Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

تحليل خلية معينة من doi: 10.3791/4214 Published: October 4, 2012

Summary

وهناك طريقة لإنتاج

Abstract

بعد الشروع في منشم ورقة، يتم التحكم تراكم الكتلة الحيوية بشكل رئيسي من قبل تكاثر الخلايا والتوسع في الأوراق 1. ومع ذلك، فإن ورقة ل arabidopsis هو جهاز معقد يتكون من العديد من أنواع مختلفة من الخلايا والهياكل عدة. في الوقت نفسه، ورقة تحتوي على خلايا النمو في مراحل مختلفة من التنمية، مع خلايا أبعد من كونها أول سويقات لوقف توسيع والخضوع الشيخوخة 1. خلايا مختلفة داخل ورقة يتم تقسيم لذلك، أو التمطيط تمييز؛ بالموقع، وشدد أو ميتا، و / أو الاستجابة للمحفزات في مجموعات فرعية من نوعها الخلوية في أي وقت من الأوقات. هذا يجعل الدراسة الجينومية تحديا للأوراق: على سبيل المثال عند تحليل البيانات من أوراق التعبير كلها، إشارات من شبكات الوراثية العاملة في مناطق متميزة استجابة الخلوية أو أنواع الخلايا سوف يكون مرتبك، مما أدى إلى الملف غير دقيقة التي يتم توليدها.

لمعالجة ذلك، قوقد وصفت وسائل everal الدراسات التي تمكن من التعبير الخلية الجينات المحددة. وتشمل هذه الليزر التقاط تسليخ مجهري (LCM) 2 أو النباتات GFP التعبير المستخدم لتوليد البروتوبلازم واللاحقة مضان تنشيط الخلايا الفرز (FACS) 3،4، ونظام وصف مؤخرا INTACT لهطول الأمطار النووية 5 و مناعي من polysomes 6.

وقد استخدمت بنجاح لFACS عدد من الدراسات، بما في ذلك تبين أن هوية الخلية والمسافة من قمة الجذر كان لها تأثير كبير على ملامح التعبير من عدد كبير من الجينات 3،7. كما تم FACS GFP من خطوط الخلايا المستخدمة لإثبات محددة خلال تنظيم النسخي الردود النيتروجين الجذر الوحشي والتنمية الجذرية 8، 9 توزيع الملح الإجهاد أوكسين في جذر 10 و لإنشاء خريطة التعبير الجيني من النسيج الإنشائي القمي ل arabidopsis تبادل لاطلاق النار 11. رغم أنوقد سبق FACS تستخدم لفرز أوراق protoplasts ل arabidopsis المستمدة يعتمد على تألق ذاتي 12،13، وقد تم حتى الآن استخدام FACS على خطوط التعبير عن GFP ل arabidopsis في أوراق محدودة جدا 4. في البروتوكول وصفنا التالية طريقة للحصول على ورقة protoplasts ل arabidopsis التي تتوافق مع FACS مع التقليل من تأثير البروتوبلازم نظام الجيل. نحن لشرح طريقة استخدام خط ل arabidopsis KC464، التي ترتبط صريح بناء GFP في البشرة متجه نحو المحور 14، السطر KC274، التي تعبر عن GFP في الأنسجة الوعائية (14) والخط ل arabidopsis TP382، والتي تعبر عن ضعف GFP إلى إشارة توطين النووية في الخلايا حارس (البيانات لا تظهر؛ الشكل 2). نحن نستخدم هذه الطريقة في الوقت الحالي لدراسة كل خلية من نوع التعبير محددة خلال تطوير والإجهاد، فضلا عن السكان غير متجانسة الخلايا في مراحل مختلفة من الشيخوخة.

Protocol

1. البروتوبلازم الجيل

  1. حصاد الأوراق والمواد مقطعة إلى شرائح 1 مم واسعة (الشكل 1) مع شفرة حلاقة. يمكن للأن العينات التي تحتوي على أكثر من ورقة واحدة تصل إلى 15 ورقة مكدسة بسهولة قبل القطع.
  2. نقل على الفور الشرائط ورقة في طبق بتري الجولة 9 سم تحتوي على 20 مل محلول A (400 ملي مانيتول، 20 هيدرات MES ملي، 20 ملي بوكل، 10 ملي CaCl 2، 2 ملم MgCl 0.1٪ و 2.5 ملي BSA β-المركابتويثانول، درجة الحموضة 5.7) بما في ذلك الإنزيمات protoplasting (1.2٪ السليلوز R-10، 0.6٪ و 0.4 RS السليلوز٪ macerozyme R-10) ومثبطات ريبونوكلياز والنسخي (1 × ProtectRNA و 10 ميكروغرام / مل الاكيتنوميسين D)؛ فصل بلطف ورقة وشرائط فراغ التسلل ل2 × 5 دقائق.
  3. تعيين مكان طبق بتري على شاكر المداري إلى 90 دورة في الدقيقة في درجة حرارة الغرفة والبروتوبلازم للساعة 3-4.
    1. يجب أن الحضانة خلال فصل شرائط ورقة عن بعضها البعض، عن طريق استخداممجموعة من ملاقط شقة، في نصف ساعة فترات.
  4. وضع الخلية ميكرون 70 مصفاة (فيشر العلمية) في أنبوب 50 مل وتصنف بلطف الحل من خلال protoplasting. سيؤدي هذا إلى إزالة الشرائط ورقة، والتي سيتم الاحتفاظ بها من منخل بينما يسمح للprotoplasts من خلال الذهاب.
  5. غسل الشرائط ورقة مع حل مل 4 A وفلتر من خلال غربال بلطف نفسه.
  6. نقل protoplasts في أنابيب أسفل الجولة وأجهزة الطرد المركزي الحل البروتوبلازم في 300 x ج لمدة 5 دقائق لprotoplasts بيليه.
  7. نضح بلطف أكبر قدر من طاف ممكن من دون إزعاج protoplasts.
  8. غسل protoplasts مع الحل 5 مل A وأجهزة الطرد المركزي في 300 x ج لمدة 5 دقائق. إزالة طاف
  9. إعادة تعليق على protoplasts في حجم مناسب لإيجاد حل، وذلك باستخدام ماصة باستور أو تلميح P1000 قطع.

2. FACS من Protoplasts ليف

  • مباشرة قبل الفرز، وإعادة تعليق protoplasts باستخدام (غير قطع) P1000 تلميح لتجنب تراكمها protoplasts معا.
  • نقل إلى أنبوب protoplasts الفرز من خلال مرشح ميكرومتر filcon 50 (BD العلوم البيولوجية) وتمييع حسب الاقتضاء لتجنب انسداد فوهة من فارز الخلية. يتم فرز protoplasts باستخدام فوهة ميكرومتر 100 في ضغط من 20 رطل لكل بوصة مربعة (غمد) و21-21،5 PSI (العينة)، تردد قدرها 39.2 كيلو هرتز ومعدل حالة <4000 (هذه الإعدادات هي الأمثل على خلية تدفق BD فارز قد دينار بحريني (العلوم البيولوجية). الأمثل على غيرها من آلات الفرز الخلية تحتاج تعديلات على هذه الإعدادات).
  • يتم تحديد protoplasts GFP إيجابية باستخدام الليزر 488 نانومتر الأرجون والتآمر على الإخراج من ممر الموجة مرشح 580/30 (البرتقال) مقابل تصفية 530/40 ممر الموجة (الخضراء). سوف تكون إيجابية protoplasts GFP في السكانية العالية 580 530/low، مع المنظمات غير GFP protoplasts في عدد السكان منخفضة 580 530 / منخفضة والأموات / protoplasts الموت والحطام في الشعبية التي عالية 580lation (الشكل 2).
    1. عندما يكون الترتيب protoplasts التي سيتم استخراج الحمض النووي الريبي، ينبغي فرزها protoplasts مباشرة إلى ما لا يقل عن 4 مجلدات للتحلل تحتوي على مخزن مؤقت عامل مختزل (مثل β-المركابتويثانول). وبالإضافة إلى ذلك، ينبغي أن يقتصر ذلك الوقت نوعا من عينة واحدة ل20-30 دقيقة، وبحد أقصى من سنتين إلى ثلاث عينات معالجتها في وقت واحد.
    2. لرؤية protoplasts مصنفة، ينبغي فرز protoplasts مباشرة إلى ما لا يقل عن 8 مجلدات عن حل وجمعها في وقت لاحق عن طريق الطرد المركزي لتركيز protoplasts.
  • 3. ممثل النتائج

    يصف هذا البروتوكول طريقة للحصول على protoplasts من أوراق arabidopsis، والتي تستخدم لتنشيط الخلايا الفرز مضان (الشكل 1). الجيل البروتوبلازم في وجود مثبطات ريبونوكلياز والنسخي يمنع الخلايا وROM تصاعد استجابة النسخي. هذا لا يكون نتيجة لمما أدى إلى العديد من القتلى وprotoplasts الموت، التي لديها قدر كبير من تألق ذاتي. عندما يكون الترتيب على استعداد protoplasts مع هذا الأسلوب هو بالتالي الشائع جدا أن نرى العديد من السكان متميزة في الرسوم البيانية من 580 نانومتر مقابل 530 نانومتر مضان المستخدمة في الفرز. وترد أمثلة على هذا، جنبا إلى جنب مع بوابات الفرز المستخدمة في هذا البروتوكول في الشكل 3.

    يمكن فرز Protoplasts إلى 8 مجلدات من حل وجمعها لتصور للتحقق من تخصيب اليورانيوم. 2G يوضح الشكل مثالا على ذلك باستخدام خط TP382، الذي يعبر عن GFP في خلايا الحرس.

    وترد أمثلة على العوائد التي تم الحصول عليها باستخدام هذه الطريقة، قبل وبعد التضخيم، في الجدول 1. المبالغ التي تم الحصول عليها كافية لتضخيم باستخدام نظام WTA الحفاوة بيكو (500 خريج-50 نانوغرام)، وبالتالي ليالي ubsequent التحليل من قبل أي من qPCR (الشكل 4)، بجانب جيل أو التسلسل ميكروأري.

    الشكل 1
    الشكل 1. سير العمل الإجمالي للتجربة. 1) حصاد أوراق الفائدة من GFP التعبير عن خط ل arabidopsis. 2) بسرعة إلى قطع شرائح 1 ~ واسعة ونقل على الفور مم في حل هذه protoplasting والفراغ التسلل. 3) احتضان لمدة ساعة 3-4. 4) حل بلطف البروتوبلازم الترشيح من خلال غربال ميكرومتر 70، نقل لجولة أنابيب أسفل وprotoplasts بيليه بواسطة الطرد المركزي. 5) مباشرة قبل الفرز، protoplasts إعادة تعليق ونقل إلى أنبوب الفرز من خلال ميكرومتر 50 مرشح. 6) ترتيب GFP إيجابية وسلبية protoplasts GFP قابلة للحياة. يمكن 7) الآن Protoplasts يتم تحليلها إما بصريا أو باستخدام تقنيات مثل qPCR، بجانب جيل أو التسلسل ميكروأري.

    together.within صفحة = "دائما"> الشكل 2
    الشكل 2. خطوط KC464، KC274 وTP382 المستخدمة في هذه الدراسة. A) قسم عرضية من ورقة تظهر التعبير GFP KC464 في البشرة متجه نحو المحور. B) Protoplasts المستمدة من KC464 الأوراق. C) قسم عرضية من ورقة تظهر التعبير GFP KC274 في الأوعية الدموية. D) Protoplasts المستمدة من KC274 الأوراق. E) ورقة تبين TP382 التعبير GFP في خلايا الحرس. F) Protoplasts المستمدة من TP382 الأوراق. G) مثال للتخصيب التي حصلت عليها من FACS GFP التعبير عن خلايا الحرس في الخلفية المعقدة من الخلايا ورقة، والتي تبين GFP تحتوي على protoplasts من 580 530/low السكانية العالية من protoplasts المستمدة من TP382 الأوراق. AF: صور المجهر متحد البؤر، G: الإسفار صورة المجهر. على نطاق والحانات داخل الصور هي 50 ميكرومتر.

    الشكل 3
    الشكل 3. نموذجي نقطة اقتناء قطع FACS الإخراج من نانومتر 580/30 (البرتقالي) في مقابل 530/40 نانومتر (الأخضر) مرشحات ممر الموجة (BD فارز الخلية تدفق). أبواب الفرز أظهرت هي تلك التي تستخدم عادة أثناء الفرز. A) نقطة قطعة protoplasts العقيد-4 أوراق المشتقة، protoplasted في غياب مثبطات، مما يدل على انخفاض واحد 530/low 580 السكان. B) نقطة مؤامرة من protoplasts العقيد WT-4 أوراق المشتقة، protoplasted في وجود مثبطات، مما يدل على تحول في مضان 580 بسبب الإجهاد والتلوين من مثبطات. CE) نقطة المؤامرات من أوراق protoplasts المستمدة من خطوط KC74، وKC464 TP382، على التوالي، protoplasted في وجود مثبطات، والتي تبين GFP تحتوي على السكان في 530/low عالية 580 السكان. وبالنظر إلى النسب المئوية للأحداث في السكان (الأعلى 530/low 580) GFP. اضغط هنا لمشاهدتها بشكل اكبر شخصية .

    e_content "FO: المحافظة على together.within صفحة =" دائما "> الشكل 4
    الشكل 4. GFP التعبير في الكسور السكان بوابات ممثل كما هو موضح في الشكل 3. تم الحصول على اثنين البيولوجية مكررات لكل نوع الكسر، تضخيم باستخدام الحفاوة بيكو WTA النظام وqPCR باستخدام GFP محددة الاشعال (الجدول 2) تم تنفيذ ذلك الحين. القيم المعروضة هي أعلى (الأحمر)، والقيم النسبية أقل (الخضراء) والمتوسط. وكان عدد السكان 580 عالية في هذه الحالة تقسيم في اثنين، وانخفاض 530/low 580 و 530/low عالية 580، والتي كانت تستخدم لتكرار واحد البيولوجية حتى يظهر فقط قيمة واحدة. وقد استخدم ACT2 (At3g18780) كمعيار لجميع العينات. ورقة: ورقة الجامعة. لم يتم فرزها: protoplasts لم يتم فرزها. GFP1: 530/low عالية 580 و Rest1: 530/low منخفضة 580، GFP2: 530/high عالية 580 و Rest2: 530/high منخفضة 580، كما هو موضح في الشكل (3) وأدخل. النتائج هي يا التحققو التقييمات البصرية من محتوى الخلية GFP في الكسور مصنفة (2G الشكل على سبيل المثال). اضغط هنا لمشاهدتها بشكل اكبر شخصية .

    عينة عدد الأوراق عدد الخلايا الحمض النووي الريبي العائد
    (NG)
    الحمض النووي الريبي العائد
    (تضخيم؛ نانوغرام)
    كلها رقة A
    كلها أوراق B
    1
    1
    -
    -
    8001
    10525
    4623 ***
    4572 ***
    لم يتم فرزها protoplasts A
    لم يتم فرزها protoplasts B
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    GFP1 A
    Rest1 A
    15 6039 (0.39٪ *)
    55389 (6.4* 0٪)
    - **
    - **
    861
    489
    GFP1 B
    Rest1 B
    15 10783 (0.63٪ *)
    57040 (7.49٪ *)
    - **
    - **
    537
    420
    GFP2
    Rest2
    15 18337 (1.49٪ *)
    62405 (73.49٪ *)
    - **
    - **
    360
    411

    الجدول 1. عينات التي تم جمعها وتحليلها باستخدام FACS مع qPCR لتحديد أي جزء الواردة الحية، معربا عن GFP protoplasts. وشملت أيضا في هذا الجدول هو العائد الحمض النووي الريبي مجموع نانوغرام في قبل وبعد التضخيم مع نظام بيكو WTA الحفاوة (NuGen). وكما هو مبين GFP1، GFP2، وRest1 Rest2 كسور في إدراج في الشكل 4. * تعطى النسبة المئوية للخلايا على المدى الخلية فرز بين قوسين بجانب إجمالي عدد الخلايا في الكسر. لا ترتبط هذه النسب إلىتم إيقاف بعضهم البعض لكل عينة وهذا النوع FACS يمتد لكسور 'الراحة' في وقت سابق من لكسور GFP نظرا لعدد أكبر بكثير من الخلايا الراحة التي تم جمعها. ** 50 نانوغرام تستخدم كمدخل لتفاعلات التضخيم، وفقا بروتوكول الشركة المصنعة.

    كتاب تمهيدي تسلسل
    mGFP5-ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5-ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    الجدول 2. الاشعال qPCR.

    Discussion

    وقد وصفت لنا طريقة التي تسمح للاستخدام النباتات معربا عن GFP ل arabidopsis في الأوراق لتوليد البروتوبلازم واللاحقة الفرز الخلية باستخدام FACS. هذه الطريقة تعطي كميات كافية من الحمض النووي الريبي لاستخدامها لتضخيم والتحليل اللاحق لذلك من قبل أي من qPCR أو ميكروأري. والتخصيب في الكسور لفرز الخلايا التي تحتوي على GFP، كما يتبين من qPCR (الشكل 2).

    لتحقيق عوائد عالية من protoplasts الحية من الأهمية بمكان العمل بسرعة خلال الخطوات الأولية لهذا الإجراء، حتى شرائط ورقة تم الفراغ تسلل مع الحل البروتوبلازم التي تحتوي على مثبط. وبالإضافة إلى ذلك، عند إنشاء شرائح 1 مم ورقة من المهم جدا لشريحة أو قطع الأوراق بدلا من 'فرم' أو الهريس لهم، وهذا يؤدي إلى الضرر المفرط وبالتالي تحقيق عائد أقل البروتوبلازم.

    ووصف الفرق الحاسم بين طريقة أخرى هنا والمنشورهد طرق هو استخدام مثبطات مثبطات ريبونوكلياز والنسخي. يتم تطوير معظم الطرق لجذور arabidopsis، والتي يمكن أن تتولد protoplasts بسهولة أكبر. ومع ذلك، عند العمل مع أوراق، باستثناء نسيج الورقة المتوسط، من الضروري زيادة الوقت الجيل البروتوبلازم. ولذلك من المهم أن تشمل هذه مثبطات للحماية من التغيرات في التعبير الجيني نتيجة للمعاملة نفسها الجيل البروتوبلازم (المعطيات غير معروضة). ومع ذلك، فإن وجود مثبطات يؤدي إلى عدم القدرة على إيجاد رد فعل النسخ، إما عن طريق التحول الجينات أو إيقاف تشغيلها، والتي من المرجح أن تجعل protoplasts أكثر عرضة لأن هذا يؤدي إلى فقدان اللدونة التي لمواجهة الضغوط من protoplasting الداخلي.

    وقد استخدمنا الطريقة الموضحة هنا بنجاح مع عدد من خطوط، معربا عن GFP ل arabidopsis. الأهم من ذلك، وقد استخدمنا هذا الأسلوب مع خطوط التعبير عن GFP GFP إما بقوة فيالنواة، أو أكثر من ذلك بكثير ضعيفة بطريقة عصاري خلوي non-localized/diffuse، كما هو الحال مع خطوط KC464 KC274 وتستخدم هنا. كلا النوعين من خطوط متوافقة مع أسلوب وتسفر الكسور عالي التخصيب من GFP، معربا عن protoplasts (الشكل 2 و 3). يمكن أن يكون وسيلة تكيف بسهولة مع fluorophores الأخرى، على الرغم من يجب تحديد fluorophore لمضان التي تختلف كثيرا عن تألق ذاتي من الخلايا الميتة / الموت من أجل الحفاظ على القدرة على تحديد الخلايا الحية.

    Disclosures

    الإعلان عن أي تضارب في المصالح.

    Acknowledgments

    ويدعم عمل في المختبر، ولاستون بوكانان على التنميط المرحلة خلية من نوع والتنموية المحددة من قبل المشروع أغرون-OMICS (منحة # LSHG-CT-2006-037704) في إطار أولى برنامج ال 6 من المفوضية الأوروبية. ويدعم عمل في المختبر على خلايا جيفورد من نوع التنميط محددة من منحة BBSRC محقق جديد (BB/H019502/1).

    تم الحصول على خطوط KC274 KC464 ول arabidopsis من AAR ويب (جامعة كامبردج).

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    تحليل خلية معينة من<em&gt; ل arabidopsis</em&gt; يترك طريق الإسفار خلية المنشط الفرز
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter