Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Cell särskild analys av doi: 10.3791/4214 Published: October 4, 2012

Summary

En metod för framställning av

Abstract

Efter initiering av blad primordium är biomassa ackumulering styrs främst av celltillväxt och expansion i bladen 1. Emellertid är Arabidopsis löv ett komplext organ som består av många olika celltyper och flera strukturer. Samtidigt innehåller den växande löv celler i olika stadier av utveckling, med cellerna längst bort från bladskaft är den första att sluta expandera och genomgår åldrande 1. Olika celler i bladet därför dela, förlängning eller differentiering, aktiv, stressad eller döda, och / eller reagera på stimuli i sub-uppsättningar av deras cellulära typ åt gången. Detta gör genomiska studie av blad utmanande: exempelvis vid analys expression data från hela blad, signaler från genetiska nätverk inom distinkta cellulära respons zoner eller celltyper kommer förväxlas, vilket resulterar i en felaktig profil genereras.

För att lösa detta, several metoder har beskrivits, vilka möjliggör studier av cell-specifik genexpression. Dessa inkluderar laser-capture mikrodissektion (LCM) 2 eller GFP uttryckande växter som används för generering protoplastfusion och efterföljande fluorescensaktiverad cellsortering (FACS) 3,4, den nyligen beskrivna INTAKT system för kärn utfällning 5 och immunoutfällning av polysomer 6.

FACS har framgångsrikt använts för ett antal studier, bland annat visar att cellidentiteten och avståndet från roten spetsen hade en betydande effekt på uttryck profiler av ett stort antal gener 3,7. FACS av GFP linjer har också använts för att demonstrera cellspecifik transkriptionsreglering under svaren rot kväve och laterala rotutveckling 8, salt stressen 9 auxin distribution i roten 10 och att skapa en karta genuttryck av Arabidopsis skjuta apikala meristem 11. ÄvenFACS tidigare har använts för att sortera Arabidopsis leaf härledda protoplaster baserade på autofluorescens 12,13, har hittills användningen av FACS på Arabidopsis som uttrycker GFP i bladen varit mycket begränsad 4. I följande protokoll beskriver vi en metod för att erhålla Arabidopsis blad protoplaster som är kompatibla med FACS och samtidigt minimera effekterna av protoplast generationen regimen. Vi visar metoden med KC464 Arabidopsis linjen, som uttrycker GFP i adaxial epidermis 14, KC274 linjen, som uttrycker GFP i den vaskulära vävnaden 14 och den TP382 Arabidopsis linjen, som uttrycker en dubbel GFP konstrukt kopplad till en nukleär lokaliseringssignal i vakten celler (data ej visade, figur 2). Vi håller för närvarande med denna metod för att studera både celltyp uttryck under utveckling och stress, samt heterogena cellpopulationer i olika stadier av åldrande.

Protocol

1. Protoplast Generation

  1. Skörd bladmaterial och skär i 1 mm breda remsor (figur 1) med ett rakblad. För prover som innehåller mer än en enda blad upp till 15 blad kan enkelt staplas före kapning.
  2. Överför omedelbart blad remsorna i en 9 cm runt petriskål innehållande 20 ml av lösning A (400 mM mannitol, 20 mM MES hydrat, 20 mM KCl, 10 mM CaClz 2, 2 mM MgCl2, 0,1% BSA och 2,5 mM β-merkaptoetanol, pH 5,7) innefattande protoplasting enzymer (1,2% cellulosa R-10, 0,6% cellulosa RS och 0,4% Macerozyme R-10) och RNas och transkriptionella hämmare (1 x ProtectRNA och 10 pg / ml aktinomycin D), separera försiktigt bladens remsorna och vakuum infiltrera för 2 × 5 min.
  3. Placera petriskål på en orbital skakanordning inställd på 90 varv per minut vid rumstemperatur och protoplast under 3-4 timmar.
    1. Under inkubationen bladens remsorna bör separeras från varandra, genom användning av enuppsättning platta pincett vid halv timmes mellanrum.
  4. Placera en 70 sil xm cell (Fisher Scientific) i ett 50 ml rör och försiktigt filtrera protoplasting lösningen genom. Detta kommer att ta bort blad band, som kommer att kvarhålls av sikten samtidigt som de protoplasterna att gå igenom.
  5. Tvätta blad remsorna med 4 ml av lösning A och försiktigt filtrera genom samma sikt.
  6. Överför protoplasterna i rundbottnade rör och centrifugera protoplast lösningen vid 300 xg under 5 minuter för att pelletera protoplasterna.
  7. Försiktigt Aspirera bort så mycket av supernatanten som möjligt utan att störa protoplasterna.
  8. Tvätta protoplasterna med 5 ml av lösning A och centrifugera vid 300 xg under 5 minuter. Avlägsna supernatanten
  9. Återsuspendera protoplasterna i en lämplig volym av lösning A, med användning av en Pasteur-pipett eller en cut-off P1000 spets.

2. FACS Leaf Protoplaster

  • Omedelbart före sortering, resuspendera protoplasterna med en (icke-cut) P1000 tips för att undvika protoplaster klumpar ihop.
  • Överför protoplaster till en sortering röret genom en 50 | im-filter filcon (BD Biosciences) och späd som lämpliga för att undvika igensättning av munstycke cellsorterare. Protoplasterna sorteras med användning av en 100 | im munstycke vid ett tryck av 20 psi (mantel) och 21-21,5 psi (prov), en frekvens av 39,2 kHz och en händelse andelen <4000 (dessa inställningar är optimala på en BD Influx cellsorterare (BD Biosciences). Optimering på andra maskiner cellsortering kan behöva justera de här inställningarna).
  • GFP-positiva protoplaster identifieras med användning av en 488 nm argonlaser och plottning utsignalen från 580/30 bandpassfilter (orange) vs 530/40 bandpassfilter (grön). GFP-positiva protoplaster kommer att vara i hög 530/low 580 invånare, med icke-GFP-protoplaster i låg 530 / låg 580 invånare och döda / döende protoplaster och skräp i hög 580 befolkning (Figur 2).
    1. När sortering protoplaster från vilket RNA skall extraheras, bör protoplaster sorteras direkt i åtminstone 4 volymer av en lysbuffert innehållande ett reduktionsmedel (t.ex. β-merkaptoetanol). Dessutom, bör den typ tiden för ett enstaka prov begränsas till 20-30 min, och högst 2:58 prover bearbetas vid ett och samma tillfälle.
    2. För visualisering av sorterade protoplaster, bör protoplasterna sorteras direkt i åtminstone 8 volymer lösning A och därefter uppsamlades genom centrifugering för att koncentrera protoplasterna.
  • 3. Representativa resultat

    Detta protokoll beskriver en metod för att erhålla protoplaster från Arabidopsis blad, som används för fluorescensaktiverad cellsortering (figur 1). Protoplast generationen i närvaro av RNas och transkriptionella hämmare hindrar cellerna from montering av en transkriptionell svar. Detta behöver följd av att ge upphov till många döda och döende protoplaster, som har en betydande grad av autofluorescens. När sortera protoplasterna framställda med denna metod är det därför mycket vanligt att se flera olika populationer i grafer av de 580 nm vs 530 nm fluorescens används för sortering. Exempel på detta tillsammans med sortering grindar används i detta protokoll visas i figur 3.

    Protoplaster kan sorteras i 8 volymer av lösning A och uppsamlas för visualisering för att verifiera anrikning. Figur 2G visar ett exempel på detta använder TP382 linjen, som uttrycker GFP i vaktceller.

    Exempel på utbyten som erhålls med denna metod, både före och efter amplifiering, visas i tabell 1. De erhållna beloppen är tillräckliga för amplifiering med Ovation Pico WTA-systemet (500 pg-50 ng) och därför ärubsequent analys antingen qPCR (Figur 4), nästa generations sekvensering eller microarray.

    Figur 1
    Figur 1. Totalt arbetsflöde för experimentet. 1) Harvest lämnar av intresse från en GFP-uttryckande Arabidopsis linje. 2) Snabbt skuren i ~ 1 mm breda remsor och omedelbart överföra dessa till protoplasting lösning och vakuum infiltrera. 3) Inkubera under 3-4 timmar. 4) försiktigt filtrat protoplast lösningen genom ett 70 nm sikt, överlåtelse rund botten rör och pellets protoplaster genom centrifugering. 5) Omedelbart före sortering, återsuspendera protoplaster och överföring till en sortering rör genom ett 50 nm-filter. 6) Sortera GFP positiva och GFP negativa livskraftiga protoplaster. 7) Protoplaster kan nu analyseras antingen visuellt eller med hjälp av tekniker såsom qPCR, nästa generations sekvensering eller microarray.


    Figur 2. De KC464, KC274 och TP382 linjer som används i denna studie. A) tvärsnitt av en KC464 blad som visar GFP-uttryck i adaxial epidermis. B) Protoplaster härledda från KC464 blad. C) tvärsnitt av en KC274 blad som visar GFP-uttryck i vaskulaturen. D) Protoplaster härledda från KC274 blad. E) TP382 blad visar GFP uttryck i vakten cellerna. F) Protoplaster härledda från TP382 blad. G) Exempel på anrikning som erhållits genom FACS av GFP uttryckande vakt celler i komplexa bakgrunden av löv celler, som visar GFP innehåller protoplaster från den höga 530/low 580 invånare protoplaster härledda från TP382 blad. AF: konfokalmikroskop bilder, G: fluorescensmikroskop bild. Skala barer inom bilder är 50 um.

    Figur 3
    Figur 3. Typiska FACS förvärv punktdiagram av utsignalen från 580/30 nm (orange) vs 530/40 nm (grön) bandpassfilter (BD Influx cellsorterare). Sorteringen visas grindarna är de vanligtvis används vid sortering. A) plot av Col-4 härledda blad protoplaster, protoplasted i frånvaro av inhibitorer, visar en låg 530/low 580 invånare. B) punktdiagram från wt härrörande Col-4 blad protoplaster, protoplasted i närvaro av inhibitorer, som visar en förändring i fluorescens 580 på grund av stress och färgning av hämmarna. CE) Dot tomter från blad härledda protoplaster från KC74, KC464 och TP382 linjer resp protoplasted i närvaro av inhibitorer, visar GFP innehåller populationer i hög 530/low 580 populationer. De procentsatser för händelserna i GFP (högt 530/low 580) populationer ges. Klicka här för att se större bild .

    e_content "fo: keep-together.within-page =" alltid "> Figur 4
    Figur 4. GFP-uttryck i de representativa gated population fraktioner såsom visas i figur 3. Två biologiska replikat erhölls för varje fraktion typ, amplifieras med användning av Pico Ovation WTA System och qPCR med GFP-specifika primrar (Tabell 2) utfördes därefter. Visade värdena är de högsta (röd), lägsta (grön) och den genomsnittliga relativa värden. Den höga 580 invånare var i detta fall delas i två, låg 530/low 580 och hög 530/low 580, där en enda biologisk replikera användes så att endast den enda värde anges. ÄRV2 (At3g18780) användes som en standard för samtliga prover. Blad: Hela blad. Osorterade: Osorterade protoplaster. GFP1: hög 530/low 580 och REST1: låg 530/low 580, GFP2: hög 530/high 580 och REST2: låg 530/high 580, såsom beskrivs i figur 3 och insatsen. Resultaten är en kontroll of optiska bedömningar av GFP cellinnehåll i den sorterade fraktioner (t ex Figur 2G). Klicka här för att se större bild .

    Prov Antal blad Antal celler RNA avkastning
    (Ng)
    RNA avkastning
    (Förstärkt; ng)
    Hela blad A
    Hela blad B
    1
    1
    -
    -
    8001
    10.525
    4623 ***
    4572 ***
    Osorterade protoplaster En
    Osorterat protoplaster B
    5
    5
    -
    -
    2433
    2625
    1152 ***
    3321 ***
    GFP1 En
    REST1 En
    15 6039 (0,39% *)
    55389 (6.40% *)
    - **
    - **
    861
    489
    GFP1 B
    REST1 B
    15 10.783 (0,63% *)
    57.040 (7,49% *)
    - **
    - **
    537
    420
    GFP2
    REST2
    15 18.337 (1,49% *)
    62.405 (73,49% *)
    - **
    - **
    360
    411

    Tabell 1. Prover samlas in med hjälp FACS och analyseras med qPCR att bestämma vilken fraktion innehöll levande GFP-uttryckande protoplaster. Dessutom ingår i denna tabell är den totala RNA-utbytet i ng före och efter förstärkning med Ovation Pico WTA System (NuGen). GFP1, GFP2, REST1 och REST2 fraktionerna som visas i insatsen i figur 4. * Andelen av celler av totala cell sort körning ges i parentes bredvid antalet celler i fraktionen. Dessa procentsatser är inte korrelerad tillvarandra för varje prov som FACS Sortera löper "vila" fraktioner stoppades tidigare än för GFP fraktioner grund av det mycket större antal Rest insamlade celler. ** 50 ng används som underlag för amplifieringsreaktioner, enligt tillverkarens protokoll.

    Primer Sekvens
    mGFP5-ER.fw GCCTGAGGGATACGTGCAGGAGA
    mGFP5-ER.rv TGGCGGGTCTTGAAGTTGGCT
    ACT2.fw GCCATCCAAGCTGTTCTCTC
    ACT2.rv GCCATCCAAGCTGTTCTCTC

    Tabell 2. QPCR primers.

    Discussion

    Vi har beskrivit en metod som medger användning av Arabidopsis växter som uttrycker GFP i bladen för protoplaster generering och efterföljande cellsortering med användning av FACS. Denna metod ger tillräckliga mängder av RNA som skall användas för förstärkning och därför efterföljande analys av antingen qPCR eller microarray. De sorterade fraktionerna höganrikat för GFP-innehållande celler, vilket framgår av qPCR (figur 2).

    För att uppnå höga utbyten av levande protoplaster är det viktigt att arbeta snabbt under de inledande stegen i förfarandet, tills blad remsorna har vakuum infiltrerat med hämmare innehållande protoplast lösning. Dessutom, när du skapar ett band mm blad är det mycket viktigt att skiva eller skära bladen i stället "chop" eller mosa dem, eftersom detta leder till svåra skador och därmed lägre protoplast avkastning.

    En kritisk skillnad mellan den här beskrivna metoden och andra published metoder är användningen av RNas-hämmare och transkriptionella inhibitorer. De flesta metoder är utvecklade för Arabidopsis rötter, från vilka protoplaster kan genereras lättare. Men när man arbetar med löv, förutom mesophyll, är det nödvändigt att öka tiden protoplast generationen. Därför är det viktigt att inkludera dessa inhibitorer att skydda mot förändringar i genuttryck som resultat av protoplast generationens behandling själv (data visas ej). Leder dock förekomsten av inhibitorer till en oförmåga att montera en transkription svar, antingen genom att byta gener på eller av, vilket sannolikt kommer att göra protoplasterna mer sårbara eftersom detta leder till en förlust av plasticitet som att motverka stressen i protoplasting förfarande.

    Vi har använt den metod som beskrivs här framgångsrikt med ett antal GFP-uttryckande Arabidopsis linjer. Det är viktigt att vi har använt denna metod med GFP som uttrycker GFP antingen starktkärnan, eller mycket svagare i ett cytosoliskt non-localized/diffuse sätt, såsom är fallet med de KC464 och KC274 linjer som används här. Båda typer av linjer är kompatibla med metoden och ger höggradigt anrikade fraktioner av GFP-uttryckande protoplaster (figur 2 och 3). Metoden kan lätt anpassas till andra fluoroforer, fastän fluoroforen måste väljas för fluorescens som är signifikant skild från autofluorescens av döda / döende celler för att bevara förmågan att välja levande celler.

    Disclosures

    Inga intressekonflikter deklareras.

    Acknowledgments

    Arbetet i Buchanan-Wollaston labb på cell-typ och utvecklingsstadium specifik profilering stöds av Agron-genomik projekt (bidrag # LSHG-CT-2006 till 037.704) i 6: e ramprogram stadsdelsförnyelse av Europeiska kommissionen. Arbetet i Gifford labbet på celltypspecifik profilering stöds av en BBSRC New Investigator Grant (BB/H019502/1).

    De KC274 och KC464 Arabidopsis erhölls från AAR Webb (University of Cambridge).

    Materials

    Name Company Catalog Number Comments
    Cellulase R-10 Melford C8001
    Cellulase RS Melford C8003
    Macerozyme R-10 Melford M8002
    BSA Sigma-Aldrich A3912
    ProtectRNA Sigma-Aldrich R7397
    Actinomycin D Sigma-Aldrich A1410
    70 μm cell strainer Fisher FB35181
    50 μm filcon cup-type filters BD Biosciences 340630

    DOWNLOAD MATERIALS LIST

    References

    1. Efroni, I., Eshed, Y., Lifschitz, E. Morphogenesis of Simple and Compound Leaves: A Critical Review. Plant Cell. 22, 1019-1032 (2010).
    2. Kleber, R., Kehr, J. Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection. Methods Mol. Biol. 323, 367-377 (2006).
    3. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. A Gene Expression Map of the Arabidopsis root. Science. 302, 1956-1960 (2003).
    4. Warnasooriya, S. N., Montgomery, B. L. Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana. J. Vis. Exp. (39), e1925 (2010).
    5. Beal, R. B., Henikoff, S. A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue. Dev. Cell. 18, 1030-1040 (2010).
    6. Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. PNAS. 106, 18843-18848 (2009).
    7. Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map. Science. 318, 801-806 (2007).
    8. Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. Cell-specific nitrogen responses mediate developmental plasticity. PNAS. 105, 803-808 (2008).
    9. Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science. 320, 942-945 (2008).
    10. Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis. Plant Cell. 21, 1659-1668 (2009).
    11. Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. PNAS. 106, 4941-4946 (2009).
    12. Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts. PNAS. 87, 816-820 (1990).
    13. Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool. Plant Methods. 4, 6 (2008).
    14. Gardner, M. J., Baker, A. J., Assie, J. -M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression. J. Exp. Bot. 60, 213-226 (2009).
    Cell särskild analys av<em&gt; Arabidopsis</em&gt; Blad Använda fluorescensaktiverad cellsortering
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).More

    Grønlund, J. T., Eyres, A., Kumar, S., Buchanan-Wollaston, V., Gifford, M. L. Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting. J. Vis. Exp. (68), e4214, doi:10.3791/4214 (2012).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter