Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Cella di analisi specifica di doi: 10.3791/4214 Published: October 4, 2012

Summary

Un metodo per produrre

Abstract

Dopo l'inizio del primordio fogliare, accumulo di biomassa è controllata principalmente da proliferazione cellulare ed espansione nelle foglie 1. Tuttavia, la foglia Arabidopsis è un organo complesso costituito da molti tipi cellulari diversi e strutture diverse. Allo stesso tempo, la foglia crescente contiene cellule a diversi stadi di sviluppo, con le cellule più lontane dal picciolo essere il primo a smettere espansione e sottoposti senescenza 1. Cellule diverse all'interno della foglia sono quindi dividendo, allungando o differenziazione, attivo, stressati o morti, e / o rispondere agli stimoli in sotto-insiemi di loro tipo cellulare in qualsiasi momento. Questo rende lo studio genomico della sfida foglia: ad esempio, l'analisi dei dati di espressione di foglie intere, i segnali provenienti dalle reti genetiche che operano in diverse zone di risposta cellulare o tipi cellulari saranno confusi, con un conseguente profilo impreciso viene generato.

Per risolvere questo problema, several metodi sono stati descritti che consentono studi di espressione genica specifica cella. Questi includono la cattura microdissezione laser (LCM) 2 o piante che esprimono GFP utilizzato per la produzione di protoplasti e la successiva selezione di fluorescenza delle cellule attivate (FACS) 3,4, il sistema recentemente descritto intatto per precipitazione nucleare 5 e immunoprecipitazione di polisomi 6.

FACS è stata utilizzata per un certo numero di studi, mostrando inoltre che l'identità della cella e della distanza dalla punta della radice avuto un effetto significativo sui profili di espressione di un grande numero di geni 3,7. FACS di linee GFP sono stati utilizzati anche per dimostrare cellule-specifiche regolazione trascrizionale durante risposte azoto radici e lo sviluppo delle radici laterali 8, 9 sale sollecitazioni distribuzione auxina nella radice 10 e per creare una mappa genica della Arabidopsis meristema apicale 11. SebbeneFACS è stata precedentemente utilizzata per ordinare protoplasti derivati ​​foglia Arabidopsis basato su autofluorescenza 12,13, finora l'uso di FACS su linee di Arabidopsis esprimenti GFP nelle foglie è stato molto limitato 4. Nella seguente protocollo si descrive un metodo per ottenere protoplasti di Arabidopsis foglia che sono compatibili con FACS minimizzando l'impatto del regime generazione protoplasti. Dimostriamo il metodo utilizzando la linea KC464 Arabidopsis che esprimono GFP costrutto legato nell'epidermide adaxial 14, il KC274 linea, che esprimono GFP nel tessuto vascolare 14 e la linea di Arabidopsis TP382, che esprimono un GFP doppia ad un segnale di localizzazione nucleare le cellule di guardia (dati non mostrati; Figura 2). Stiamo attualmente utilizzando questo metodo per studiare sia del tipo cellulare specifica espressione durante lo sviluppo e stress, nonché popolazioni cellulari eterogenee in diverse fasi di senescenza.

Protocol

1. Generazione di protoplasti

  1. Raccolta materiale fogliare e tagliarla a strisce di 1 mm di larghezza (Figura 1), con una lama di rasoio. Per campioni contenenti più di una singola foglia fino a 15 fogli possono essere facilmente impilati prima del taglio.
  2. Trasferire immediatamente strisce foglia in un tondo piatto Petri 9 centimetri contenente 20 ml di soluzione A (400 mM mannitolo, 20 mM MES idrato, 20 mM KCl, 10 mM CaCl 2, 2 mM MgCl2, 0,1% BSA e 2,5 mM β-mercaptoetanolo, pH 5,7) compresi gli enzimi protoplasting (1,2% cellulosa R-10, 0,6% cellulosa RS e 0,4% macerozyme R-10) e RNasi e inibitori trascrizionali (1 × ProtectRNA e 10 ug / ml actinomicina D); separare delicatamente le strisce foglia e vuoto infiltrato per 2 × 5 min.
  3. Luogo Petri su un agitatore orbitale impostato su 90 min a temperatura ambiente e protoplasti per ora 3-4.
    1. Durante l'incubazione le strisce foglia devono essere separate l'una dall'altra, con l'uso di unset di pinzette piatte, ad intervalli di trenta minuti.
  4. Posizionare una cella di filtro 70 micron (Fisher Scientific) in un tubo da 50 ml e delicatamente filtrare la soluzione attraverso protoplasting. Ciò rimuovere le strisce foglia, che saranno trattenuti dal vaglio consentendo i protoplasti di passare attraverso.
  5. Lavare le strisce foglia con 4 ml di soluzione A e delicatamente filtrare attraverso il setaccio stesso.
  6. Trasferire i protoplasti in provette a fondo tondo e centrifugare la soluzione protoplasti a 300 xg per 5 minuti a pellet i protoplasti.
  7. Aspirare delicatamente fuori la maggior quantità di surnatante possibile senza disturbare i protoplasti.
  8. Lavare i protoplasti con 5 ml di soluzione A e centrifugare a 300 xg per 5 min. Rimuovere il surnatante
  9. Risospendere i protoplasti in un volume appropriato di soluzione A, con una pipetta Pasteur o un cut-off punta P1000.

2. FACS di protoplasti Leaf

  • Immediatamente prima cernita, risospendere le protoplasti con un (non-taglio) P1000 punta per evitare protoplasti aggregazione insieme.
  • Trasferire protoplasti di un tubo di smistamento attraverso un micron 50 Filcon filtro (BD Biosciences) e diluite per evitare l'intasamento dell'ugello del cell sorter. I protoplasti vengono ordinati utilizzando un ugello 100 micron ad una pressione di 20 psi (guaina) e 21-21,5 psi (campione), una frequenza di 39,2 kHz e un tasso di evento di <4000 (queste impostazioni sono ottimali su un cell sorter Influx BD (BD Biosciences). Ottimizzazione su altre macchine di smistamento delle cellule potrebbe essere necessario regolare queste impostazioni).
  • Protoplasti GFP positivi sono identificati utilizzando un laser argon 488 nm e riportando l'uscita dal passabanda 580/30 del filtro (arancione) vs il filtro 530/40 passabanda (verde). GFP protoplasti positivi saranno in alta 530/low 580 popolazione, con i non-GFP protoplasti nel basso 530/580 a bassa popolazione e morti / protoplasti muoiono e detriti in alta 580 popolazionemento (Figura 2).
    1. Quando si ordina protoplasti da cui saranno estratti RNA, protoplasti dovrebbero essere ordinati direttamente in almeno 4 volumi di un tampone di lisi contenente un agente riducente (ad esempio β-mercaptoetanolo). Inoltre, il tempo di ordinamento di un singolo campione dovrebbe essere limitato a 20-30 min, e un massimo di 2-3 campioni trattati in qualsiasi momento.
    2. Per la visualizzazione di protoplasti filtrate, i protoplasti dovrebbero essere ordinati direttamente in almeno 8 volumi di soluzione A e successivamente raccolti per centrifugazione a concentrare i protoplasti.
  • 3. Risultati rappresentativi

    Questo protocollo descrive un metodo per ottenere protoplasti da foglie di Arabidopsis, che sono utilizzati per fluorescenza selezione cellulare attivata (Figura 1). Generazione protoplasti in presenza di RNasi e inibitori trascrizionali impedisce f cellulerom montare una risposta trascrizionale. Questo ha la conseguenza di dare luogo a molte protoplasti morti e morenti, che hanno un livello significativo di autofluorescenza. Quando si ordinano i protoplasti preparati con questo metodo è quindi molto comune vedere diverse popolazioni distinte nei grafici dei 580 nm contro 530 nm fluorescenza utilizzati per l'ordinamento. Esempi di questo, insieme con le porte di ordinamento utilizzati in questo protocollo sono mostrati nella Figura 3.

    Protoplasti possono essere ordinati in 8 volumi di soluzione A e raccolti per la visualizzazione per verificare l'arricchimento. Figura 2G mostra un esempio di questo utilizzando la linea TP382, che esprime GFP nelle cellule di guardia.

    Esempi di rese ottenute con questo metodo, prima e dopo l'amplificazione, sono mostrati nella Tabella 1. Gli importi ottenuti sono sufficienti per l'amplificazione con il Ovation Pico WTA di sistema (500 pg-50 ng) e quindi sanalisi ubsequent da una qPCR (Figura 4), ​​sequenziamento di nuova generazione o microarray.

    Figura 1
    Figura 1. Flusso di lavoro generale per l'esperimento. 1) Raccolta foglie di interesse da una linea che esprime GFP Arabidopsis. 2) rapidamente tagliata a strisce ~ 1 mm di larghezza e di trasferire immediatamente questi in soluzione protoplasting e vuoto infiltrato. 3) Incubare per ora 3-4. 4) delicatamente filtrato soluzione protoplasti al setaccio 70 pm, il trasferimento per arrotondare tubi fondo e protoplasti pellet per centrifugazione. 5) Immediatamente prima cernita, protoplasti risospendere e il trasferimento ad un tubo ordinamento attraverso un filtro di 50 micron. 6) In ordine GFP positive e negative GFP protoplasti vitali. 7) I protoplasti possono essere analizzati visivamente oppure utilizzando tecniche come qPCR, sequenziamento di nuova generazione o microarray.


    Figura 2. Le linee KC464, KC274 e TP382 utilizzati in questo studio. A) Sezione trasversale di una foglia KC464 che mostra espressione GFP nell'epidermide adaxial. B) protoplasti derivati ​​da KC464 foglie. C) la sezione trasversale di una foglia KC274 mostrando espressione GFP nel sistema vascolare. D) protoplasti derivati ​​da KC274 foglie. E) foglie TP382 mostrando espressione GFP nelle cellule di guardia. F) protoplasti derivati ​​da TP382 foglie. G) Esempio di arricchimento ottenuto mediante FACS di GFP che esprimono cellule di guardia sullo sfondo complesso di celle foglia, mostrando contenente GFP protoplasti dall'alto 530/low 580 popolazione di protoplasti derivati ​​da TP382 foglie. AF: immagini microscopio confocale; G: immagine al microscopio a fluorescenza. Barre di scala all'interno di immagini di 50 micron.

    Figura 3
    Figura 3. Tipici FACS trame di acquisizione punto dei prodotti ottenuti dai 580/30 nm (arancione) vs 530/40 nm (verde) filtri passa banda (sorter Afflusso BD cellulare). Le porte di ordinamento indicati sono quelli tipicamente utilizzati durante l'ordinamento. A) dot plot di Col-4 foglia protoplasti derivati, protoplasted in assenza di inibitori, che mostrano un basso singolo 530/low 580 popolazione. B) dot plot da Wt protoplasti Col-4 foglie derivate, protoplasted in presenza di inibitori, che mostrano un cambiamento nella fluorescenza 580 a causa di stress e di colorazione dagli inibitori. CE) Dot trame di foglie protoplasti derivati ​​dalle linee KC74, KC464 e TP382, rispettivamente, protoplasted in presenza di inibitori, mostrando anche la GFP contenente popolazioni del 530/low alta 580 popolazioni. Le percentuali degli eventi nelle 530/low (alta 580) popolazioni GFP sono dati. Clicca qui per ingrandire la figura .

    e_content "fo: keep-together.within-page =" always "> Figura 4
    Figura 4. Espressione GFP nelle frazioni rappresentative popolazione gated come mostrato in Figura 3. Due replicati biologici sono stati ottenuti per ciascun tipo di frazione, amplificati utilizzando il sistema Ovation Pico WTA e qPCR GFP usando primer specifici (Tabella 2) è stata poi eseguita. I valori indicati sono i più elevati (rosso), i valori più bassi (verde) e media relativi. L'alta 580 popolazione era in questo caso diviso in due, basso 530/low 580 e alta 530/low 580, per il quale un singolo replicato biologico è stato utilizzato in modo che solo il singolo valore viene visualizzato. ACT2 (At3g18780) è stato utilizzato come standard per tutti i campioni. Foglia: foglia intera. Unsorted: protoplasti Unsorted. GFP1: alta 530/low 580 e Rest1: basso 530/low 580, GFP2: 530/high alta 580 e Rest2: basso 530/high 580, come descritto nella Figura 3 e l'inserto. I risultati sono una verifica of valutazioni ottiche del contenuto della cella GFP nelle frazioni ordinati (ad esempio 2G Figura). Clicca qui per ingrandire la figura .

    Campione Numero di foglie Numero di celle RNA resa
    (Ng)
    RNA resa
    (Amplificato; ng)
    Una foglia intera
    Tutta la foglia B
    1
    1
    -
    -
    8001
    10525
    4623 ***
    4572 ***
    Protoplasti Unsorted A
    Unsorted protoplasti B
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    GFP1 A
    Rest1 A
    15 6039 (0,39% *)
    55389 (6.40% *)
    - **
    - **
    861
    489
    GFP1 B
    Rest1 B
    15 10.783 (0,63% *)
    57.040 (7,49% *)
    - **
    - **
    537
    420
    GFP2
    Rest2
    15 18.337 (1,49% *)
    62.405 (73,49% *)
    - **
    - **
    360
    411

    I campioni Tabella 1. Raccolti con FACS e analizzate qPCR per determinare quale frazione contenuta dal vivo che esprimono GFP-protoplasti. Sono incluse in questa tabella è la resa totale in ng RNA prima e dopo amplificazione con il Pico Ovation WTA System (NuGen). GFP1 frazioni, GFP2, Rest1 e Rest2 sono come mostrato nella inserto in Figura 4. * La percentuale di cellule della corsa totale liste cella è indicato tra parentesi accanto al numero di cellule nella frazione. Queste percentuali non sono correlati adreciprocamente per ogni campione come il tipo FACS corre per frazioni 'Rest' stato interrotto prima di GFP per frazioni a causa del numero molto maggiore di cellule raccolte riposo. ** 50 ng utilizzata come input per reazioni di amplificazione, secondo il protocollo del produttore.

    Primer Sequenza
    mGFP5-ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5-ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    Tabella 2. QPCR primers.

    Discussion

    Abbiamo descritto un metodo che permette l'utilizzo di piante di Arabidopsis esprimenti GFP nelle foglie per la generazione di protoplasti e cell sorting successiva utilizzando FACS. Questo metodo produce una quantità sufficiente di RNA per essere utilizzati per l'amplificazione e l'analisi successiva pertanto sia qPCR o microarray. Le frazioni vengono filtrate altamente arricchito per GFP contenenti cellule, come dimostrato da qPCR (Figura 2).

    Per ottenere rese elevate di protoplasti vivi è fondamentale lavorare rapidamente durante le fasi iniziali della procedura, fino a quando le strisce sono state foglio vuoto infiltrato con l'inibitore soluzione contenente protoplasti. Inoltre, quando si genera uno strisce anta mm è molto importante per affettare o tagliare le foglie anziché 'chop' o schiacciare, in quanto questo porta ad un danno eccessivo e quindi un rendimento inferiore protoplasti.

    Una differenza fondamentale tra il metodo descritto qui e publishe altrimetodi d è l'uso di inibitori di RNasi e inibitori trascrizionali. Molti metodi sono stati sviluppati per radici di Arabidopsis, da cui protoplasti possono essere generate più facilmente. Tuttavia, quando si lavora con foglie, ad eccezione mesofillo, è necessario aumentare il tempo di generazione protoplasti. Pertanto è importante che tali inibitori di protezione contro i cambiamenti nell'espressione genica come risultato del trattamento stesso generazione protoplasti (dati non mostrati). Tuttavia, la presenza degli inibitori porta ad una incapacità di montare una risposta trascrizione, sia attivando geni ON o OFF, che può realizzare i protoplasti più vulnerabili come questo porta ad una perdita di plasticità con cui contrastare le sollecitazioni del protoplasting procedura.

    Abbiamo utilizzato il metodo descritto qui con successo con un numero di linee esprimenti GFP-Arabidopsis. È importante sottolineare che abbiamo usato questo metodo con le linee che esprime GFP GFP sia fortemente inil nucleo, o molto più debolmente in modo non-localized/diffuse citosolico, come è il caso con i KC464 KC274 e linee utilizzate qui. Entrambi i tipi di linee sono compatibili con il metodo e la resa frazioni altamente arricchito di GFP-esprimenti protoplasti (Figura 2 e 3). Il metodo può essere facilmente adattato per altri fluorofori, sebbene il fluoroforo deve essere selezionato per fluorescenza che è significativamente diversa dalla autofluorescenza di cellule morte / morenti per preservare la capacità di selezionare cellule vive.

    Disclosures

    Nessun conflitto di interessi dichiarati.

    Acknowledgments

    Il lavoro in Buchanan-Wollaston laboratorio sul profilo palco tipo cellulare e di sviluppo specifico è supportato dal AGRON-OMICS progetto (concessione # LSHG-CT-2006-037704) nel quadro Progamme 6 ° della Commissione europea. Il lavoro in laboratorio Gifford sul tipo cellulare specifico profilo è supportato da un nuovo BBSRC Investigator Grant (BB/H019502/1).

    Le KC274 KC464 e linee di Arabidopsis sono stati ottenuti da AAR Webb (Università di Cambridge).

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    Cella di analisi specifica di<em&gt; Arabidopsis</em&gt; Foglie usando fluorescenza activated cell sorting
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter