Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

İnsan Mantar şeklinde Lezzet papilla hücrelerinin izolasyonu ve Kültürü

doi: 10.3791/3730 Published: May 17, 2012

Summary

Biz insan mantarbiçim tat papilla hücrelerinin uzun süreli kültürlerde izole edilmesi ve sürdürülmesi için tekrarlanabilir bir protokol geliştirmeyi amaçladık. Biyopsi ile elde edilen insan mantarbiçim papilla hücreleri başarıyla canlılık kaybı olmadan daha sekiz pasajlar (12 ay) için kültüre edildi.

Abstract

Tat hücreleri gıdaların içerdiği basit uyaranlara ve karmaşık kimyasal moleküllerin geniş bir algılama izin özgü histolojik, moleküler ve fizyolojik özelliklere sahip, son derece uzmanlaşmış bulunmaktadır. İnsan, bireysel mantarbiçim papillada sıfırdan 20 kadar tat tomurcukları ihtiva etmektedir. Birden çok hücre döngüsü için kültür tat papilla hücrelerini korumak için yeteneği bu eşsiz duyusal hücrelerin, moleküler rejeneratif ve fonksiyonel özellikleri tanımlamak için önemli faydası olacaktır ancak kültür, insan tat hücreleri için oluşturulmuş protokol vardır. Tat hücrelerinin daha önceki çalışmalarda primer kültür, kemirgenler gelen eksplant kültürleri, ya da doku dilimleri 1,2,3,4 yarı sağlam tat tomurcukları taze olarak izole edilen hücreler kullanılarak yapılmıştır. Bu preparatlar, her avantajlara sahip olmakla birlikte, uzun dönem kültürlerin gelişimi, özellikle tat hücre proliferasyonu ve yönün çalışmaları için, önemli avantajlar sağladığı olacaktırentiation. Bizimki de dahil olmak üzere çeşitli gruplar, tat hücre kültürü modellerin geliştirilmesi ve kurulması ilgi olmuştur. Kültür tat hücreleri girişimleri, 3-5 d 5,6,7,8 ötesinde genellikle kalıcı değildir hücreleri ile sınırlı canlılığı bildirdin. Biz son zamanlarda kemirgen tat hücrelerinin 9 genişletilmiş kültürü için başarılı bir yöntem bildirdi. Biz burada ilk kez izole insan mantarbiçim tadı papilla hücrelerinin in vitro kültür sistemi bir kurulması için rapor. Biyopsi ile elde edilen insan mantarbiçim papilla hücreleri başarıyla canlılık kaybı olmadan daha sekiz pasajlar (12 ay) için kültüre edildi. Hücreler olgun tat hücrelerinin karakteristik birçok moleküler ve fizyolojik özellikleri görüntülenir. Gustducin ve fosfolipaz C β2, (PLC-β2) mRNA ters transkriptaz-polimeraz zincir reaksiyonu ile birçok hücre tespit ve sıralama tarafından teyit edildi. İmmünositokimya analizi bora varlığını göstermiştirKültüre tat hücrelerinde ducin ve PLC-β2 ifade. Kültürlü insan mantarbiçim hücreleri de tat reseptörleri ve sinyal yolunun en azından bazı mevcut olduğunu gösteren birçok tat uyaran Uygun konsantrasyonlarda yanıt olarak hücre içi kalsiyum artış sergiledi. Bu sonuçlar yeterli yetişkin insanlardan tat hücreleri oluşturulur ve en az sekiz geçişleri için muhafaza edilebilir olduğunu göstermektedir. Hücrelerin çoğu bir model tat sistemi olarak kullanımı desteklemek için yetişkin tadı epitelden akut izole hücrelerin fizyolojik ve biyokimyasal özelliklerini korurlar. Bu sistem, in vitro hazırlanmasında bir memeli tat reseptör hücrelerin proliferasyonu, farklılaşması ve işlevi ile ilgili işlemlerin çalışmalara sağlayacaktır.

Insan mantarbiçim hücre kültürü oluşturulması için kullanılan İnsan mantarbiçim tadı papilla incelendi araştırma protokolleri altında uygun bilgilendirilmiş onam sonrasında araştırma için hibe edildive İDD komitesi tarafından onaylandı. Protokolü (# 0934) Schulman Associates Kurumsal Değerlendirme Kurulu Inc, Cincinnati, OH tarafından onaylandı. Aşağıda yazılı bir protokol Özdener ark yayınlanan parametreleri dayanmaktadır. 2011 10.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. İnsan Mantar şeklinde Tat papilla Alınması

  1. Kavisli yay microscissors kullanılarak dilin ön kısmının dorsal yüzeyi 4-8 insan mantarbiçim tat papilla çıkarın.
  2. Hemen bir izolasyon çözeltisi içine yerleştirme (26 mM NaHCO 3, 2,5 mM NaH 2 PO 4, 20 mM glükoz, 65 mM NaCl, 20 mM KCI, ve 1 mM EDTA nükleaz serbest su içinde çözülür ve steril filtre).

2. İnsan Mantar şeklinde Tat papilla Sindirim

İnsan mantarbiçim tat hücresi papilla küçük farklılıklar ile iki farklı enzimatik sindirimi protokolleri kullanarak dissosiye olabilir.

  1. Pronaz (1 mg / ml, Sigma Aldrich) ve elastaz (1 mg / ml Sigma Aldrich) 30-45 dak (protokol 1) için oda sıcaklığında ile izole çözelti içinde inkübe mantarbiçim papilla.
  2. Kollajenaz tip I (Worthington den 550 U / ml) ile inkübe mantarbiçim papilla + elastaz (10 Wort U / mL,için hington) 35 2 ml kalsiyum ücretsiz Ringer çözüm + tripsin inhibitörü (Worthington 0.9 mg / ml) ° 30 dakika ve% 95 O 2 /% 5 CO 2 nazik oksijenlenme için sirkülasyon C su banyosu. (Alternatif yöntem sindirim, protokol 2)
  3. Inkübasyondan sonra, zil ile papilla yıkayın ve 10 kez yangın parlatılmış cam Pasteur pipeti ile papilla öğütmek.
  4. RT 2500 rpm'de 3 dakika için santrifüjleyin ve izolasyon çözüm kaldırmak ve tat hücre kültürü ortamında 1 ml ekleyin.
  5. Cam tabak içine sindirmek mantarbiçim papilla aktarın.
  6. Cerrahi jilet ile nazikçe mantarbiçim papilla parçalara ayır.
  7. Sıçan kuyruğu kollajen tip-1 kaplı coverslip üzerine klonlama silindir içine disseke papilla 250 ul ekleyin.
  8. Her oyuğuna tat hücre kültür aracı maddesi 1 ml ilave edilir.

3. İnsan Mantar şeklinde Lezzet papilla hücrelerinin Kültürleme

  1. Nemlendirilmiş bir içinde 36 ° C'de inkübe plakasıinkübatör% 5 CO 2 içeren.
  2. Tam medyum birinci değişim öncesinde 2 gün süreyle bozulmamış bir inkübatörde yerleştirin. 1 ila 3 gün içinde açıkça görünür olmasa da tadı hücreler sonunda, kaplamalı coverslip bağlanacaktır.
  3. Tamamen plaka ve ortamdan klonlama silindir çıkarın ve her kuyuya tat hücresi orta 1 ml ekleyin.
  4. Her ortamda 6-7 gün 1/3 'değiştirin. Daha sık ve / veya tamamen orta değiştirmeyin.
  5. Her gün mikroskop altında hücre büyümesini kontrol edin. Yeni hücrelerin çoğu hücre kümeleri altında büyür. Hücre kümeleri genellikle kültür 2-3 hafta yeni oluşturulan hücreler ayrıldıktan sonra ayırın.
  6. Bir kez klonlama silindirin% 40-50 tat hücreleri genişleyen kaplı, 36 2-3 dakika w / v tripsin / EDTA% 0.25 kullanarak hücrelerin trypsinize ° C
  7. 15 ml'lik tüplere kuyu hücreleri transferi, oda sıcaklığında 5 dakika boyunca 3000 rpm'de santrifüj tat hücre kültür aracı maddesi ilave 3 hacimleribelgelendiğinden.
  8. Tat hücresi orta 1 ml süpernatan ve Pastör pipetiyle hücreleri çıkarın.

4. İnsan Mantar şeklinde Lezzet papilla hücrelerinin yayılması

  1. T25 plaka içine hücreleri aktarın ve tat hücresi orta (pasaj 0) 4 ml ekleyin. 36 nemlendirilmiş bir inkübatör ° C CO 2% 5 içeren hücrelere koruyun.
  2. Kültürlü tat hücrelerinin% 100 izdiham ulaşana kadar her ortamda 6-7 gün 1/3 'değiştirin. Bu zamanda, hücre hasat etmek tat sağlamak için, steril bir kez PBS ile yıkayıp sonra hücreler 36 az 2-3 dakika boyunca% 0.25 w / v tripsin / EDTA kullanılarak hücrelerin ° C. trypsinize
  3. Yukarıda tarif edildiği gibi santrifüjünden sonra taze T-75 şişeler (pasaj 1) için tam bir tat hücresi, orta ve transfer hücrelerde yeniden süspanse.
  4. Her ortamda 6-7 gün 1/3 'değiştirin. Daha sık ve / veya tamamen orta değiştirmeyin.
  5. Hücrelerinin% 100'e yakın izdiham ulaştığınızda 4.3 ve 4.4 adımı yineleyin. Bir şişe içinde 1:04 T75 seyreltme daha fazla için hücreler ayrılırzamanla hücrelerinin büyümesini sürdürmek için yeterli.

5.. Kültürlü İnsan Mantar şeklinde Tat papilla hücreleri Donma ve Çözülme

  1. Temel tat hücrelerinin stokları dondurmak için, tripsinizasyon sonra (adım 4.2), 3 ml tam tat hücresi, orta ve steril 15 ml konik santrifüj tüplerine transfer hücreleri ekleyin. Oda sıcaklığında 5 dakika boyunca 2500 rpm'de santrifüje.
  2. Dikkatle% 95 Fetal Bovine serum (FBS) ve% 5 DMSO içeren dondurma orta uygun hacmi süpernatan ve yavaşça Pastör pipetiyle hücreleri çıkarmak.
  3. Etiketli, steril cryovials, kapağı sıkıca ve izopropanol içeren bir dondurma kap içinde yere hücreleri aktarın. Önceden sıvı azot ile süresiz aktarılması için en az bir gün için -80 ° C dondurucu içine yerleştirin.
  4. 37 donmuş primer insan mantarbiçim tadı papilla hücrelerinin, yer bir şişe çözülmeyi ° C su banyosuna kadar laminer akış hücre kültürü çalışırken, sadece (yaklaşık 1 dakika) çözülmüşbaşlık.
  5. Steril bir 15 ml konik santrifüj tüpüne hücreleri ve dondurma orta aktarın ve tat hücre kültürü ortamında 5 ml ekleyin.
  6. Oda sıcaklığında 5 dakika boyunca 2500 rpm'de santrifüje hücreleri. Dikkatle tam tat hücre kültürü, orta ve steril bir T-25 doku kültürü şişesi için transferi ile süpernatant, hafifçe Pastör pipetiyle hücreleri atın.
  7. 4-3 Adım göre kültürü hücre devam etmektedir.

6. Temsilcisi Sonuçlar

Kültüründe tat biyopsileri büyümeye girişimleri zaman% 90 başarılı olmuştur. Biyopsi ve ayrışma birkaç gün sonra, hücreler tipik ayrışma işlemden sonra kalan disseke mantarbiçim doku parçaları dışarıya doğru büyür ve göç etmeye başladılar. Tek tek hücrelerin kaplama (Şekil 1A) sonra 24-48 saat görünür olmasına rağmen, hücreler bazen kızı hücreleri (Şekil 1B) üreten, en fazla bağlı hücre kümeleri altında 2-3 hafta için büyüdü. Biyopsikültüründe 4 hafta içinde 8000 hücreleri - ing 4-8 insan mantarbiçim papilla, birincil insan mantarbiçim tat papilla hücrelerinin ilk izole yaklaşık 2000 ulaşır. Ek 3-4 hafta süre ile T25 hücre kültür şişeleri (pasaj 0) genişleme (Şekil 1C) adapte kültürü insan mantarbiçim tat papilla hücrelerine sahip neden olacaktır. Birincil insan mantarbiçim tadı papilla hücrelerinin daha fazla 3-4 hafta (Şekil 1D) içinde geçit-1 ile en az bir milyon hücre yukarı verim kültür genişletilebilir. İlköğretim tat hücrelerinin fazla 8 pasajları için büyümeye devam edecektir.

Kültüründe kültüre insan mantarbiçim tat papilla hücrelerinin kültür morfolojisi duyusal hücreleri ile benzer olmuştur daha önce tarif 11,12 .. En kültürlü insan mantarbiçim tadı papilla hücrelerinin kadar 15-30 gün ya da bir veya daha fazla işlem olmadan hücre gövdelerinin orijinal kompakt görünümünü korumuştur. Onlar izdiham kültür ce en ulaştı sonraLLS polarize-uzun görünüşü vardı. Olgun tat hücreleri birkaç farklı histolojik alt ve sergi tat hücresi belirli özellikler oluşur. İşte bu kültürler içindeki hücrelerin olgun tat hücrelerinin karakteristik birçok moleküler ve fizyolojik özellikleri görüntüler olduğunu göstermektedir. Gustducin ve fosfolipaz C - β2, (PLC-β2) mRNA ters transkriptaz-polimeraz zincir reaksiyonu ve sıralama (Şekil 2) ile teyit ürünleri tarafından tespit edildi. Gustducin ve PLC-β2 ekspresyon immunocytochemically tip II-benzeri hücreleri (B ve D, sırasıyla Şekil 3) varlığını gösteren tespit edildi. Yaygınlığı ve gustducin ve PLC-β2 hücre sinyal yolları ve hücre tiplerini yansıtan tam in vivo görülen yansıtmamaktadır göreceli ifade kalıpları. Bir tat tomurcuğu içinde farklı hücre tiplerinin nispi dağıtımı yöneten faktörler bilinmemektedir ve kültür koşullarında çoğaltılmış olabilir. Bu nedenle, b kültür hücreleri ve in vivo meslektaşları manipüle ve izlenebilir koşullar altında, moleküler düzeyde bu özelliklerin düzenlenmesi incelemek için bir fırsat arasındaki benzerlikleri ve farklılıkları oth.

Bir model sistemi için önemli bir kriter ilgili fonksiyonel özelliklerinin bulunmasıdır. Kültür hücreler de çeşitli tat uyaranlara (Şekil 4) uygun konsantrasyonları yanıt olarak hücre içi kalsiyum güçlü artışlar sergiledi. Bu çalışmalarda, tatlı ve acı uyaranlara depolarizasyon karşılık gelebilir hücre içi kalsiyum artışı ortaya çıkarmak. Bu tat hücreleri gibi kültürlü hücrelerin özellikleri burada tarif model sistem iletim yollarının ve insan tat hücrelerin rejeneratif kapasitesinin ileri çalışmalar için değerli bir varlık olacağını iddia etmek destekliyoruz.

fig1.jpg "/>
Şekil 1. Eklenti ve kültürlü insan mantarbiçim tat papilla hücrelerinin morfolojisi. Kollajen tip-1 kaplı plakalar üzerinde yetiştirilen Birincil insan mantarbiçim tadı papilla hücre kültürleri 2 gün (A) sonra görüntülendi. İnsan mantarbiçim tat papilla hücrelerini yavru hücrelere yol göründü bağlı hücre kümeleri altında 4 hafta için büyüdü. Hücreler tipik olarak dört hafta (B) içinde birleştiği büyümüş ve (C ve D) hasat ve sırasıyla yeniden tohumlama gün sonra 2 ve 4 hafta temsil eder. Kültür hücrelerinin en az 8 ay boyunca büyümeye devam etti. Ölçek bar = 50 nm. Şekil 1, bir kısmı da Özdener ve sunuldu. ark. 10.

Şekil 2
Şekil 2,. RT-PCR sonuçlar spesifik tat hücre belirteç mRNA'lar (gustducin ve PLC-β2) varlığında göstermiştir. Kültürlü insan mantarbiçim hücrelerinden RNA revers transc olduRT-PCR (Invitrogen) için Superscript First Strand Synthesis Sistemi kullanılarak ribed ve gustducin ve PLC-β2 saptanması için özel olarak tasarlanmış olan primerler yükselterek PCR için kullanıldı. Primerler (Tablo 1) bir veya daha fazla intron yayılan seçilmiştir. Her mRNA geçişini 4 veya sıralama ile teyit beklenen boyutu amplifikasyon ürünleri ile 5, kültürlerinde insan mantarbiçim tat papilla hücrelerini tespit edildi. Özgül mRNA hiçbir genomik DNA kirlenme gösteren ters transkriptaz olmadan kontrol deneyleri saptanmadı. PCR ürünlerinin% 2 agaroz jeli üzerine ayrıldı ve jel üzerinde, amplifiye ürün bir ustura ile çıkarıldı. DNA QIAquick Jel Ekstraksiyon Kiti (Qiagen) kullanılarak jelden ekstrakte edildi. PCR ürünleri Pennsylvania Sıralama tesislerinin Üniversitesi dizilenmisti.r. C-PCR ve C-RT sırasıyla, PCR ve Reverse Transcriptase için kontrol deneyleri vardır. Şekil 2, bir kısmı da Özdener ve sunuldu. ark.

Şekil 3
Şekil 3. Kültürlü insan mantarbiçim tadı papilla hücrelerinin geçişini 4 veya 5 İmmünoboyama tat hücresi biyolojik varlığını gösterdi. Cultured insan mantarbiçim tat papilla hücreleri (5 günlük) 4 ° C'de gece boyunca (Tablo 2) 4% paraformaldehit ile sabitlenir ve primer antikor ile birlikte inkübe edildi Görüntüler bir Leica TCS-SP2 konfokal lazer tarama mikroskobu ile elde edildi. Yaklaşık olarak, kültür mantarbiçim tat papilla hücreleri% 60 gustducin (B) ve β2 PLC-(D) ile% 20-30 etiketli edildi. Tekabül eden hücrelerin iletim görüntüleri (A ve C) gösterilmektedir. Denetimler için, antikor spesifik immunglobulin ile immünboyama nonspesifik immün reaktivitesi (veriler gösterilmemiştir) olmadığını göstermiştir. Ölçek bar = 50 nm. BölümŞekil 3, aynı zamanda Özdener et sunulmuştur. ark. 10.

Şekil 4
Geçit 4 veya 5 Şekil 4. Kültüre insan mantarbiçim tadı papilla hücrelerinin farklı uyaranlara yanıt verir. Kültürlü insan mantarbiçim tat papilla hücrelerinin (4-5 günlük) 1mM Fura-2 AM (Molecular Probes) ve 10 mg / ml Pluronic F 127 (Molecular Probes) yüklendi. Kültürlü insan mantarbiçim tat papilla hücrelerinin hücre içi kalsiyum düzeyi ([Ca 2 +] i) değişiklikler standart manuel görüntüleme teknikleri kullanılarak ölçüldü. Hücreleri 340 nm ve 380 nm eksitasyon dalga boylarında ters bir floresan mikroskop ve 510 nm de bir bant geçiren filtre tarafından belirlenen emisyon dalgaboyu kullanılarak görüntülenmiştir. Gerekirse uyaranlara Banyo çözeltisi içinde çözülür ve daha sonra pH değeri yeniden ayarlanması ve osmolarite edildi. Kültürlü insan mantarbiçim tadı papilla hücrelerinin tatlı ve acı uyaranlara cevap verdi. Graphs [Ca 2] ile temsil yanıtları göstermek için maruz (A) denatonyum (2 mM), (B) Sucralose (1 mM) içinde tek tek hücrelerin in i seviyeleri. Her eser tek tek hücreleri temsil eder.

Gen Dizi PCR koşulları Beklenen boyutu
(Bp)
Referans
β-Aktin GGACTTCGAGCAAGAGATGG
AGCACTGTGTTGGCGTACAG
7 dakika
45 sn
45 sn
45 sn
7 dakika
95
94
53
72
72
234 NM_001101.3
Gustducin TCTGGGTATGTGCCAAATGA
GGCCCAGTGTATTCTGGAAA
7 dakika
45 sn
45 sn
45 sn
7 dakika
95
94
53
72
72
386 NM_001102386
PLC-β2 GTCACCTGAAGGCATGGTCT
TTAAAGGCGCTTTCTGCAAT
3 dakika
30 sn
30 sn
60 sn
7 dakika
95
94
53
72
72
333 NM_004573

Tablo 1. Tat spesifik molekülleri saptamak için kullanılan primerler ve koşulları.

Primer antikor Kaynak Ana Seyreltme İkincil Antikor Kaynak Ana Seyreltme
Gustducin Santacruz Tavşan 1:500 Anti-tavşan IgG Alexa 633 Molecular Probes Keçi 1:500
PLC-β 2 Santacruz Tavşan 1:500 Anti-tavşan IgG Alexa 633 Molecular Probes Keçi 1:500

Tablo 2. Antikorlar spesifik molekül tespit ifadesi için kullanılabilir.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Biz 12 aylık bir dönemi kapsayan, 8 üzerinden geçişler için insan mantarbiçim tat papilla elde edilen hücrelerin korumuştur. Bu kültürler bunlar tat reseptör hücrelerinin anahtar moleküler ve fizyolojik özelliklerine ilave olarak, olgun tat hücre tipleri birkaç belirteçler ifade burada aşama için in vitro olgunlaşması birçoğu yeni hücreler, üretir. Varlığı gustducin-ve PLC-β2 kültürlü hücrelerin alt gruplarında immünoreaktivite bu sonuç ile tutarlıdır. En önemlisi, bazı hücreler disosiye tat hücreleri 5, tat tomurcuğu dilim 3 ve kültürlü insan ve sıçan tat hücreleri 19,10 hücrelerin bir özelliği olan, hücre içi kalsiyum geçici artışlar ile tatlı ve acı bir tadı uyaranların uygulamaları yanıt verdi. Bu kültür hücrelerin bazı tatlı ve acı için moleküler reseptörleri ifade ettiğini sadece gösterir, ancak calci üretmek için yeterli G-protein kenetli transdüksiyon çağlayan vardıyanıtları um.

Uzun süreli primer hücre kültürleri genellikle hücrelerin fizyolojik fonksiyonu bir rol oynayabilir özgün doku ve hücre yapısı ve hücresel faktörlerden muhafaza edemez. Insan mantarbiçim tat papilla hücre kültürü başarılı uzun vadede kurulması ile büyük bir ilerleme henüz sınırlamalar bir takım belirtilmelidir yapılmıştır. Bunların arasında en önemlisi primer kültürlenmiş hücrelerde her parti kültürü başlatmak için kullanılan hücrelerin, başlangıç ​​popülasyonda farkına bağlı olarak değişebilir olmasıdır. Primer hücre kültürleri genellikle hücrelerin fizyolojik fonksiyonu rol oynayan özgün doku organizasyonu ve yapısı ve büyüme faktörleri özledim. Kültürlerin% 100 izdiham büyüdü asla gibi hücreler, diğer hücrelerin temas her zaman ve tamamen sık değildir. Genel olarak, birincil hücreler de dediferansiyonunu tabidir, ve sürekli hücre li hücre çoğaltma sırasında kayıp ya da kromozom kazançları ile karakterize kromozomal instabilite,eşya, bir başka sorun, 13,14,15 olabilir. Dilin kültüre nontaste hücreler ile insan kültüre mantarbiçim hücrelerin karşılaştırma araştırılması gereklidir. Anlayışımızı tamamlanmadan önce bu soruları pek çok deneysel yaklaşımlar ve model sistemlerinin kullanımını gerektirir.

Sonuç olarak, bu protokol Burada tanımlanan ilgili hücre-fizyolojik ve moleküler özelliklerini kaybetmeden en az 8 pasajları (12 ay) için in vitro insan mantarbiçim tat papilla hücrelerini koruyarak sağlar. Bu uzun süreli primer kültür daha da geliştirilmesi proliferasyonu ve farklılaşmasını, uyaran özgünlüğü, çapraz-talk ve insan tat reseptör hücreleri gibi doku rejenerasyonu adaptasyonu özelliklerinin çalışmaları için bir model sistemi sağlar. Ayrıca, enfeksiyon gibi tat hücre fonksiyonu bozan koşulların etkileri, ilaçlar, radyasyon, toksik veya kimyasal maddelere moleküler ve fizyolojik düzeyde incelenebilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Çıkar çatışması ilan etti.

Acknowledgments

Biz Aimee Myers ve teknik beceri ve yardım için Esi Quayson teşekkür ederim. Bu çalışma NSF 0216310 ve GIVAUDAN Inc hibe (NER) tarafından kısmen desteklenmiştir.

References

  1. Mbiene, J. P., Maccallum, D. K., Mistretta, C. M. Organ cultures of embryonic rat tongue support tongue and gustatory papilla morphogenesis in vitro without intact sensory ganglia. J. Comp. Neurol. 377, 324-340 (1997).
  2. Miyamoto, T., Fujiyama, R., Okada, Y., Sato, T. Strain difference in amiloride-sensitivity of salt-induced responses in mouse non-dissociated taste cells. Neurosci. Lett. 277, 13-16 (1999).
  3. Caicedo, A., Jafri, M. S., Roper, S. D. In situ Ca2+ imaging reveals neurotransmitter receptors for glutamate in taste receptor cells. J. Neurosci. 20, 7978-7985 (2000).
  4. Qin, Y. M., Shi, J. Q., Zhang, G. H., Deng, S. P., Wang, T. H. A reliable method to obtain cells of taste buds from fungiform papillae of mice. Acta Histochem. 112, 107-112 (2010).
  5. Spielman, A. I., Mody, I., Brand, J. G., Whitney, G., MacDonald, J. F., Salter, M. W. A method for isolating and patch-clamping single mammalian taste receptor cells. Brain Res. 503, 326-329 (1989).
  6. Kishi, M., Emori, Y., Tsukamoto, Y., Abe, K. Primary culture of rat taste bud cells that retain molecular markers for taste buds and permit functional expression of foreign genes. Neuroscience. 106, 217-225 (2001).
  7. Ruiz, C. J., Stone, L. M., McPheeters, M., Ogura, T., Bottger, B., Lasher, R. S., Finger, T. E., Kinnamon, S. C. Maintenance of rat taste buds in primary culture. Chem. Senses. 26, 861-873 (2001).
  8. Stone, L. M., Tan, S. S., Tam, P. P., Finger, T. E. Analysis of cell lineage relationships in taste buds. J. Neurosci. 22, 4522-4529 (2002).
  9. Ozdener, H., Yee, K. K., Cao, J., Brand, J. G., Teeter, J. H., Rawson, N. E. Characterization and long-term maintenance of rat taste cells in culture. Chem. Senses. 31, 279-290 (2006).
  10. Ozdener, M. H., Brand, J. G., Spielman, A. I., Lischka, F. W., Teeter, J. H., Breslin, P. A., Rawson, N. E. Characterization of Human Fungiform Papillae Cells in Culture. Chem. Senses. 36, 601-612 (2011).
  11. Gomez, G., Rawson, N. E., Hahn, C. G., Michaels, R., Restrepo, D. Characteristics of odorant elicited calcium changes in cultured human olfactory neurons. J. Neurosci. Res. 62, 737-749 (2000).
  12. Wolozin, B., Sunderland, T., Zheng, B. B., Resau, J., Dufy, B., Barker, J., Swerdlow, R., Coon, H. Continuous culture of neuronal cells from adult human olfactory epithelium. J. Mol. Neurosci. 3, 137-146 (1992).
  13. Wick, N., Saharinen, P., Saharinen, J., Gurnhofer, E., Steiner, C. W., Raab, I., Stokic, D., Giovanoli, P., Buchsbaum, S., Burchard, A., Thurner, S., Alitalo, K., Kerjaschki, D. Transcriptomal comparison of human dermal lymphatic endothelial cells ex vivo and in vitro. Physiol. Genomics. 17, 179-192 (2007).
  14. Fu, L., Zhu, L., Huang, Y., Lee, T. D., Forman, S. J., Shih, C. C. Derivation of neural stem cells from mesenchymal stemcells: evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109-1121 (2008).
  15. Sandow, S. L., Grayson, T. H. Limits of isolation and culture: intact vascular endothelium and BKCa. Am. J. Physiol. Heart Circ. Physiol. 297, H1-H7 (2009).
İnsan Mantar şeklinde Lezzet papilla hücrelerinin izolasyonu ve Kültürü
Play Video
PDF DOI

Cite this Article

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).More

Ozdener, H., Spielman, A. I., Rawson, N. E. Isolation and Culture of Human Fungiform Taste Papillae Cells. J. Vis. Exp. (63), e3730, doi:10.3791/3730 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter