Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Cell specifik analyse af doi: 10.3791/4214 Published: October 4, 2012

Summary

Fremgangsmåde til fremstilling

Abstract

Efter indledningen af bladet primordium er biomasse akkumulering styres hovedsageligt af celleproliferation og ekspansion i bladene 1. Imidlertid Arabidopsis blad er et komplekst organ, der består af mange forskellige celletyper og flere strukturer. Samtidig indeholder voksende blad celler på forskellige udviklingstrin, med cellerne længst fra stilken være den første til at stoppe ekspanderende og undergår ældning 1. Forskellige celler i bladet derfor dividere, forlængede eller differentiering, aktive, stresset eller døde, og / eller reagere på stimuli i sub-sæt af de cellulære type ad gangen. Dette gør genomisk undersøgelse af bladet udfordrende: for eksempel, når man analyserer udtryk data fra hele blade, signaler fra genetiske netværk inden for forskellige cellulære respons zoner eller celletyper vil blive forvirret, hvilket resulterer i en ukorrekt profil, der genereres.

For at løse dette, several metoder er blevet beskrevet, som muliggør studier af cellespecifik genekspression. Disse omfatter laser-capture mikrodissektion (LCM) 2 eller GFP-udtrykkende planter, der anvendes til protoplast generation og efterfølgende fluorescensaktiveret cellesortering (FACS) 3,4, den nyligt beskrevne INTAKT system for nuklear udfældning 5 og immunopræcipitation af polysomer 6.

FACS held er blevet anvendt for en række undersøgelser, også viser, at cellens identitet og afstand fra rodspids havde en signifikant virkning på ekspressionen profiler af et stort antal gener 3,7. FACS for GFP-linier er også blevet anvendt til at påvise cellespecifik transkriptionel regulering under root nitrogen svar og laterale rodudvikling 8, salt stress 9 auxin fordeling i roden 10 og at skabe en genekspression kort for Arabidopsis shoot apical meristem 11. SkøntFACS tidligere blevet anvendt til at sortere Arabidopsis blad afledte protoplaster baseret på autofluorescens 12,13, hidtil anvendelse af FACS for Arabidopsis der udtrykker GFP i bladene været meget begrænset 4. I den følgende protokol beskriver vi en fremgangsmåde til opnåelse Arabidopsis blad-protoplaster, der er kompatible med FACS og minimere indvirkningen af protoplast generation regime. Vi viser fremgangsmåden med KC464 Arabidopsis linje, der udtrykker GFP i adaxial epidermis 14, KC274 linje, der udtrykker GFP i vaskulært væv 14 og TP382 Arabidopsis linjen, som udtrykker en dobbelt GFP-konstruktion bundet til et kernelokaliseringssignal i De beskyttelsesceller (data ikke vist, figur 2). Vi i øjeblikket at bruge denne metode til at undersøge både celletypespecifik ekspression under udvikling og stress samt heterogene cellepopulationer på forskellige stadier af senescens.

Protocol

1. Protoplast Generation

  1. Høst bladmateriale og skæres i 1 mm brede strimler (figur 1) med et barberblad. For prøver indeholdende mere end en enkelt blad op til 15 blade let kan stables før skæring.
  2. Straks overføre blad strimler i en 9 cm rundt petriskål indeholdende 20 ml opløsning A (400 mM mannitol, 20 mM MES-hydrat, 20 mM KCI, 10 mM CaCl2, 2 mM MgCl2, 0,1% BSA og 2,5 mM β-mercaptoethanol, pH 5,7) herunder protoplasting enzymer (1,2% cellulose R-10, 0,6% cellulose RS og 0,4% macerozyme R-10) og RNase og transkriptionelle hæmmere (1 × ProtectRNA og 10 ug / ml actinomycin D), forsigtigt adskille blad strimler og støvsuge infiltrere for 2 × 5 min.
  3. Place petriskål på en orbitalryster sat til 90 rpm ved stuetemperatur og protoplast i 3-4 timer.
    1. Under inkuberingen bladet strimlerne skal være adskilt fra hinanden, ved anvendelse af etsat af flade pincet, ved halv time.
  4. Anbring en 70 pm cell strainer (Fisher Scientific) i et 50 ml rør og forsigtigt filtreres protoplasting opløsning igennem. Dette vil fjerne bladet strimler, som vil blive tilbageholdt af sigten, samtidig med at protoplasterne til at gå igennem.
  5. Vask bladet strimler med 4 ml opløsning A og forsigtigt filtreres gennem den samme sigte.
  6. Overfør protoplasterne i rundbundede rør og centrifuger protoplast opløsningen ved 300 x g i 5 min for at pelletere protoplasterne.
  7. Aspirer forsigtigt ud så meget af supernatanten som muligt uden at forstyrre protoplasterne.
  8. Vask protoplasterne med 5 ml opløsning A og centrifugeres ved 300 x g i 5 min. Fjern supernatanten
  9. Resuspenderes protoplasterne i et passende volumen af opløsning A under anvendelse af en Pasteur-pipette eller en cut-off P1000 spids.

2. FACS af Leaf protoplaster

  • Umiddelbart før sortering, resuspendere protoplaster ved hjælp af en (ikke-cut) P1000 tip til at undgå protoplaster sammenklumpning sammen.
  • Overfør protoplaster til et sorterings rør gennem en 50 um filcon filter (BD Biosciences) og fortyndes efter behov for at undgå tilstopning af dysen af ​​cellesorteringsapparat. Protoplasterne sorteres under anvendelse af en 100 um dyse ved et tryk på 20 psi (kappe) og 21-21,5 psi (prøve), en frekvens på 39,2 kHz og en begivenhed på <4000 (disse indstillinger er optimal på en BD Influx cellesorterer (BD Biosciences). Optimering på andre cellesortering maskiner kan have behov for justeringer af disse indstillinger).
  • GFP-positive protoplaster identificeres under anvendelse af en 488 nm argon-laser, og afbilde udgangssignalet fra 580/30 båndpasfilter (orange) vs 530/40 båndpasfilter (grøn). GFP-positive protoplaster vil være i den høje 530/low 580 befolkningen med ikke-GFP protoplaster i den lave 530 / lav 580 befolkning og døde / døende protoplaster og vragdele i det høje 580 befolkning (figur 2).
    1. Ved sortering protoplaster hvorfra RNA vil blive udtrukket, bør protoplaster sorteres direkte i mindst 4 volumener af en lysepuffer indeholdende et reducerende middel (f.eks β-mercaptoethanol). Desuden bør den slags tid af en enkelt prøve begrænses til 20-30 min, og højst 2-3 prøver behandlet på en gang.
    2. Til visualisering af sorteret protoplaster bør protoplasterne sorteres direkte i mindst 8 rumfang af opløsning A, og derefter samles ved centrifugering for at koncentrere protoplasterne.
  • 3. Repræsentative resultater

    Denne protokol beskrives en fremgangsmåde til opnåelse af protoplaster fra Arabidopsis blade, som anvendes til fluorescensaktiveret cellesortering (figur 1). Protoplast generering i nærvær af RNase og transkriptionelle inhibitorer forhindrer cellerne from montering af en transkriptionel respons. Dette har dog den konsekvens, give anledning til mange døde og døende protoplaster, som har en betydelig grad af autofluorescens. Når du sorterer protoplasterne fremstillet med denne metode er det derfor meget almindeligt at se flere forskellige befolkningsgrupper i grafer af de 580 nm vs 530 nm fluorescens anvendes til sortering. Eksempler på dette, sammen med sorteringen porte, der anvendes i denne protokol er vist i figur 3.

    Protoplaster kan sorteres i 8 volumener af opløsning A og opsamles til visualisering at kontrollere berigelse. Figur 2G viser et eksempel på dette ved hjælp af TP382 linie, som udtrykker GFP i beskyttelsesceller.

    Eksempler på udbytter opnået ved denne metode, både før og efter amplifikation, er vist i tabel 1. De opnåede mængder er tilstrækkelige til amplificering ved hjælp af Ovation Pico WTA System (500 pg-50 ng), og derfor erubsequent analyse af enten qPCR (figur 4), næste generation sekventering eller microarray.

    Figur 1
    Figur 1. Samlede arbejdsgang til eksperimentet. 1) Harvest blade af interesse fra et GFP-udtrykkende Arabidopsis linje. 2) Hurtigt skåret i ~ 1 mm brede strimler og straks overføre disse til protoplasting løsning og vakuum infiltrere. 3) Inkuber i 3-4 timer. 4) forsigtigt filtrat protoplast opløsning gennem en 70 um sigte, overførsel til rundbundede rør og pellet protoplaster ved centrifugering. 5) Umiddelbart før sortering, filter Resuspender protoplaster og overførsel til en sortering rør gennem en 50 um. 6) Sorter GFP positive og GFP-negative levedygtige protoplaster. 7) Protoplaster kan nu analyseres enten visuelt eller ved hjælp af teknikker, såsom qPCR, næste generation sekventering eller microarray.


    Figur 2. De KC464, KC274 og TP382 linjer anvendt i denne undersøgelse. A) tværsnit af en KC464 blad viser GFP-ekspression i adaxial epidermis. B) Protoplaster afledt fra KC464 blade. C) tværsnit af en KC274 blad viser GFP-ekspression i karrene. D) Protoplaster afledt af KC274 blade. E) TP382 blad viser GFP-ekspression i guard-celler. F) Protoplaster afledt af TP382 blade. G) Eksempel på berigelse opnået ved FACS af GFP udtrykker beskyttelsesceller i den komplekse baggrund af bladceller, der viser GFP indeholdende protoplaster fra det høje 530/low 580 indbyggere protoplaster afledt af TP382 blade. AF: konfokalt mikroskop billeder; G: Fluorescensmikroskop billede. Scale barer inden billeder er 50 um.

    Figur 3
    Figur 3. Typiske FACS erhvervelse dot plots af udgangssignalet fra 580/30 nm (orange) vs 530/40 nm (grøn) båndpasfiltre (BD Influx cellesorterer). Sorteringsstedet viste porte er dem, der typisk anvendes under sortering. A) Dot plot af Col-4 blad afledte protoplaster, protoplasted i fravær af inhibitorer, der viser en enkelt lav 530/low 580 befolkning. B) Dot plot fra wt Col-4 blad afledte protoplaster, protoplasted i nærvær af inhibitorer, som viser et skift i 580 fluorescens på grund af stress og farvning af inhibitorerne. CE) Dot plots fra blad afledte protoplaster fra de KC74, KC464 og TP382 linjer henholdsvis protoplasted i tilstedeværelse af inhibitorer, der viser GFP indeholdende populationer i den høje 530/low 580 populationer. Procentsatserne af de hændelser i GFP (høj 530/low 580) populationer er givet. Klik her for at se større figur .

    e_content "fo: keep-together.within-page =" altid "> Figur 4
    Figur 4. GFP-ekspression i de repræsentative gated population fraktioner som vist i figur 3. To biologiske replikater blev opnået for hver fraktion type, amplificeret under anvendelse af Ovation Pico WTA System og qPCR hjælp GFP-specifikke primere (Tabel 2) blev derefter udført. Viste værdier er de højeste (rød), laveste (grøn) og gennemsnitlig relative værdier. Den høje 580 populationen var i dette tilfælde todelt, lav 530/low 580 og høj 530/low 580, hvor en enkelt biologisk gentagelse blev brugt så kun er anført én værdi. AKT2 (At3g18780) blev anvendt som en standard for alle prøver. Blad: Hele blade. Unsorted: Ukategoriseret protoplaster. GFP1: høj 530/low 580 og REST1: lav 530/low 580, GFP2: høj 530/high 580 og REST2: lav 530/high 580, som beskrevet i figur 3 og indsatsen. Resultaterne er en verifikation of optiske vurderinger af GFP celleindhold i de sorterede fraktioner (fx Figur 2G). Klik her for at se større figur .

    Prøve Antal blade Antal celler RNA udbytte
    (Ng)
    RNA udbytte
    (Suppleres; ng)
    Hele blade A
    Hele blade B
    1
    1
    -
    -
    8001
    10.525
    4623 ***
    4572 ***
    Usorterede protoplaster A
    Unsorted protoplaster B
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    GFP1 A
    REST1 A
    15 6039 (0,39% *)
    55389 (6.40% *)
    - **
    - **
    861
    489
    GFP1 B
    REST1 B
    15 10.783 (0,63% *)
    57.040 (7,49% *)
    - **
    - **
    537
    420
    GFP2
    REST2
    15 18.337 (1,49% *)
    62.405 (73,49% *)
    - **
    - **
    360
    411

    Tabel 1. Prøver opsamlet under anvendelse af FACS og analyseret med qPCR at afgøre, hvilken fraktion indeholdt levende GFP-udtrykkende protoplaster. Også inkluderet i denne tabel, er den totale RNA udbytte i ng før og efter amplifikation med Ovation Pico WTA System (NuGen). GFP1, GFP2, REST1 og REST2 fraktioner som vist i insertet i figur 4. * Procentdelen af ​​celler af den samlede celle-sortering løb er angivet i parentes ved siden af ​​antallet af celler i fraktionen. Disse procentsatser er ikke korreleret tilhinanden for hver prøve som FACS sortering kører for 'Rest' fraktioner blev stoppet tidligere end for GFP fraktioner på grund af det langt større antal Rest indsamlede celler. ** 50 ng anvendes som input for amplifikationsreaktioner, som pr producentens protokol.

    Primer Sekvens
    mGFP5-ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5-ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    Tabel 2. QPCR primere.

    Discussion

    Vi har beskrevet en fremgangsmåde, der tillader anvendelsen af Arabidopsis planter, der udtrykker GFP i bladene til protoplast generation og efterfølgende cellesortering under anvendelse af FACS. Denne metode giver tilstrækkelige mængder af RNA, der skal anvendes til amplifikation og derfor efterfølgende analyse ved enten qPCR eller microarray. De sorterede fraktioner er højt beriget for GFP-holdige celler som påvist ved qPCR (fig. 2).

    For at opnå høje udbytter af levende protoplaster er det vigtigt at arbejde hurtigt i løbet af de indledende trin i proceduren, indtil bladet strimler har været vakuum infiltreret med inhibitoren-holdige protoplast opløsning. Desuden er det, når der genereres 1 mm blad strimler er meget vigtigt at skære eller klippe bladene frem CHOP eller mos dem, da det fører til overdreven beskadigelse og dermed en lavere protoplast udbytte.

    En kritisk forskel mellem den her beskrevne fremgangsmåde og andre published metoder er anvendelsen af ​​RNase-hæmmere og transkriptionelle inhibitorer. De fleste metoder er udviklet til Arabidopsis rødder, hvorfra protoplaster kan dannes lettere. Men når der arbejdes med blade, med undtagelse mesophyll, er det nødvendigt at forøge protoplast generation tid. Det er derfor vigtigt at inkludere disse inhibitorer til beskyttelse mod ændringer i genekspression som følge af protoplast generation selve behandlingen (data ikke vist). Tilstedeværelsen af ​​inhibitorerne fører til en manglende evne til at montere en transskription respons, enten ved at skifte gener til eller fra, hvilket kan gøre protoplasterne mere sårbare, da dette fører til et tab af plasticitet, hvormed at imødegå de belastninger af protoplasting procedure.

    Vi har anvendt den her beskrevne fremgangsmåde med succes med en række af GFP-udtrykkende Arabidopsis linier. Vigtigere er det, vi har brugt denne metode med GFP linjer udtrykker GFP enten kraftigt ikernen, eller meget svagere i et non-localized/diffuse cytosolisk måde, som det er tilfældet med de KC464 og KC274 linier anvendes her. Begge typer af linjer er kompatible med fremgangsmåden og giver højt beriget fraktioner af GFP-udtrykkende protoplaster (figur 2 og 3). Fremgangsmåden kan let tilpasses andre fluoroforer, selv fluorophoren skal vælges for fluorescens, som er signifikant forskellig fra autofluorescens af døde / døende celler for at bevare evnen til at vælge levende celler.

    Disclosures

    Ingen interessekonflikter erklæret.

    Acknowledgments

    Arbejdet i Buchanan-Wollaston lab på celle-type og udviklingsstadiet specifik profilering understøttes af Agron-omik-projektet (tilskud # LSHG-CT-2006 til 037.704) i 6 rammeprogram for Programme for Europa-Kommissionen. Arbejdet i Gifford lab på celletypespecifik profilering understøttes af en BBSRC New Investigator tilskud (BB/H019502/1).

    De KC274 og KC464 Arabidopsis linjer blev opnået fra AAR Webb (University of Cambridge).

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    Cell specifik analyse af<em&gt; Arabidopsis</em&gt; Blade Med fluorescensaktiveret cellesortering
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter