Değerlendirme Etanol bağlı Gen Değişiklikleri ve Gelişim Sonuçları

    in situ hibridizasyon incelenir. qPCR sonra 3 ayrı biyolojik örnekler kullanılarak valide Integrated DNA Technologies (IDT) yazılımı ile tasarlanmış primerler kullanılarak elde edilir. Bir kez primerler onaylanmıştır, qPCR toplanan RNA örnekleri oluşturulan cDNA yapılmaktadır. Her numune üç nüsha halinde çalıştırılır. PCR reaksiyonlar çok renkli algılama sistemi ile Chroma-4 PCR makinesi (BioRad) veya benzer PCR makinede Platinum SYBR Green qPCR Super mix (Invitrogen) çalıştırılır. Sorgulamasının genler ek olarak, bu primerler ile ayarlanmış bir kontrol cDNA ya da RNA hazırlanmasında küçük bir farklılık dengelemek için kullanılır olması kritik bir durumdur. Bizim zebrabalıkları embriyolar için, GAPDH kullanın: 5'GAAGGTGGGAAACTGGTCAT3 've 5'TTGCACCACCCTTAATGTGA3'. Analiz edilen genleri daha sonra gen ifadesi bir miktarının nispi 2 üzerine Pfaffl yöntemi varyasyonu kullanılarak hesaplanır GAPDH seviyeleri göre normalize edilir 12, deneysel göreli kat fark olarak veri görüntüleme. Normal hesaplama tüm genlerin Her devir için iki kez DNA çoğaltmak olduğunu varsayar ve böylece, tam sayı "2" üzerinde güç hesapları olarak ifade, referans gen değişimi üzerine deneysel geninde değişim oranı olarak ifade veri Mükemmel bir PCR reaksiyonu görülen döngüsü başına DNA iki katına verim budur. Pfaffl yöntemi tercih PCR primerleri için de geçerlidir verimliliği elde deneyi ile genel "2" yerini alır. Bu PCR reaksiyonlarında fark daha doğru bir yansıma yansıtır. Tam formül şöyledir:
    (Deneysel gen Verimlilik) (tedavi edilen numune kontrolü Ct örnek-Ct)
    -------------------------------------------------- -----------------------------------
    (Referans gen Etkinliği) (Ctkontrol örneği - tedavi örnek Ct)
  1. In situ hibridizasyon için digoxigenin (kaz) etiketli riboprobes ilgi gen bölümlerini içeren plasmidlerden inşa edilir. Yaştaki embriyolar standart koşullarda 13 ile riboprobes maruz kalan ve bir renk reaksiyonu (NBT / BCIP) kullanarak etiketli riboprobes yerini sağlar Alkalin fosfataz birleştiğinde anti-dig antikorları ile tespit edilir. Embriyolar daha sonra bir Leica mikroskop (Şekil 1B-G) kullanılarak görselleştirilebilir.
  2. Morfojenik gelişimini değerlendirmek için, embriyolar istenilen zamanda toplanır ve mikroskop altında incelenir. Hücre gruplarının şekli için, canlı embriyoları 14 görüntülenmesi işlemidir. Oküler arası mesafe ve vücut uzunluğu için, embriyo PFA giderilmiştir. Her durumda, istenilen bölgenin görüntülerini Adobe Photoshop softwar kullanılarak alınan sabit bir büyütme ve ölçümler bir mikroskop yakalanıre 10,14.
  3. Larva zebrabalıkları gelişen kıkırdak yapılar üzerinde tedavi etkilerini araştırmak için, Alcian Blue boyaması kullanın. Birkaç saat veya bir gece boyunca% 20 asetik asit (asidi alkolü): Sabit zebrafish larvaları% 80 etanol içinde çözülmüş Alcian mavi çözeltisi ile muamele edilmiştir. Larvalar% 1'lik bir KOH transfer edilmeden önce asidi alkolü birkaç yıkama in destained edilir: pigment hücrelerin daha da temizlenmesi için% 3 hidrojen peroksit çözeltisi. Zebra balığı kıkırdağı yapıları göstermek için eski en az 4 gün olmak gerekir, ve bu iyi 5 veya 6 gün geçmiş balık tanımlanır.
  4. Canlı embriyo hücre ölümünü Akridin Orange (AO) kullanılarak incelenmiştir. AO canlı hücreler geçirgen hücre değildir, ve apoptoz ve nekroz geçiren olanlar dahil olmak üzere tehlikeye membran ile hücrelerde DNA bağlanır. Yaşayan embriyosu PBS içinde 3 yıkama izledi, 1 saat süreyle PBS içinde 5 mg / ml AO ile inkübe edilir. Embriyolar sonra konfokal mikroskobu kullanılarak görüntülenmiştir edilir. Dijital Z-serler görüntüler kompozit oluşturmak için birleştirilir.

4. Zebra balığı Embriyo kurgulama

  1. Etanol maruz azalmıştır genlerinin tanımlanması sonra, eksik geni değiştirmek üzere tasarlanmıştır mRNA enjeksiyon kullanarak bunları değiştirmeye çalışın mümkündür. Kapaklı mRNA üretici talimatlarına (mMessage Makinesi, Applied Biosystems) göre, in vitro transkripsiyon kitleri, RNA polimeraz kullanarak doğrusallaştırılmış DNA plasmidlerden transkripsiyonu. 25-200 arasındaki RNA'nın pg / nl 0.1 M KCl bir çözelti içinde, 1-2 hücre aşaması zebrafish yumurta içine enjekte edilir. Embriyolar sonra (Şekil 5) Yukarıda tarif edildiği gibi etanol ile muamele edilmeden önce kurtarmak için izin verilir.
  2. Etanol maruz artarak herhangi bir gen transkript için, onlar "knocked-down" bir antisens morfolino teknolojisi kullanılarak azaltılabilir veya edilebilir. Antisens morpholinos (Amos) şirketi Gen Araçlar tarafından tasarlanan ve protein içine RNA çeviri engelleyebilir veya blo edilirDeneysel ihtiyaca göre RNA ck olgunlaşması ve yapıştırma,. Morpholinos bu işlem hedef geni, bunların mevcut olmadığını anitibodies kullanılarak ölçülebilir bir açık için aktif bir proteini miktarını sınırlamak. RNA bağlama morpholinos etkinliğinin raptedilmektedir ve unspliced ​​transkriptlerin göreceli miktarları tespit etmek için RT-PCR kullanılarak ölçülebilir. Morfolino ile titre doz-bağımlı aktivitesi 15 ile sonuçlanabilir. AMOS Danieau çözeltisi çalışan konsantrasyonları (ng konsantrasyonuna pg titre) (58 mM NaCI, 0.7 mM KCI, 0.4 mM MgSO 4, 0,6 mM Ca (NO 3) 2, 5 mM HEPES, pH 7.6) ile seyreltilir. Enjeksiyon embriyosu yukarıdaki gibi muamele etanol tabi tutulmadan önce geliştirmek için izin verilir, daha sonra 1-2-hücre aşamada yer alır.

5.. Temsilcisi Sonuçlar

Ile ilgilidir gelişim ve genetik kusurları bir dizi etanol sonuçlarına zebrafish embriyo maruzfenotipleri diğer omurgalıların bulundu. Biz Notokordun (14 veri gösterilmemiştir) dahil olmak üzere, eksenel dokuların anormal gelişim belgelenmiştir. Etanol tarafından üretilen gelişim gecikmesi görünüşte kısaltılmış ve bazen de bozulur Notokordun (veri gösterilmemiştir 14) götüren, uygun Notokordun uzama bozulmasına yol açar. Bu erken gecikme ve Notokordun defekti büyük olasılıkla tedavi edilmemiş kontrol görüldüğü gibi güçlü zikzak şeklini kaybetmiş Somitlerin içinde daha sonra anormallikler (Şekil 2), kısmen de yol açar, ve görülen fenotipleri karakteristik u şeklindeki Somitlerin yakınız sonik sinyalleşme 14 azalır. Somitlerin açı standart yazılım ve 92.1 ± 4.6 ° den tedavi edilmemiş kontrol 122.6 ile ± 6.6 ° etanol tedavi edilen embriyolar (p <0,001) açısı arttığında kullanılarak ölçülebilir.

Downstrea olabilir etanol maruz bir başka sonucuErken gelişme geriliği ve daha sonra Notokordun kusurları m embriyo kısaltılmış uzunluğu (Şekil 3). Hatta embriyo dikkate etanol maruz tarafından üretilen eğrilik almak, ölçme, etanol pozlama (3E 14 Şekil) embriyo maruz kaldı etanol dozu bağlıdır kısaltılmış bir gövde yol açar. Bu bulgu zebrabalıkları modeli insan doğum defekti anlayış ilgili olduğunu düşündüren, geliştirme 16, 17 sırasında etanol maruz kalan çocuklarda bulundu prepubertal boy kısalığı ve kalıcılığı benzer.

FEF klasik özelliklerinden biri düşük çeneli, küçük göz açma ve pürüzsüz bir filtrum dahil olmak üzere klasik bir fasiyesi vardır. Kadar bu özelliklerin orta hat dokular bir azalma ile ilgilidir. Ciddi etanol maruziyet synopthalmia ve siklops dahil olmak üzere daha belirgin fenotipleri, neden olduğu hayvan modellerinde gösterilmiştir. Zaman expoetanol artan dozlarda zebrabalıkları embriyolar şarkı, göz içi mesafe (IOD) insan doğum kusuru niteliği ile tutarlı (Şekil 4) doza bağımlı olarak azalır. Siklops sadece çok yüksek dozlarda bulunur, ancak düşük dozlarda bu hayvan modelinde, orta hat yüz gelişimi 10 benzer bir kusuru var düşündüren, IOD (Şekil 4) önemli bir azalma ve üretim yok.

Etanol maruz tarafından üretilen vücut ve yüz hem de kusurları altında yatan mekanizma anlamak için, biz gelişimin erken döneminde ortaya çıkar ve bu makul sonraki gelişim kusurları katkıda beklenebilir gen ekspresyon değişiklikleri düzen kurmaktı. Biz iki şekilde bunu, embriyolardan mRNA çıkarma denetimleri (Şekil 1A) ile karşılaştırıldığında etanol tedavi embriyolarda gen ekspresyonu düzeylerinin kantitatif bir değerlendirme sağlar. Buna ek olarak, in situ olarak gerçekleştirebilirhibridizasyon bakılmaksızın sinyal (Şekil 1B-G 18) azalmış olup olmadığını, genlerin şekline bakmak. Bu örnekte, ifade olan etanol maruz kaldıktan sonra azalır iki gen, gli1 ve six3b gösterilmiştir. Biz six3b için yerinde desen incelendiğinde, biz etanol maruz kalan embriyolar bu genin ifade mekansal ölçüde (Şekil 1 EG) bir azalma buldunuz. Benzer bir azalma gen gsc (Şekil BD) tespit edildi. Six3b ve gsc Hem kraniyofasiyal orta hatta dokulara katkıda bulunmak için mukadder dokularda ifade edilir. Yani 8 hpf azından bu genlerin redüksiyon daha sonra Şekil 4'de gösterildiği bulundu IOD azalma ile tutarlıdır.

Etanol etkilenen genler belirlendikten sonra, bunların ifade artırılabilir veya azaltılabilir hangi mekanizmalar vardır. Bu, özellikle de example, biz qPCR azalmıştır 2 genleri (gli1 ve six3b) göstermiştir. Biz bu gen değişiklikleri geri sonuçları artırabilir olmadığını belirlemek için mRNA enjekte etmek için seçti. Bu deneme için, yerine gli1 enjekte biz şşş, gli1 düzeylerini artırır bir ligand enjekte seçti. Six3b için, six3b kendisine enjekte başardık. Biz six3b (veriler gösterilmemiştir) enjekte fakat temelde ilave şşş enjeksiyonları (Şekil 5) Zebra balığı embriyolarının brüt kusurları kurtarmak için başardık hiçbir değişiklik bulundu.

Şekil 1
Şekil 1. Etanol maruz kalma erken desen ve seçilen gelişimsel genlerin gen ekspresyon düzeyleri değişir. 8hpf az embriyo A) qPCR sonuçları. Iki gen için sonuçlar yayınlanmaktadır: six3b ve gli1. Sonuçlar, üç ayrı deney ortalaması olarak gösterilmiştirve gösterilen etanol dozda% 2.5 'tir. Her iki genin kontrolü (t-testi, p <0.05) anlamlı bir şekilde azalmaktadır. 8 hpf Zebra balığı embriyolarının in situ hibridizasyon yılında BG). Gsc ve six3b desenleri Hem kontrollere göre bu zaman noktasında değiştirilir. (Loucks ve ark. 2007'den itibaren izniyle Modifiye).

Şekil 2
Şekil 2. Hücre gruplarının gelişimi ile tedavi edilen embriyoların değiştirilir. Hücre gruplarının yapısı ve açıları 48 hpf muayene edilir. Kontrolü embriyolar (A), Somitlerin bir zikzak şekli ve keskin bir açı var. Etanol maruz zebrafish daha I-ya da U-şekilli hücre grubu, ve daha az keskin açılan sahiptir. (Loucks ve Ahlgren 2009 izniyle Modifiye).

Şekil 3
Şekil 3. Etanol tedavisi önemli ölçüde zebrabalıkları vücut uzunluğu azalır.Tedavi edilmeyen ve etanol maruz kalan embriyoların uzunluğu 5 gün postfertilization ölçüldü. Uzunluğunda anlamlı bir azalma (ANOVA, p <0,001) tedavi edilen tüm embriyoların görüldü. BD. Daha büyük bir azalma% 2.0 ve% 2.5 etanol ile dozlanmış embriyo görüldü ise% 1.0 ve% 1.5 etanol ile tedavi edilen embriyoların toplam uzunluğu hafif fakat anlamlı bir azalma vardı. Her kavrama büyüklük farklılıkları kontrol etmek E., her bir deney için kontrol embriyoların 100 normalize ve kardeş tedavi edilen embriyoların 100 bir yüzdesi olarak ifade edildi. (Loucks ve Ahlgren 2009 izniyle Modifiye).

Şekil 4
Şekil 4. Zebra balığı embriyolarının içi mesafe (IOD) bir azalmaya Etanol pozlama sonuçları. A) embriyoların frontal kez normal ve erimiş göz fenotipleri göstermektedir. B) etanol farklı olarak doz gastrulasyon res içinde 3 saat için uygulananBalık 24 saat sonra incelendiğinde in ults IOD azalmıştır. Sigortalı gözleri ve siklops sadece (% 2.4) test edilen en yüksek dozda görülür. * Kontroller ile karşılaştırıldığında IOD önemli bir azalma gösterir. (Ahlgren, 2004 izni ile değiştirilmiş).

Şekil 5,
Şekil 5. Sus-N mRNA enjeksiyon zebrabalıkları etanol maruz tarafından üretilen brüt kusurları kurtarır. Bir-iki hücreli embriyo 100 pg / nl şşş-N mRNA ve enjekte edilen embriyoların yarısı 4,3-24 hpf gelen standart etanol dozlarda maruz kalan enjekte edildi. Embriyolar 5 dpf'e analiz edildi. % 2.0 etanol ile tedavi edilen embriyolar dorsale kısa kuyrukları, ben şekilli Somitlerin ve siklops gibi göz kusurları eğri sergilemektedir. Bu fenotip kurtuluşu, enjekte embriyosu (% 93) 71/76 görülmektedir. Bu embriyolar, vücut düz, Somitlerin baklava biçimindeki vardır, ve gözleri tamamen ayrılır.

Discussion

Yöntemleri burada açıklanan ve gösterilen sonuçlar zebrafish gelişim kusurları sorgulamak için nasıl kullanılabileceğini sadece ucu göstermektedir. Çünkü embriyo erişilebilirlik, her kavrama ve sonuçların yüksek tekrarlanabilirlik için bıraktıkları yumurta sayısı yüksek, bu omurgalı teratojenik çalışmalar için idealdir. Balık aynı zamanda belirli bir gen veya faiz 19 yol için görsel bir muhabir olarak kullanmak için floresan moleküller içeren manipüle edilebilir. Etanol çalışmalarda kullanılan dozlar, memeli kan alkol seviyeleri ile karşılaştırıldığında oldukça yüksek görünür. Bununla birlikte, bu düzeyde suda mevcut olanı yansıtmaktadır ve tüm etanol embriyo teslim edilir.

Birlikte ele alındığında, açıklanan ve yukarıda ayrıntıları yöntemleri zebrabalıkları embriyoların etanol maruz kalmasıyla ilgili insan doğum kusurları modellenmesi son derece yararlı olduğunu göstermektedir. Dahası, zebrafish bulunan gen ifadesi değişiklikler diğerleri tarafından teyit edilmiştiretanol gelişimsel etkileri omurgalılar arasında korunur düşündüren memeli model sistemler 20, içinde. Yukarıda gösterildiği teknikleri çok çabuk ve kolay potansiyeli teratojenler algılamak ve belirli bir madde teratogenez katkı yatan mekanizmaları belirlemek için başka çevresel veya farmasötik hakaretler ile birlikte kullanılabilir.

Disclosures

Biz ifşa hiçbir şey yok.

Acknowledgments

Biz situ hibridizasyon ve mRNA microinjections içinde için plazmidlerin hediyeler için Monte Westerfield, Makoto Kobayashi ve Jacek Topczewski teşekkür etmek istiyorum. Biz Video görünmesi için Steph Erhard minnettarız. Ayrıca videoda gösterilen konfokal mikroskobu ile William Goossens yardımından dolayı teşekkür etmek istiyoruz. Tyler Schwend videoda kullanılan görüntüler sağlanır ve Rodney Dale video için hazırlık yaptılar. Ayrıca, Zebra balığı ile hayvancılık çalışmaları için CMRC hayvan bakım personelini tanımak. Bu çalışma SCA NIH hibe R21 AA13596 tarafından finanse edildi.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
Fetal Alkol Pozlama bir Zebra balığı Modelinde teratojenik değişiklikler değerlendirilmesi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter