Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

인간 Fungiform의 맛 용의자 전지의 분리 및 문화

doi: 10.3791/3730 Published: May 17, 2012

Summary

우리는 인간의 fungiform의 맛을 용의자 전지의 장기 문화를 분리하고 관리하기위한 재현성 프로토콜을 개발하기위한. 생검에 의해 얻은 인간 fungiform 용의자의 세포가 성공적으로 생존 능력의 손실없이 더보다 여덟 구절 (12 개월) 동안 문화를 유지했다.

Abstract

미각 세포는 음식에 포함된 간단한 자극하고 복잡한 화학 분자의 광범위한 감지를 허용 독특한 histological, 분자 및 생리 특성으로 고도의 전문입니다. 인간, 개별 fungiform의 용의자에서 제로로부터 많은 20 등 입맛에 포함되어 있습니다. 여러 세포주기위한 문화의 맛을 용의자 세포를 유지하는 능력이 독특한 감각 세포, 분자 재생 및 기능적 특성을 특성화를 위해 상당한 유틸리티 될 비록 culturing 인간의 미각 세포에 대한 설립 프로토콜은 없습니다. 미각 세포의 이전 연구는 일차 문화, 설치류에서 explant 문화, 또는 조직 조각 1,2,3,4의 세미 그대로 입맛에 갓 고립된 세포를 사용하여 수행되었습니다. 이러한 준비는 각각 장점이 있지만, 장기적인 문화의 발전은 특히 미각 세포 증식과 diffe의 연구를 위해 상당한 이점을 제공했을rentiation. 우리를 포함하여 몇몇 그룹은, 미각 세포 배양 모델의 개발 및 구축에 관심이 있었다. 문화 미각 세포에 대한 대부분의 시도는 3-5 D 5,6,7,8 이후 일반적으로 지속하지 세포와 제한된 생존을보고했습니다. 우리는 최근 쥐 미각 세포 9 확장된 문화를위한 성공적인 방법에보고했다. 우리는 여기서 처음 격리된 인간 fungiform의 맛을 용의자 세포에 대한 체외 배양 시스템의 설립에 대해보고합니다. 생검에 의해 얻은 인간 fungiform 용의자의 세포가 성공적으로 생존 능력의 손실없이 더보다 여덟 구절 (12 개월) 동안 문화를 유지했다. 세포는 성숙한 미각 세포의 특징 많은 분자 및 생리 기능을 표시합니다. Gustducin 및 포스 포 라이 페이스 C β2 (PLC-β2) mRNA는 반전 transcriptase - 중합 효소 사슬 반응에 의해 여러 세포에서 감지하고 시퀀싱에 의해 확인되었다. Immunocytochemistry 분석 돌풍의 존재를 증명교양 미각 세포의 ducin 및 PLC-β2 표현. 교양 인간 fungiform 세포는 또한 미각 수용체와 신호 전달 경로 중 적어도 일부는 현재의 것을 나타내는 여러 미각 자극의 적절한 농도에 대한 응답으로 세포 내 칼슘의 증가를 전시. 이러한 결과는 충분히 성인 인간의 미각 세포가 생성하고 적어도 8 구절 지속 돼 있음을 나타냅니다. 세포의 많은 모델 맛을 시스템으로의 사용을 지원하는 성인 취향의 상피에서 심하게 격리 세포의 생리 및 생화 학적 특성을 유지합니다. 이 시스템은 체외 준비에의 포유류의 미각 수용체 세포의 증식, 분화 및 기능에 관련된 프로세스의 추가 연구를 가능하게합니다.

인간 fungiform 셀 문화 확립을 위해 사용되는 휴먼 fungiform의 맛을 용의자가 검토되었다 연구 프로토콜 아래에서 적절한 정보를 동의에 따라 연구를 위해 기증했다그리고 IRB위원회에 의해 승인했다. 프로토콜 (# 0934)는 Schulman 어소 기관 검토위원회 주식, 신시내티, OH에 의해 승인되었습니다. 아래 글 프로토콜은 Ozdener 의해 보고된 출판 매개 변수를 기반으로합니다. 2011 10.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 인간 Fungiform의 맛 용의자 구하기

  1. 곡선 봄 microscissors를 사용하여 혀의 앞부분은 부분 등 부분의 표면 4-8 인간 fungiform의 맛을 용의자를 제거합니다.
  2. 즉시 격리 솔루션에 플레이스 (26 MM NaHCO 3, 2.5 MM 아뇨 2 PO 4, 20 MM 포도당, 65 MM NaCl, 20 MM KCl, 1 밀리미터 EDTA (에틸렌 다이아 민 테트라 초산) nuclease없는 물속에 녹아 및 소독 필터링).

2. 인간 Fungiform의 맛 용의자는 소화

인간 fungiform의 맛을 전지 용의자는 약간의 차이로 두 개의 서로 다른 효소 소화 프로토콜을 사용하여 dissociated 수 있습니다.

  1. pronase (1 밀리그램 / ML, 시그마 알드리치)과 엘라스타제 (1 밀리그램 / ML 시그마 알드리치) 30-45 분 (프로토콜 1) 상온에서 함께 격리 솔루션에서 품어 fungiform 용의자.
  2. Collagenase 유형 I (워싱턴에서 550 U / ML,)로 품어 fungiform 용의자 + 엘라스타제 (10 Wort에서 U / ML,대한 hington) 35 2 ML 칼슘 무료 닮은 솔루션의 + 트립신 억제제 (워싱턴에서 0.9 밀리그램 / ML) ° 30 분 95% O 5분의 2 %의 CO 2와 부드러운 산소를위한 순환와 C 물 목욕. (다른 방법 소화, 프로토콜 2)
  3. 부화 후 닮은 함께 용의자를 씻고 10 회 대한 화재 광택 유리 파스퇴르 피펫으로 용의자를 씹다.
  4. RT에서 2,500 rpm으로 3 분만을 원심 분리기 및 절연 솔루션을 제거하고 미각 세포 배양 매체의 1 ML을 추가합니다.
  5. 유리 그릇에 소화 fungiform 용의자를 전송합니다.
  6. 수술 면도기로 부드럽게 fungiform 용의자를 해부.
  7. 쥐의 꼬리 콜라겐 타입-1 코팅 coverslip 향해 복제 실린더로 해부하는 용의자를 250 μl를 추가합니다.
  8. 각 잘으로 미각 세포 배양 매체의 1 ML을 추가합니다.

3. 인간 Fungiform의 맛 용의자 전지의 Culturing

  1. humidified에서 36 ° C에서 접시를 품어배양기 5 %에게 CO 2를 포함하는.
  2. 전체 매체의 첫 번째 변경 이전 2 일 흐트러지지 인큐베이터에 넣으십시오. 그 1 ~ 3 일 안에 분명하게 보이지 않을 수도 있지만 맛이 전지는 결국 코팅된 coverslip에 바인딩됩니다.
  3. 완전히 플레이트와 매체에서 복제 실린더를 제거하고 각 잘으로 미각 세포 매체의 1 ML을 추가합니다.
  4. 모든 매체 6-7일 1 / 3을 교체하십시오. 더 자주 그리고 / 또는 완전히 매체를 변경하지 마십시오.
  5. 매일 현미경으로 세포의 성장을 확인합니다. 새로운 세포의 대부분은 세포 클러스터 아래 성장. 세포 클러스터는 일반적으로 문화 2-3주은 새로 생성된 세포를 떠난 후 분리.
  6. 일단 복제 실린더의 40~50%는 미각 세포를 팽창으로 덮여 있습니다, 36시 2~3분 위해 W / V 트립신 / EDTA (에틸렌 다이아 민 테트라 초산) 0.25 %을 사용하여 세포를 trypsinize ° C.
  7. 15 ML 튜브로 우물에서 세포를 전송, 룸 기질에서 5 분 동안 3,000 rpm으로 원심 분리에 의해 다음 미각 세포 배양 매체 3 권 추가ature.
  8. 미각 세포 매체의 1 ML로 뜨는 및 resuspend 세포를 제거합니다.

4. 인간 Fungiform의 맛 용의자 전지의 전파

  1. T25 접시에 세포를 전송하고 미각 세포 매체 (통로 0) 4 ML에 추가합니다. 36 humidified 인큐베이터에서 ° C는 CO 2 5 %를 포함한에서 세포를 유지합니다.
  2. 교양 미각 세포가 100 % 합류점에 도달하기 전까지 모든 매체 6-7일 1 / 3을 교체하십시오. 이때 수확 미각 세포를 활성화하려면, 멸균 PBS로 한 번 세포를 씻어가 36에서 2-3분 동안 0.25 % W / V 트립신 / EDTA (에틸렌 다이아 민 테트라 초산)를 사용하여 세포 ° C를 trypsinize
  3. 위에서 설명한 원심 분리 후, 신선한 T-75 flasks (통로 1) 완전 맛 셀 매체 및 전송 세포에 resuspend.
  4. 모든 매체 6-7일 1 / 3을 교체하십시오. 더 자주 그리고 / 또는 완전히 매체를 변경하지 마십시오.
  5. 세포가 주변에 100 % 합류점에 도달했을 때 4.3 및 4.4 단계를 반복합니다. T75 플라스크에 1시 4분 희석보다 더 이상으로 세포를 분할시간에 따른 세포의 적절한 성장을 유지하는.

5. 교양 인간 Fungiform의 맛 용의자 세포를 동결 융해

  1. 기본 미각 세포의 주식을 동결시키고 trypsinization 후 (단계 4.2), 3 ML 완전한 미각 세포 매체와 무균 15 ML 원추형 원심 튜브에 전송 세포를 추가합니다. 상온에서 5 분 동안 2,500 rpm으로 원심 분리기.
  2. 조심스럽게 95% 태아 소 혈청 (FBS)와 5 % DMSO를 포함하는 동결 매체의 적절한 볼륨으로 뜨는 부드럽게 resuspend 세포를 제거합니다.
  3. 라벨, 멸균 cryovials, 단단히 모자 및 이소프로판올를 포함하는 냉동 컨테이너의 장소로 세포를 전송합니다. 이전 액체 질소로 무한정 전송에 하나 이상의 일간 -80 ° C ~ 냉동기에 장소.
  4. 37 일차 냉동 인간 fungiform의 맛을 용의자 세포, 장소의 병을 녹여하려면 ° C 물에 목욕까지 판상 흐름 세포 배양에서 작업하는 동안 단지 (약 1 분) 해동후드.
  5. 멸균 15 ML 원추형 원심 튜브에 세포 동결 매체를 전송하고 미각 세포 배양 매체의 5 ML에 추가합니다.
  6. 상온에서 5 분 동안 2,500 rpm으로 세포를 원심 분리기. 조심스럽게 완전한 미각 세포 배양 매체 및 멸균 T-25 조직 배양 플라스크에 전송로 뜨는, 부드럽게 resuspend 세포를 버리고.
  7. 4 3 단계에 따라 배양 세포로 진행합니다.

6. 대표 결과

문화에 맛을 biopsies 성장하려고 시도 시간의 90 % 성공했다. 생검 및 분리 후 며칠이 세포는 일반적으로 분리 과정 후 남아 해부 fungiform 조직의 조각에서 바깥쪽으로 성장하고 마이 그 레이션하기 시작했다. 개별 세포 도금 (그림 1A) 이후 24-48 시간 볼 수 있었다지만, 세포가 가끔 딸 세포 (그림 1B) 생성, 최대 첨부된 세포 클러스터 미만 2~3주에 대해되었다. 생검에서문화 상품 4 주 동안 8,000 세포 - ING 4-8 인간 fungiform 용의자는 기본 인간 fungiform의 맛을 용의자 전지의 초기 분리는 약 2000에 도달합니다. 추가 3-4주위한 T25 세포 배양 flasks (통로 0)의 확장 (그림 1C) 적응 문화에 인간 fungiform의 맛을 용의자 세포가 발생하게됩니다. 기본 인간 fungiform의 맛을 용의자 전지는 더욱 3-4주 (그림 1D)의 통로-1에 의해 적어도 백만 세포의 이상을 양보하는 문화에 확장 할 수 있습니다. 기본 미각 세포가 이상 8 구절에 대해 계속 증가할 것이다.

문화 교양 인간 fungiform의 맛을 용의자 세포의 형태 교양 chemosensory 세포 비슷했다 이전에 11,12 설명했다 .. 대부분의 교양 인간 fungiform의 맛을 용의자 전지는 최대 15~30일까지 함께 또는 하나 이상의 프로세스없이 세포 기관의 원래 컴팩트한 외관을 유지했습니다. 그들이 합류에게 교양 CE의 대부분을 도달 후재편은 편광-길쭉한 모양을했다. 중년 여인 미각 세포는 여러 가지 histological subtypes 및 전시 미각 세포 특징 구성되어 있습니다. 여기에서 우리는 이러한 문화권 내에서 세포가 성숙 미각 세포의 특성 많은 분자 및 생리 기능을 표시하는 것으로 나타났습니다. Gustducin 및 포스 포 라이 페이스 C - β2, (PLC-β2) mRNA는 반전 transcriptase - 중합 효소 사슬 반응 및 시퀀싱 (그림 2)에 의해 확인된 제품에 의해 감지되었다. gustducin 및 PLC-β2 표현은 immunocytochemically 타입 II와 같은 세포 (B와 D는 각각 그림 3)의 존재를 나타내는 감지되었습니다. 유행과 gustducin 및 PLC-β2 세포 신호 전달 경로와 세포 유형을 반영한 것이 정확하게 생체내을 볼 것을 반영하지 않는의 상대적인 표현 패턴. 미뢰 내에서 다른 세포 유형의 상대적 분포를 지배하는 요인 알 수 있으며, 문화 조건에 복제되지 않을 수 있습니다. 따라서, B 교양 세포들의 생체내의 대응에서이 조작해서 모니터링할 수 있습니다 조건 하에서, 분자 수준에서 이러한 특성의 규정을 검토하는 기회를 제공 사이의 유사점과 차이점을 oth.

모델 시스템에 대한 중요한 기준은 관련 기능적 속성의 존재이다. 교양 세포들은 또한 여러 미각 자극 (그림 4)의 적절한 농도에 대한 응답으로 세포 내 칼슘의 강력한 증가를 전시. 이러한 연구에서는 다정하고 쓰라린 자극은 탈분극에 해당 있습니다 세포내 칼슘의 증가를 유도. 이러한 미각 세포와 같은 교양 세포의 특성은 우리가 여기서 설명하는 모델 시스템이 도입 경로와 인간의 미각 세포의 재생 능력을 더욱 연구를위한 귀중한 자산이 될 것이라는 주장에 지원을 빌려 주다.

fig1.jpg "/>
그림 1. 첨부 파일과 교양 인간 fungiform의 맛을 용의자 세포의 형태. 콜라겐 타입-1 코팅 접시에 성장 기본 인간 fungiform의 맛을 용의자 세포 배양은 2 일 () 이후에 몇 군데 있었다. 인간 fungiform의 맛을 용의자 전지는 최대 딸 세포를 야기할 것 같았다 첨부된 세포 클러스터, 아래 4 주 동안 성장했다. 세포는 일반적으로 4 주 (B) 내에서 합류로 증가, 그리고 (C와 D) 수확 각각 reseeding 후 2 일 그리고 4 주를 나타냅니다. 교양 세포는 최소한 8 개월 동안 성장을 계속했다. 스케일 바 = 50 nm의. 그림 1의 일부도 Ozdener 동부 표준시로 표시되었다. 알. 10.

그림 2
그림 2. RT-PCR 결과는 특정 미각 세포 biomarker의 mRNAs (gustducin 및 PLC-β2)의 존재를 보여주었다. 교양 인간 fungiform 세포로부터 총 RNA는 역방향 transc였다RT-PCR (Invitrogen)에 윗첨자 첫 스트랜드 합성 시스템을 이용한 ribed하고 gustducin 및 PLC-β2의 검출을위한 구체적인 primers로 증폭하여 PCR에 사용. Primers (표 1) 하나 이상의 introns에 걸쳐하기로했다. 각각의 mRNA는 통로 4 또는 시퀀싱에 의해 확인 예상 크기의 증폭 제품과 5에서 교양 인간 fungiform의 맛을 용의자 세포에서 발견되었다. 특정 mRNA는 더 게놈 DNA의 오염을 나타내는없는 역방향 transcriptase없이 제어 실험에서 검출되지 않았습니다. PCR 제품은 2% 아가로 오스 젤에 별거 중이 젤의 증폭 제품은 면도칼로 excised되었다. DNA가 QIAquick 젤 추출 키트 (Qiagen)을 사용하여 겔에서 추출되었다. PCR 제품은 펜실베니아 장면 시설의 대학에서 순서가되었다. C-PCR 및 C-RT는 각각 PCR 및 역방향 Transcriptase를위한 제어 실험입니다. 그림 2의 일부도 Ozdener 동부 표준시로 표시되었다. 알.

그림 3
그림 3. 교양 인간 fungiform의 맛을 용의자 세포 통로 4 또는 5의 Immunostaining은 미각 세포 생체 존재를 보여주었다. 교양 인간 fungiform의 맛을 용의자 전지 (5 일 이전) 4 ° C.에서 하룻밤 (표 2) 4 % paraformaldehyde로 고정하고, 일차 항체와 incubated되었습니다 이미지 Leica TCS-SP2 공촛점 레이저 스캐닝 현미경과 함께 인수했다. 약, 교양 fungiform의 맛을 용의자 세포의 60 %가 gustducin (B) 및 PLC-β2 (D)와 20~30%으로 표시되었습니다. 해당 셀의 전송 이미지는 (A와 C) 표시됩니다. 컨트롤이 들어, 특정 면역 글로불린 항체와 immunostaining 것은 특이 현상 immuno의 반응성 (데이터가 표시되지 않음)의 부재를 보여주었다. 스케일 바 = 50 nm의. 부분그림 3은 역시 Ozdener 동부 표준시로 표시되었다. 알. 10.

그림 4
통로 4 또는 5에서 그림 4. 교양 인간 fungiform의 맛을 용의자 세포는 다른 자극에 반응한다. 교양 인간 fungiform의 맛을 용의자 전지 (4-​​5일 이전) 1mM Fura-2 AM (분자 프로브) 및 10 밀리그램 / ML Pluronic F127 (분자 프로브)로로드했습니다. 교양 인간 fungiform의 맛을 용의자 세포에서 세포 내 칼슘 수준 ([칼슘 2 +] I)의 변경은 표준 수동 이미징 기술을 이용하여 측정되었다. 전지는 340 나노미터와 380 나노미터의 여기 파장의 간접 형광 현미경과 510 nm의 중심 밴드 패스 필터가 정한 방출 파장을 사용하여 시각 있었다. 필요하면 자극이 목욕 용액에 용해 후 산도와 osmolarity 재조정되었다. 교양 인간 fungiform의 맛을 용의자 전지는 달콤한 쓴맛 자극에 응답했습니다. Graphs은 [카 2]의 대표적인 반응을 보여주는에 노출 (A) Denatonium (2 ㎜), (B) Sucralose (1 ㎜) 중 개별 셀의 I 수준. 각 성분은 하나의 개별 셀을 나타냅니다.

유전자 순서 PCR 조건 예상 크기
(BP)
참고
β-Actin GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 분
45 초
45 초
45 초
7 분
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 분
45 초
45 초
45 초
7 분
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 분
30 초
30 초
60 초
7 분
95
94
53
72
72
333 NM_004573

표 1. 맛이 특정 분자를 검출에 사용 Primers 및 조건.

일차 항체 출처 숙주 묽게 함 이차 항체 출처 숙주 묽게 함
Gustducin SantaCruz 토끼 1:500 안티 - 토끼 IgG 알렉사 633 분자 프로브 염소 1:500
PLC-β 2 SantaCruz 토끼 1:500 안티 - 토끼 IgG 알렉사 633 분자 프로브 염소 1:500

표 2. 항체가 특정 분자의 표현을 감지를 위해 사용됩니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

우리는 12 개월 기간을 걸치는, 8 이상의 구절에 대한 인간의 fungiform의 맛을 용의자로부터 얻은 세포를 유지했습니다. 이러한 문화들은 미각 수용체 세포의 핵심 분자 및 생리 학적 특성 이외에, 성숙한 미뢰 세포 유형의 여러 마커를 표현할 수있는 무대 체외에서 성숙 많은 중 새로운 세포를 생성합니다. 의 존재 gustducin 및 PLC-β2 교양 세포의 하위 집합에 immunoreactivity이 결론과 일치합니다. 가장 중요한 것은, 일부 세포는 dissociated 미각 세포 5, 미뢰 조각 3과 교양 인간과 쥐의 미각 세포 19,10에있는 세포의 기능으로하는 세포 내 칼슘의 일시적 증가와 함께 달콤한 쓴맛의 자극의 응용 프로그램에 응답했습니다. 이것은 문화의 세포 중 일부가 다정하고 쓴웃음을위한 분자 수용체를 표현한다는 의미뿐만 아니라,하지만 그들은 calci를 생성하는 데 충분한 G-단백질 결합 형질 도입의 계단식의를 가지고있다답변 음.

장기 일차 세포 배양은 종종 세포의 생리적 기능에 역할을 할 수있는 원래의 조직과 세포 구조와 세포 요인을 유지할 수 없습니다. 인간 fungiform의 맛을 용의자의 세포 배양의 성공적인 장기 설립함으로써 큰​​ 진전은 아직 제한의 수를 언급해야하였습니다. 제일이 중에서 기본 교양 세포의 각 배치가 문화를 시작하는 데 사용 세포의 초기 인구의 차이로 인해 달라질 수있다는 것입니다. 기본 세포 배양은 종종 세포의 생리적 기능에 역할을 원래의 조직 조직 및 구조와 성장 요인을보고 싶어요. 문화가 100 %의 합류로 성장되지 않습니다로서 세포는 다른 세포와 접촉을 항상 그리고 전적으로 자주하지 않습니다. 일반적으로 기본 세포도 dedifferentiation에 따라 달라질 수 있으며, 연속 셀 리튬의 세포 복제하는 동안 손실 또는 염색체의 상승을 특징으로 염색체 불안정성,선, 또 다른 문제 13,14,15 수 있습니다. 혀 교양 nontaste 세포와 교양 인간 fungiform 전지의 비교는 탐험해야합니다. 우리의 이해가 완료되기 전에 이러한 질문은 많은 실험적인 접근법 및 모델 시스템의 사용을 요구할 것입니다.

결론적으로,이 프로토콜은 여기에 설명된 관련 세포 생리학 및 분자 특성을 잃지 않고 최소한 8 구절 (12 개월) 동안 체외에서 인간 fungiform의 맛을 용의자 세포를 유지하고 있습니다. 이 장기 차 문화의 발전은 증식과 분화, 자극 특이성, 크로스 토크와 인간의 미각 수용체 세포뿐만 아니라, 조직 재생의 적응 특성 연구를위한 모델 시스템을 제공합니다. 또한, 이러한 감염과 같은 맛을 세포 기능을 손상 조건의 효과는 약물, 방사선, 독성이나 화학 물질 노출은 분자 및 생리 학적 수준에서 검사를 할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

관심의 어떠한 충돌 선언 없습니다.

Acknowledgments

우리는 아미 마이어스 및 기술 능력과 도움 ESI의 Quayson 감사드립니다. 이 작품은 NSF 0,216,310 및 Givaudan INC 부여 (NER)에 의해 부분적으로 지원되었다.

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
인간 Fungiform의 맛 용의자 전지의 분리 및 문화
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter