Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

تحديد doi: 10.3791/50156 Published: February 1, 2013

Summary

ووصف طريقة التعرف السائقين غير معروف من التسرطن باستخدام نهج غير متحيز. أسلوب يستخدم

Abstract

الجينومية وتحليل البروتين، transcriptomic، وepigenomic الأورام الإنسان تشير إلى أن هناك الآلاف من الحالات الشاذة في كل جينوم السرطان مقارنة مطابقة الأنسجة الطبيعية. بناء على هذه التحليلات من الواضح أن هناك العديد من السائقين الجينية غير مكتشفة من السرطان 1. للأسف مخفية ضمن برامج التشغيل هذه عدد أكبر بكثير من الحالات الشاذة الركاب في الخريطة الوراثية البشرية التي لا تساهم مباشرة في تشكيل الورم. وثمة جانب آخر للجينوم السرطان أن هناك عدم تجانس كبير الوراثية ضمن أنواع الأورام مماثلة. يمكن لكل ورم تؤوي الطفرات المختلفة التي توفر ميزة انتقائية لتكوين ورم 2. أداء غير منحازة شاشة الوراثية إلى الأمام في الفئران يوفر الأدوات اللازمة لتوليد أورام وتحليل تركيبتها الجينية، مع الحد من خلفية الطفرات الركاب. ونظام النوم الجمال ينقول (SB) هو أسلوب واحد من هذا القبيل 3. النظام يستخدم المحمول SB الخامسectors (ترانسبوزونات) التي يمكن إدراجها في جميع أنحاء الجينوم من قبل انزيم transposase. وتقتصر الطفرات إلى نوع خلية معينة من خلال استخدام أليل transposase الشرطي الذي يتم تفعيلها من خلال لجنة المساواة العرقية Recombinase. خطوط الماوس وجود العديد من لجنة المساواة العرقية التي Recombinase صريحة في أنسجة معينة. عن طريق عبور واحدة من هذه الخطوط إلى أليل transposase المشروطة (مثل السلمون المدخن للتوقف وكس-SB11)، يتم تنشيط نظام SB فقط في الخلايا التي تعبر عن لجنة المساواة العرقية Recombinase. ستقوم لجنة المساواة العرقية Recombinase المكوس شريط التوقف الذي يمنع التعبير عن أليل transposase، وبالتالي تفعيل الطفرات ينقول في نوع من الخلايا المعينة. يبدأ على شاشة SB عن طريق تربية ثلاث سلالات من الفئران المعدلة وراثيا بحيث تحمل الفئران التجريبية أليل transposase المشروط، وهو concatamer من ترانسبوزونات، وRecombinase لجنة المساواة العرقية أليل الأنسجة محددة. ويسمح لهذه الفئران في العمر حتى شكل أورام وتصبح المحتضرة. الفئران هي ثميتم عزل الحمض النووي الجيني وnecropsied من الأورام. المقبل، وتعرض الحمض النووي الجيني لPCR-رابط بوساطة (LM-PCR) التي تؤدي إلى التضخيم من مواضع الجينومية التي تحتوي على ينقول SB. LM-PCR يقوم على وجود ورم واحد سيؤدي إلى مئات amplicons متميزة تمثل مئات مواضع الجينومية التي تحتوي على الإدراج في 4 ينقول ورم واحد. يتم تحليل الإدراج ينقول في جميع الأورام وتحديد المواقع الإدراج المشترك (كيبك) باستخدام الأساليب الإحصائية المناسبة 5. الجينات داخل رابطة الدول المستقلة من المرجح للغاية أن تكون الجينات المسرطنة أو الجينات الكابتة للورم، وتعتبر جينات السرطان مرشح. مزايا استخدام نظام لتحديد الجينات SB سرطان المرشحة هي: 1) يمكن بسهولة أن يكون موجودا ينقول في الجينوم لأنه من المعروف تسلسل لها، 2) تبديل يمكن أن يوجه إلى نوع تقريبا أي خلية و3) وقادر على ينقول عرض كل مكسب والخسارة من وظيفة الطفرات 6. وfollowiنانوغرام بروتوكول يصف كيفية وضع وتنفيذ شاشة الوراثية إلى الأمام باستخدام نظام ينقول SB لتحديد جينات السرطان مرشح (الشكل 1).

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. تربية الحيوانات والشيخوخة المعدلة وراثيا

  1. تحديد سلالات من الفئران المعدلة وراثيا المناسبة لتجربتك. وهناك تجربة نموذجية استخدام ثلاثة خطوط المعدلة وراثيا؛ ماوس transposase المشروط، ماوس لإيواء concatamer من ترانسبوزونات والفأر معربا عن لجنة المساواة العرقية في الخلايا Recombinase يعتقد أن خلايا المنشأ للسرطان المطلوب. إذا كان السرطان يجري على غرار لديه طفرة معروفة في نسبة كبيرة من المرضى قد يكون من المستحسن أن تدرج هذه الطفرة في البداية. ومن أمثلة هذه الطفرات "المهيئة" تشمل KRAS تفعيلها، TP53 السلبية السائدة أو أليل PTEN floxed. عن طريق إضافة طفرة في مؤهبة قد تمثل أفضل نموذج لسرطان الإنسان (انظر 1.3). عدة transposase الجمال النائم والفئران ينقول المتوفرة من مستودع الماوس الوطني للسرطان معهد ( http://mouse.ncifcrf.gov/ ).
  2. الفئران تتكاثر الفئران transposase مشروطة مع إيواء ترانسبوزونات في نهاية المطاف للحصول على الفئران متماثلة اللواقح لكلا الأليلات إذا كان ذلك ممكنا. سلالة ذرية متماثلة اللواقح لجنة المساواة العرقية معربا عن الفئران لتوليد Recombinase الخاص الثلاثي الفئران المعدلة وراثيا التجريبية (الشكل 2). ملاحظة: الفئران متماثلة اللواقح ليست دائما الحصول على الممكن أو مثالية. على سبيل المثال، P53 المهيمنة متماثلة اللواقح الفئران السلبية هي أكثر صعوبة لتربية الفئران من متخالف. وبالإضافة إلى ذلك، فإنه من المفيد للتأكد من أن تتبع الوراثة المندلية الفضلات للتأكد من أن نظام التربية الناجحة.
  3. في حالة استخدام خلفية ميالا والفئران سلالة الأولى مع transposase على الفئران مع أليل المؤهبة. في وقت واحد، معربا عن سلالة الفئران لجنة المساواة العرقية Recombinase على الفئران تحمل ترانسبوزونات. إنشاء الفئران متماثلة اللواقح لكل أليل إذا كان ذلك ممكنا. وأخيرا، وتولد ذرية متماثلة اللواقح من مخططات السابقة تربية اثنين إلى أربعة أضعاف توليد أنيم التجريبية المعدلة وراثياALS.
  4. بالإضافة إلى حيوانات التجارب، وتوليد الأفواج السيطرة على الفئران. السيطرة على المجموعة يتكون عادة من تتزاحم من تربية التجريبية التي ترث اثنين فقط من الأليلات الثلاثة (الشكل 2). في حالة وجود خلفية مستعد، سوف الفئران بينهم ثلاثة من الأليلات الأربعة سوف ضرورية أيضا.
  5. رصد التجريبية والضابطة الفئران يوميا من أجل التنمية الورم و / أو الاحتضار. اتبع رعايتك الحيوان المؤسسية واستخدام اللجنة (IACUC) المتطلبات لتربية الحيوانات. أيضا، انه يعتبر نموذجا لتحديد سن الذي سوف يضحي حيوان اذا لم تصبح بعد المحتضرة. ثمانية عشر شهرا هي عمر النموذجية التي يصرح باستخدامها في الفئران.

2. التشريح من الحيوانات المعدلة وراثيا

اسم كاشف شركة كتالوج رقم
متأكد ختم Inducغرفة نشوئها الدماغ شجرة العلمية EZ-177
Cryovial Bioexpress C-3355-2
التخزين المؤقت الفورمالين 10٪ سيغما الدريتش HT501128-4L

الجدول 1. الكواشف اللازمة.

  1. عندما الماوس أو المحتضرة وصلت إلى نهاية العمر الافتراضي العزم، الموت ببطء الحيوانات باستخدام CO 2 غرفة المبادئ التوجيهية الخاصة بك بعد IACUC. عموما، ضع الحيوان في غرفة الغاز النظيف، افتح خزان الغاز وضبط منظم لقراءة أي أعلى من 5 جنيه لكل بوصة مربعة. ملء ببطء لتقليل تهيج الأنف والعين والنفور من CO 2. تأكد من أن القلب الحيوان لم يعد الضرب ولا يستجيب عند لمسها في العين.
  2. رذاذ الخارج من الماوس ضحى مع الايثانول 70٪.
  3. مكان الماوس على لوحة التشريح وتأمين مع دبابيس تشريح. استخدام مقص لد ملاقط الماوس لفتح وإزالة الأجهزة. تحديد أي أجهزة ينبغي جمع هو المشروع التابعة. ومع ذلك، فمن المستحسن دائما لجمع الطحال والكبد حيث أن هذه الأجهزة غالبا ما تعطي نظرة متبصرة في ماذا كان الماوس المحتضرة. أيضا جمع القص لتحليل إمكانات نخاع العظام. وبالإضافة إلى ذلك، هو دائما مفيدة لجمع أي جهاز أو الأنسجة التي تظهر غير طبيعية.
  4. ينبغي تقسيم الأنسجة والأورام التي يتم جمعها إلى أربعة أقسام. تم إصلاح مقطع واحد في 10٪ مخزنة الفورمالين لمدة 18 ساعة تليها الايثانول 70٪. ويمكن استخدام هذا القسم لH & E تلطيخ و / أو IHC. ما تبقى من ثلاثة أقسام، والتي عادة ما تكون 50 إلى 100 ملغ في الحجم، هي المفاجئة المجمدة في النيتروجين السائل. ويمكن استخدام هذه لDNA، RNA والبروتين العزلة.
  5. التخلص من الأنسجة المتبقية الذبيحة وفقا للمبادئ التوجيهية IACUC.

3. عزل الحمض النووي الجيني من الأورام

<اسم قوي> من كاشف شركة كتالوج رقم
البروتين الأمطار الحل QIAGEN 158910
الخلية تحلل العازلة QIAGEN 158906
بروتين K QIAGEN 158920
ريبونوكلياز A QIAGEN 158924
TE العازلة Promega V6232

الجدول 2. الكواشف اللازمة.

  1. المفروم فرما ناعما العينة الورم المجمدة (50 إلى 100 ملغ) باستخدام شفرة حلاقة نظيفة.
  2. مفروم مكان الأنسجة في أنبوب مل 1.5 و ميكروسنتريفوج إضافة 1 مل من العازلة تحلل الخلايا التي تحتوي على 5 ميكرولتر حل K بروتين (20 ملغ / مل).
  3. دوامة بدقة.
  4. في احتضان 55 درجة مئوية شاكر تعيين في 250 دورة في الدقيقة لمدة 4 ساعة، بين عشية وضحاها يفضل.
  5. إضافة 1 ميكرولتر ريبونوكلياز A الحل (10 ملغ / مل) وعكس أنبوب 25 مرة.
  6. احتضان في C ° 37 لمدة 30 دقيقة.
  7. بارد لدرجة حرارة الغرفة عن طريق وضع على الجليد لمدة 3 دقائق.
  8. إضافة 333 ميكرولتر حل الأمطار البروتين ودوامة بقوة.
  9. الطرد المركزي في 14000 دورة في الدقيقة 10 دقيقة. ينبغي البروتينات بيليه. إذا بيليه هو صغير جدا، دوامة مرة أخرى، احتضان على الجليد لمدة 5 دقائق، ثم إعادة الطرد المركزي.
  10. صب قبالة DNA تحتوي طاف في أنبوب 15 مل نظيفة الطرد المركزي.
  11. إضافة حجم مساو من 100٪ الأيزوبروبانول وتخلط بواسطة 50 مرة عكس بلطف.
  12. أجهزة الطرد المركزي في 3،500 دورة في الدقيقة لمدة 3 دقائق.
  13. تجاهل طاف.
  14. إضافة 1 مل من الايثانول 70٪ وعكس مرات عدة أنبوب لغسل بيليه.
  15. نقل بيليه غسلها مع الإيثانول إلى أنبوب microcentrifuge 1.5 مل.
  16. أجهزة الطرد المركزي في 14000 دورة في الدقيقة لمدة 5 دقائق في C. ° 4
  17. صب قبالة الايثانول وعكس أنبوب الهواء الجاف ل(ما يقرب من 5 إلى 30 دقيقة).
  18. إعادة تعليق DNA عellet في 50 إلى 500 ميكرولتر من TE اعتمادا على حجم بيليه DNA.
  19. حضانة الاختياري في 37 ° C ل resuspend DNA.
  20. متجر في C ° 4، أو -20 درجة مئوية لمدة التخزين على المدى الطويل.

4. رابط بوساطة PCR باستخدام الحمض النووي الجيني من الأورام

اسم كاشف شركة كتالوج رقم
BfaI نيو انغلاند Biolabs R0568S
NlaIII نيو انغلاند Biolabs R0125S
MinElute 96 لوحات جيدة QIAGEN 28051
QIAvac متعددة فراغ 96 QIAGEN 19504
صفيحة ميكروسكوبية متعددة الجني، 120V العلمية للصناعات، وشركة SI-4000
T4 يغاز DNA مع العازلة ربط 5X إينفيتروجن 15224-041
BamHI نيو انغلاند Biolabs R0136S
25 ملي dNTPs Bioexpress C-5014-200
البلاتين طق إينفيتروجن 10966-034
FastStart البلمرة DNA طق روش 12032929001
الاغاروز Promega V3121
TAE عازلة Promega V4271
TE العازلة Promega V6232
إيثيديوم بروميد Promega H5041

الجدول 3. الكواشف اللازمة.

رابط متواليات

BfaI رابط + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

BfaI رابط-5 'فوس-TAGTCCCTTAAGCGGAG 3'NH2

"> NlaIII رابط + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

NlaIII رابط-5 'فوس-GTCCCTTAAGCGGAGCC 3'

متواليات التمهيدي

PCR الأولية إلى الأمام الجانب الأيمن (NlaIII): SPL IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

الابتدائية PCR اليسرى إلى الأمام الجانب (BfaI): SPL IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC

PCR الأولية لعكس الجانب اليمين واليسار معا: Link1 SPL 1 GTAATACGACTCACTATAGGGC

(مطلوبة لN تمثل الباركود BP 12، تسلسل في حالة العلوي للمنصة البورشيد، وتسلسل في انخفاض الحالة سوف ربط ينقول.) مثال لالتمهيدي البورشيد الثانوية barcoded AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa 5 ': الثانوي PCR الجانب الأيمن إلى الأمام

PCR الثانوية اليسرى إلى الأمام الجانب: مثال لbarcoded الشركة السعودية البورشيد(مطلوبة لN تمثل الباركود BP 12، تسلسل في حالة العلوي للمنصة البورشيد، وتسلسل في انخفاض الحالة سوف ربط ينقول.) دارى 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa التمهيدي

PCR الثانوية لعكس الجانب اليمين واليسار معا: رابط التمهيدي عكس متداخلة CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC 5 '

  1. يصلب + و- عن طريق خلط 50 ميكرولتر من رابط + (100 ميكرومتر) مع 50 ميكرولتر من رابط-(100 ميكرومتر) linkers لlinkers BfaI كل وlinkers NlaII وإضافة 2 ميكرولتر كلوريد الصوديوم (5 M) في أنبوب microcentrifuge 1.5 مل. المكان في 95 ° C الحرارة كتلة لمدة 5 دقائق. إيقاف كتلة التدفئة والسماح لتبرد ببطء إلى درجة حرارة الغرفة (وهذا يأخذ ساعة أو أكثر). بعد التبريد، قد يتم تخزين صلب linkers في الفريزر -20 درجة ° حين الحاجة.
  2. 2 إعداد مأخوذة من DNA الورم، كل قسامة تحتوي على 1 ميكروغرام من الحمض النووي. سوف يتم هضمها واحد قسامة الطرافةانزيم تقييد هكتار من شأنها أن تقطع بالقرب من نهاية "حق" من ينقول. وسيتم هضم قسامة الثاني مع انزيم تقييد أن التخفيضات على مقربة من نهاية "اليسار" من ينقول. يتم ذلك لتحقيق أقصى قدر من فرص تضخيم كل موقع الإدراج ينقول.
  3. هضم الحمض النووي ورم في إحدى قسامة باستخدام "حق" إنزيم الجانب NlaII، وهضم الحمض النووي ورم في قسامة أخرى باستخدام "اليسار" إنزيم الجانب BfaI: الجمع بين 1 ميكرولتر من انزيم، 5 ميكرولتر العازلة 10X NEB رقم 4، DNA ( 1 ميكروغرام) وDDH 2 O إلى وحدة تخزين ما مجموعه 50 ميكرولتر. خلاصة DNA بين عشية وضحاها في 37 درجة مئوية في حمام مائي أو الحاضنة.
  4. تسخين تعطيل الإنزيمات (BfaI = 80 درجة مئوية لمدة 20 دقيقة، NlaIII = 65 درجة مئوية لمدة 20 دقيقة).
  5. تنظيف العينات هضمها عن طريق وضع العينات في MinElute وحة 96 أيضا، لوحة متعددة في مكان الفراغ والفراغ لمدة 15 دقيقة حتى الآبار تبدو جافة.
  6. إزالة لوحة من فراغ وأسفل متعددة لطخة من 96 لوحة جيدا مع منشفة ورقية لإزالة كافة LIQUIد
  7. إضافة 30 ميكرولتر DDH 2 O إلى كل بئر ويهز على مجموعة شاكر المداري على ارتفاع لمدة 2 دقيقة، أو حتى ماصة وبنسبة 20 إلى 40 مرة.
  8. نقل كامل حجم الآبار في (30 ميكرولتر) من MinElute وحة 96 جيدا في لوحات 96 نظيفة أيضا.
  9. إجراء التفاعلات مع ربط رابط DNA هضمها من الخطوة 4.8 و linkers من الخطوة 4.1. 10 ميكرولتر مزيج DNA هضمها، 4 ميكرولتر العازلة ربط 5X، 5.5 ميكرولتر linkers صلب (950 ميكروغرام / ميكرولتر)، 0.5 ميكرولتر يغاز T4 (5 U / ميكرولتر).
  10. احتضان لمدة 4 ساعة ليلة وضحاها في 16 درجة مئوية.
  11. تسخين تعطيل ليغاز DNA T4 في C ° 65 لمدة 10 دقيقة.
  12. تنظيف ربط باستخدام MinElute 96 لوحات جيدة ومتعددة الفراغ كما هو موضح في الخطوات 4،5 حتي 4،6.
  13. resuspend في 30 ميكرولتر O 2 H ونقلها إلى لوحة نظيفة 96 أيضا.
  14. إجراء عملية الهضم الحمض النووي الثاني في لتدمير ما تبقى concatamer ترانسبوزونات. ويتحقق هذا عن طريق قطع DNA مرة ثانية باستخدام انزيم أن التخفيضات الخامس بلازميدector DNA الذي تم استخدامه لإنشاء الفئران المعدلة وراثيا تحتوي على concatamer ينقول.
  15. خلاصة DNA باستخدام BamHI (الجانب الأيمن والأيسر على حد سواء): مزيج من سعة 25 ميكرولتر رابط DNA-ligated من الخطوة 4.13، 5 ميكرولتر العازلة 10X NEB رقم 3، 0.5 ميكرولتر BamHI (20 U / ميكرولتر)، 0.5 ميكرولتر BSA (10 ملغ / مل )، و 19 ميكرولتر DDH 2 O.
  16. خلاصة 3-6 ساعة أو بين عشية وضحاها في 37 درجة مئوية.
  17. أداء PCR الأولية باستخدام التمهيدي محددة لينقول ومحددة التمهيدي للرابط. وهذه تختلف تبعا لما ينقول ورابط تستخدمه. الاشعال المذكورة في الجدول أعلاه التمهيدي العمل للT2/Onc وترانسبوزونات T2/Onc2.
  18. PCR الأولية: 5 ميكرولتر العازلة 10X، 2.0 ميكرولتر MgCl2 (50 ملم)، و 4 ميكرولتر dNTPs (2.5 نانومتر)، 1 ميكرولتر التمهيدي 1 (20 ميكرومتر)، 1 ميكرولتر التمهيدي 2 (20 ميكرومتر)، 0.25 ميكرولتر طق البلاتين (5 U / ميكرولتر)، و 3 ميكرولتر الحمض النووي مع إستيعاب linkers (مبلغ يمكن أن تختلف)، وتصل إلى 50 ميكرولتر DDH 2 O.
  19. PCR البرنامج: 94 ° C لمدة 5 دقائق، 30 دورات من 94 درجة مئوية لمدة 30 ثانية و 60 د وعلى سبيل المثال؛ مئوية لمدة 30 ثانية، 72 ° C لمدة 90 ثانية. التمديد النهائي في 72 درجة مئوية لمدة 5 دقائق.
  20. تنظيف المنتج باستخدام PCR MinElute 96 لوحات جيدة ومتعددة الفراغ كما هو موضح أعلاه.
  21. resuspend في 30 ميكرولتر O 2 H ونقلها إلى لوحة نظيفة 96 أيضا.
  22. جعل التخفيف من 1:75 1 ° PCR عن طريق تمييع 2 ميكرولتر من الحمض النووي من الخطوة 4،21 في 148 ميكرولتر O 2 DDH
  23. أداء PCR باستخدام الإصدارات الثانوية متداخلة من الاشعال التي لديها أيضا تسلسل المطلوبة للجهاز GAIIx البورشيد وكذلك زوج قاعدة 12 الباركود التي هي فريدة من نوعها لكل عينة الورم معالجتها (انظر الجدول التمهيدي أعلاه لأمثلة من هذه الاشعال).
  24. الثانوية PCR: 10 ميكرولتر العازلة 10X مع MgCl2، 8 dNTPs ميكرولتر (2.5 ملم)، 1 ميكرولتر البورشيد barcoded التمهيدي الثانوي (20 ميكرومتر)، 1 ميكرولتر 1 عش البورشيد التمهيدي الثانوي (20 ميكرومتر)، 0.25 ميكرولتر FastStart طق (5 U / ميكرولتر )، 2 ميكرولتر من الحمض النووي PCR 1:75 الابتدائية الواحد، ما يصل إلى 100 ​​ميكرولتر DDH 2 O.
  25. PCR البرنامج: 94 °؛ C لمدة 2 دقيقة، 30 ° C دورات 94 لل30 ثانية و 53 درجة مئوية لمدة 45 ثانية، 72 ° C لمدة 90 ثانية. التمديد النهائي في 72 درجة مئوية لمدة 5 دقائق.
  26. مسافة 45 ميكرولتر من رد الفعل هذا PCR على هلام الاغاروز٪ 1 التي تتضمن إيثيديوم بروميد (0.5 ميكروغرام / مل). يجب أن يكون هناك "تشويه" من المنتجات PCR تمثل amplicons من الإدراج ينقول عديدة ومختلفة في الورم (الشكل 3).
  27. تنظيف المتبقية 50 ميكرولتر من المنتج PCR باستخدام MinElute 96 لوحات جيدة ومتعددة الفراغ كما هو موضح أعلاه. يغسل مرة واحدة عن طريق وضع 50 ميكرولتر DDH 2 O في الآبار وكنس مرة أخرى.
  28. resuspend في 30 ميكرولتر TE ونقلها إلى لوحة نظيفة 96 أيضا.
  29. تحديد تركيز الحمض النووي في كل عينة. الجمع بين كميات متساوية من الحمض النووي في أنبوب واحد 1،5 مل microfuge. وستكون هذه المكتبة التي يتم التسلسل في ممر واحد من آلة البورشيد 2000 HiSeq. فمن الممكن لتسلسل عدة مئات من الأورام في ممر واحد لتشغيل البورشيد.
  30. عرضأنبوب واحد يحتوي على كميات متساوية من الحمض النووي من جميع الأورام للتسلسل. ويمكن أن يتم ذلك عن طريق مؤسسة أو تجاريا.

5. تحليل الإدراج ينقول

  1. برنامج لتحليل البيانات ينقول الإدراج يتوفر للتحميل مجانا عبر سورس ( http://sourceforge.net/projects/tapdancebio/ ). البرنامج، ودعا TapDance، يتطلب الملف تسلسل من منصة البورشيد والباركود إلى خريطة مكتبة ملف نصي.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

بعد تم تأسيس نظام التربية، وينبغي أن مربي إنتاج القمامة كل يوم 19-21. سوف تختلف حجم القمامة ما بين 5 و 12 الجراء، وهذا يتوقف على عمر من المربين والخلفية الوراثية. وبالإضافة إلى ذلك، تأكد من أن التركيب الوراثي من القمامة يلي مندلية الوراثة كوسيلة لتأكيد أن المخطط تربية صحيحة على حد سواء وناجحة.

للتجربة أن تكون ناجحة، يجب أن حدوث الأورام في حيوانات التجارب تكون أكبر بكثير من حدوث الأورام في الحيوانات السيطرة. إذا لم يدرج "المهيئة" طفرة في التجربة يجب أن يكون هناك عدد قليل من أية أورام في الحيوانات السيطرة. إذا تم تضمين "المهيئة" طفرة في التجربة، يجب أن حدوث الأورام في هذه الحيوانات أن تكون أقل بكثير من نسبة الإصابة في الحيوانات مع تحور والنشاط SB.

يجب LM-PCR تضخيم مئات الإدراج في ينقول ورم واحد. بعد تشغيل هكتارLF للمنتج PCR الثانوية على هلام 1٪، يجب أن يكون هناك "تشويه" من DNA يمثل هذا التضخيم (الشكل 3). إذا كان هناك واحد فقط أو اثنين من العصابات، وكان إما SB غير نشطة في الورم أو تم خطأ في بروتوكول (الشكل 4).

يجب أن التسلسل 1-200 الأورام في ممر واحد من النظام الأساسي GAIIx البورشيد إنتاج أكثر من 30 مليون متواليات من 100 BP كل (الشكل 5).

الجدول 1. الكواشف اللازمة للقسم 2.

الجدول 2. الكواشف اللازمة للباب 3.

الجدول 3. الكواشف اللازمة للقسم 4.

الشكل 1
الشكل 1. الرسم البياني يوضح الخطواتلتنفيذ شاشة الوراثية إلى الأمام باستخدام نظام الجمال النائم. أولا، يتم إنشاء نموذج الفأر. وnecropsied ثم الفئران عندما يتم جمع المحتضرة والأورام ومعزولة. يتم تنقيته DNA الورم وإجراء رابط بوساطة-PCR. وأخيرا، يتم تضخيم التسلسل DNA الورم مع الإدراج ينقول وتحديد مواقع الإدراج المشترك.

الشكل 2
الشكل 2. تربية مخطط لتوليد الفوج التجريبية. الفئران التي تحتوي على transposase (Rosa26-LSL-SB11) وعبرت لإيواء الفئران concatamer من ترانسبوزونات (T2-انس). وتزاوج ثم ذرية الفئران لتحمل المروج الأنسجة المعينة المحددة مدفوعة لجنة المساواة العرقية Recombinase (لجنة المساواة العرقية).

الشكل 3
الشكل 3. ممثلنتائج الثانوية PCR. المنتوج المتوقع لديه مسحة مثل ظهور تتراوح بين 100 إلى أزواج قاعدة 600.

الشكل 4
الشكل 4. إذا LM-PCR غير ناجحة، سيكون هناك غياب "تشويه" من الحمض النووي. بدلا من ذلك، سوف ترى الفرق نهائي من الحمض النووي.

الشكل 5
ينبغي تحليل بيانات الرقم مثال 5. من المدى الذي يوضح تسلسل ممر واحد للمنصة GAIIx البورشيد إنتاج أكثر من 30 مليون من أزواج قاعدة تسلسل 100 كل.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

شاشة الوراثية إلى الأمام باستخدام نظام النوم ينقول الجمال يوفر طريقة لتحديد الطفرات التي تسبب السرطان. عن طريق اختيار المروج المناسبة لمراقبة لجنة المساواة العرقية Recombinase بالإضافة إلى أي طفرات المهيئة، فإن الشاشة SB تحديد جينات جديدة معروفة وسرطان مرشح.

نجاح على شاشة SB يعتمد إلى حد كبير على الفئران التي اختيرت لإنشاء الشاشة. لينقول، نوصي باستخدام الماوس سلالتين مختلفة تحمل concatamer من ترانسبوزونات أنكجنيك على الكروموسومات المختلفة 7. وينبغي استخدام الفكر حذرا عند اختيار لجنة المساواة العرقية Recombinase الأنسجة محددة من شأنها أن تفعيل transposase SB. يجب أن يكون هناك دليل على أن لجنة المساواة العرقية الانزيم نشط في نوع من الخلايا التي يشتبه في كونها خلية من خلايا المنشأ للسرطان التي يجري تحويلها إلى نموذج. وتشمل الأمثلة الناجحة لجنة المساواة العرقية، Villin (GI المسالك السرطان)، لجنة المساواة العرقية الزلال-(carcinom الكبدأ)، والمعونة لجنة المساواة العرقية-(سرطان الغدد الليمفاوية) 8-10

فإن عدد الفئران اللازمة لنجاح شاشة تعتمد على انتفاذ الورم. بشكل عام، سوف أكثر وأكثر الأورام الفئران يؤدي إلى الشاشة أكثر قوة. للكشف عن الفرق 2-أضعاف في سرطان الكمون يجب أن يكون هناك على الأقل 60 الحيوانات في السيطرة على حد سواء والمجموعات التجريبية 11

طبيعة تنوعا من هذه الشاشات هي قوية فيما يتعلق تقنيات أخرى يمكن للمرء أن في تحديد طبيعة المرض، اتبع التقدم، وتحليل التكوين الجيني. وكانت هذه التقنية بنجاح في عدد من الشاشات التي أسفرت عن قوائم CIS التي تحدد القيادة الجديدة المحتملة سرطان الجينات. مع هذه المعلومات، قد يتم تنفيذ الدراسات الموجهة إلى فهم وظيفة هذه الطفرات الرواية. وبشكل عام، فإن استخدام هذه التقنية تؤدي في نهاية المطاف إلى التصميم من العلاجات المخدرات جديدة تهدف إلى القضاء على نتائج هذه مؤتة جينية محددةستعقد.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Acknowledgments

فإن الكتاب أود أن أشكر براندن Moriarity، Largaespada ديفيد، وكنج فنسنت في جامعة مينيسوتا، ودوبوي آدم في جامعة ولاية ايوا لمساعدتهم في تطوير بروتوكول الموصوفة أعلاه.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
تحديد<em&gt; الجمال النائم</em&gt; الإدراج ينقول في الأورام الصلبة باستخدام رابط بوساطة PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter