Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Análise de célula específico doi: 10.3791/4214 Published: October 4, 2012

Summary

Um método para produzir

Abstract

Após o início do primórdio foliar, acúmulo de biomassa é controlado principalmente pela proliferação celular e expansão das folhas 1. No entanto, a folha de Arabidopsis é um órgão complexo composto de muitos tipos diferentes de células e estruturas diversas. Ao mesmo tempo, a folha de crescimento contém células em diferentes fases de desenvolvimento, com as células mais afastadas do pecíolo sendo o primeiro a parar de se expandir e passar por um senescência. Células diferentes dentro da folha são, portanto, dividindo, alongando ou diferenciação; ativo, estressado ou morto, e / ou responder a estímulos em sub-conjuntos de seu tipo de celular a qualquer momento. Isso faz estudo genômico da folha desafiador: por exemplo, quando da análise de dados de expressão de folhas inteiras, os sinais de redes genéticas que operam em diferentes zonas de resposta celular ou tipos de células serão confundidos, resultando em um perfil imprecisa sendo gerado.

Para resolver isso, sárias métodos foram descritos, que permitem estudos de expressão de genes específicos de células. Estes incluem a laser de captura de microdissecção (LCM) 2 ou plantas que expressam GFP utilizados para a geração e selecção de protoplasto de células activadas por fluorescência subsequente (FACS) 3,4, o sistema descrito recentemente para a precipitação nuclear INTACT 5 e imunoprecipitação de polissomas 6.

FACS tem sido usado com sucesso para um certo número de estudos, incluindo o que mostra que a identidade da célula e a distância a partir da ponta da raiz teve um efeito significativo sobre os perfis de expressão de um grande número de genes de 3,7. FACS de linhas de GFP também têm sido utilizados para demonstrar a célula-regulação transcricional específica durante as respostas de raiz de azoto e de desenvolvimento de raízes laterais 8, 9 da distribuição de sal estresse auxina na raiz 10 e para criar um mapa de expressão do gene do meristema apical Arabidopsis 11. EmboraFACS tenha sido previamente utilizado para classificar protoplastos de folha de Arabidopsis derivados baseados em autofluorescência 12,13, até agora o uso de FACS das linhas de Arabidopsis expressando GFP nas folhas tem sido muito limitado 4. No protocolo seguinte descreve-se um método para a obtenção de protoplastos de folha de Arabidopsis que são compatíveis com FACS e minimizar o impacto do regime de produção de protoplastos. Demonstramos o método de utilizar a linha de Arabidopsis KC464, que expressam GFP na epiderme adaxial 14, a linha de KC274, que expressam GFP no tecido vascular 14 e a linha de Arabidopsis TP382, que expressam GFP um duplo construto ligado a um sinal de localização nuclear, em as células guarda (dados não mostrados), Figura 2. Estamos actualmente a utilização deste método para estudar tanto a expressão específica do tipo de células durante o desenvolvimento e o stress, bem como as populações de células heterogéneas em várias fases da senescência.

Protocol

1. Geração de protoplastos

  1. Material de colheita e corte de folha em 1 mm de largura (Figura 1) com uma lâmina de barbear. Para amostras que contêm mais do que uma única folha de até 15 folhas podem ser facilmente empilhadas antes de cortar.
  2. Transferir imediatamente tiras de folha em uma placa de Petri 9 centímetros redondo contendo 20 ml de solução A (400 mM de manitol, 20 mM de hidrato de MES, 20 mM de KCl, 10 mM de CaCl2, 2 mM de MgCl2, 0,1% de BSA e 2,5 mM β-mercaptoetanol, pH 5,7) incluindo as enzimas protoplasting (1,2% de celulose de R-10, 0,6% de celulose e 0,4% de RS macerozyme R-10) e RNase e inibidores da transcrição (1 × ProtectRNA e 10 ug / ml de actinomicina D); suavemente separar as tiras de folha e vácuo para se infiltrar 2 × 5 min.
  3. Prato Petri lugar em um agitador orbital ajustado para 90 rpm à temperatura ambiente e de protoplastos por 3-4 horas.
    1. Durante a incubação, as tiras de folhas devem ser separadas umas das outras, através da utilização de umconjunto de pinças planas, em intervalos de meia hora.
  4. Coloque um 70 um coador de células (Fisher Scientific) num tubo de 50 ml e cuidadosamente filtrar a solução através de protoplasting. Isto irá remover as tiras de folha, que serão retidos pelo crivo, permitindo que os protoplastos de passar.
  5. Lave as tiras de folha com 4 ml de solução A e suavemente filtro através do mesmo crivo.
  6. Transfira os protoplastos em tubos de fundo redondo e centrifugar a solução de protoplastos a 300 xg durante 5 min para sedimentar os protoplastos.
  7. Aspirar cuidadosamente fora tanto do sobrenadante quanto possível, sem perturbar os protoplastos.
  8. Lave os protoplastos com 5 ml de solução A e centrifugar a 300 xg durante 5 min. Remover o sobrenadante
  9. Ressuspender os protoplastos em um volume apropriado de solução A, usando uma pipeta de Pasteur ou um P1000 ponta de corte.

2. FACS de protoplastos de folha

  • Imediatamente antes da classificação, ressuspender os protoplastos usando uma (não corte) P1000 dica para evitar aglomeração protoplastos juntos.
  • Transferir para um tubo de protoplastos de triagem por meio de um filtro de 50 um filcon (BD Biosciences) e dilui-se, conforme adequado, para evitar o entupimento do bocal do classificador de células. Os protoplastos são classificados usando um bico de 100 ^ M a uma pressão de 20 psi (invólucro) e 21-21,5 psi (amostra), de uma frequência de 39,2 kHz e uma taxa de eventos de <4000 (essas configurações são óptimas em um separador de células Influx BD (BD Biosciences) Otimização. nas máquinas de triagem outros celulares podem precisar de ajustes para essas configurações).
  • Protoplastos GFP positivas são identificadas usando um laser de árgon de 488 nm e traçando a saída do 580/30 passa-banda do filtro (cor de laranja) em relação ao filtro 530/40 passa-banda (verde). Protoplastos GFP positivas estará no alto 530/low 580 população, com GFP não-protoplastos em baixo 530 / baixo 580 mortos / população e protoplastos morrendo e detritos no alto 580 popumento (Figura 2).
    1. Ao classificar os protoplastos a partir de RNA que serão extraídos, protoplastos devem ser separados directamente para pelo menos 4 volumes de um tampão de lise contendo um agente redutor (por exemplo, β-mercaptoetanol). Além disso, o tempo de classificação de uma única amostra deve ser limitado a 20-30 min, e um máximo de duas a três amostras processadas ao mesmo tempo.
    2. Para visualização dos protoplastos classificados, os protoplastos devem ser separados directamente para, pelo menos, oito volumes da solução A e, subsequentemente, recolhidos por centrifugação a concentrar os protoplastos.
  • 3. Resultados representativos

    Este protocolo descreve um método para a obtenção de protoplastos a partir de folhas de Arabidopsis, que são utilizados para a selecção de células activadas por fluorescência (Figura 1). Geração de protoplastos na presença de RNase e inibidores da transcrição impede o f célulasrom a montagem de uma resposta transcripcional. Isso não tem a conseqüência de dar origem a muitas protoplastos mortos e moribundos, que têm um nível significativo de autofluorescência. Ao classificar os protoplastos preparados com este método, portanto, é muito comum ver várias populações distintas em gráficos dos 580 nm vs 530 nm de fluorescência utilizado para a triagem. Exemplos deste, em conjunto com as portas de triagem utilizadas neste protocolo são mostrados na Figura 3.

    Protoplastos podem ser classificados em 8 volumes da solução A e recolhido para visualização para verificar o enriquecimento. Figura 2G mostra um exemplo deste utilizando a linha de TP382, que expressa GFP nas células guarda.

    Exemplos de rendimentos obtidos com este método, antes e depois de amplificação, são mostrados na Tabela 1. Os valores obtidos são suficientes para a amplificação, utilizando o Sistema Ovation Pico WTA (500 pg-50 ng) e, portanto, sanálise ubsequent por qualquer qPCR (figura 4), ​​a sequenciação geração seguinte ou microarray.

    Figura 1
    Figura 1. Fluxo geral para o experimento. 1) Colheita deixa de interesse a partir de uma linha de Arabidopsis expressando GFP. 2) rapidamente cortado em ~ 1 mm de largura e imediatamente transferi-los para a solução protoplasting e vácuo infiltrar. 3) Incubar por 3-4 horas. 4) cuidadosamente filtrado solução protoplastos através de um peneiro de 70, a transferência para tubos de fundo redondo e protoplastos de pelotas por centrifugação. 5) Imediatamente antes da classificação, protoplastos Ressuspenda e transferir para um tubo de triagem por meio de um filtro de 50 | iM. 6) Classificar GFP positivos e negativos GFP protoplastos viáveis. 7) Os protoplastos podem agora ser analisadas visualmente ou através de técnicas tais como qPCR, sequenciação geração seguinte ou microarray.


    Figura 2. As linhas KC464, KC274 e TP382 utilizados neste estudo. A) seção transversal de uma folha mostrando KC464 expressão GFP na epiderme adaxial. B) derivado de protoplastos KC464 folhas. C) a secção transversal de uma folha de KC274 mostrando a expressão da GFP na vasculatura. D) Os protoplastos derivados de KC274 folhas. E) TP382 folha que mostra a expressão da GFP em células guarda. F) derivado de protoplastos TP382 folhas. G) Exemplo do enriquecimento obtido por FACS de células que expressam GFP de guarda no fundo complexo de células da folha, mostrando GFP contendo protoplastos a partir da elevada população 530/low 580 de protoplastos derivados de TP382 folhas. AF: imagens de microscópio confocal; G: imagem do microscópio de fluorescência. Barras de escala dentro das imagens são de 50 m.

    Figura 3
    Figura 3. Típicos FACS parcelas de aquisição de pontos de saída dos 580/30 nm (laranja) vs 530/40 nm (verde) filtros de banda (BD Influx seleccionador de células). Os portões de classificação apresentados são os normalmente usados ​​durante a classificação. A) Ponto de trama Col-4 protoplastos derivados de folhas, protoplasted na ausência de inibidores, que mostram uma única população baixa 530/low 580. B) a partir de wt trama Dot Cl-4 protoplastos derivados de folhas, protoplasted na presença de inibidores, indicando uma mudança na fluorescência 580 devido ao stress e coloração pelos inibidores. CE) Dot parcelas de folha protoplastos derivados a partir das linhas KC74, KC464 e TP382, respectivamente, protoplasted na presença de inibidores, mostrando a GFP contendo populações no alto 530/low 580 populações. As porcentagens dos eventos nos (alta 530/low 580) GFP populações são dadas. Clique aqui para ver maior figura .

    "fo: manter-together.within-page =" e_content sempre "> Figura 4
    Figura 4. Expressão da GFP nas fracções representativas de populações fechadas, como mostrado na Figura 3. Duas réplicas biológicas foram obtidos para cada tipo de fracção, amplificado utilizando o Sistema Ovation Pico WTA e qPCR GFP utilizando-se os iniciadores específicos (Tabela 2) foi então realizada. Os valores apresentados são os mais elevados (vermelho), o mais baixo (verde) e média de valores relativos. A população foi elevada 580, neste caso, dividido em dois, baixo 530/low 580 e 530/low alto 580, para o qual apenas uma repetição, biológica foi utilizada para que apenas o valor único é apresentado. ACT2 (At3g18780) foi utilizado como um padrão para todas as amostras. Folha: folha inteira. Unsorted: protoplastos não separados. GFP1: 530/low alto 580 e Rest1: 530/low baixo 580, GFP2: 530/high alto 580 e repouso2: 530/high baixo 580, tal como descrito na Figura 3 e da inserção. Os resultados são a verificação of avaliações ópticas da GFP conteúdo celular nas frações classificadas (2G por exemplo, a figura). Clique aqui para ver maior figura .

    Amostra No. de folhas No. de células RNA rendimento
    (Ng)
    RNA rendimento
    (Amplificado; ng)
    A folha inteira
    B folha inteira
    1
    1
    -
    -
    8001
    10525
    4623 ***
    4572 ***
    Protoplastos Unsorted A
    B protoplastos Unsorted
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    A GFP1
    A Rest1
    15 6039 (0,39% *)
    55389 (6.40% *)
    - **
    - **
    861
    489
    GFP1 B
    Rest1 B
    15 10.783 (0,63% *)
    57040 (7,49% *)
    - **
    - **
    537
    420
    GFP2
    Repouso2
    15 18.337 (1,49% *)
    62.405 (73,49% *)
    - **
    - **
    360
    411

    Exemplos Tabela 1. Obtidos utilizando FACS e analisadas com qPCR para determinar que fracção continha vivas que expressam GFP-protoplastos. Também estão incluídos nesta tabela é o rendimento em ng de RNA total, antes e depois de amplificação com o Ovation Pico WTA System (NuGen). GFP1 fracções, GFP2, Rest1 e repouso2 são como mostrado na inserção da Figura 4. * A percentagem de células do tipo de célula total de funcionamento é dado entre parêntesis ao lado do número de células na fracção. Esses percentuais não são correlacionadosoutro para cada amostra como o tipo FACS corre para frações "descanso" foram interrompidos mais cedo do que para frações GFP devido ao número muito maior de células de descanso coletados. ** 50 ng usado como entrada para as reacções de amplificação, como por protocolo do fabricante.

    Cartilha Seqüência
    mGFP5-ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5-ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    Primers Tabela 2. QPCR.

    Discussion

    Nós descrevemos um método que permite o uso de plantas de Arabidopsis expressando GFP nas folhas para a produção de protoplastos e subsequente separação de células utilizando FACS. Este método produz uma quantidade suficiente de RNA a serem utilizados para a amplificação e subsequente análise, portanto, por um ou outro ou qPCR microarray. As fracções são classificados altamente enriquecido para GFP contendo células, como demonstrado por qPCR (figura 2).

    Para obter altos rendimentos de protoplastos vivos é crítico para trabalhar rapidamente durante os passos iniciais do processo, até que as tiras de folha ter sido vácuo infiltrada com a solução de protoplastos contendo inibidor. Em adição, ao gerar um tiras de folha milímetros, é muito importante para cortar ou cortar as folhas em vez de "talhar" ou triture-los, como isso leva a danos excessivos e, assim, um menor rendimento de protoplastos.

    A diferença fundamental entre o método descrito aqui e outro publisheMétodos d é a utilização de inibidores de RNase e inibidores da transcrição. A maioria dos métodos são desenvolvidos em raízes de Arabidopsis, a partir de protoplastos que podem ser gerados com mais facilidade. No entanto, quando se trabalha com folhas, com excepção mesófilo, é necessário aumentar o tempo de geração de protoplastos. Por isso, é importante incluir estes inibidores para proteger contra as alterações na expressão de genes, como resultado do tratamento de protoplastos geração própria (dados não mostrados). No entanto, a presença de agentes inibidores leva a uma incapacidade para montar uma resposta de transcrição, quer por comutação de genes ligado ou desligado, o que é susceptível de fazer os protoplastos mais vulnerável, pois isso leva a uma perda de plasticidade com que para contrariar as tensões do protoplasting procedimento.

    Usámos o método aqui descrito com sucesso com um certo número de linhas que expressam GFP-Arabidopsis. Importante, nós têm utilizado este método com linhas GFP expressando GFP ou fortemente emdo núcleo, ou muito mais fraca de uma maneira non-localized/diffuse citosólica, como é o caso com os KC464 KC274 e linhas utilizadas aqui. Ambos os tipos de linhas são compatíveis com o método de produzir e as fracções altamente enriquecidas de GFP-expressando protoplastos (Figura 2 e 3). O método pode ser facilmente adaptado a outras fluoróforos, embora o fluoróforo deve ser seleccionada para a fluorescência, que é significativamente diferente da autofluorescência das células mortas / a morrer, a fim de preservar a capacidade para seleccionar células vivas.

    Disclosures

    Não há conflitos de interesse declarados.

    Acknowledgments

    Trabalhar no laboratório Buchanan-Wollaston sobre o perfil do estágio de célula-tipo e de desenvolvimento específico é suportado pelo projeto AGRON-Omics (Grant # LSHG-CT-2006-037704) no-Programa-Quadro 6 º da Comissão Europeia. O trabalho no laboratório de Gifford no tipo de células perfil específico é suportado por um novo BBSRC Investigador de subvenção (BB/H019502/1).

    Os KC274 KC464 e linhas de Arabidopsis foram obtidos a partir de AAR Webb (Universidade de Cambridge).

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    Análise de célula específico<em&gt; Arabidopsis</em&gt; Folhas utilizando ordenação células activadas por fluorescência
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter