Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

זיהוי doi: 10.3791/50156 Published: February 1, 2013

Summary

שיטה של ​​זיהוי נהגים לא ידועים של היווצרות הסרטן באמצעות גישה משוחדת מתוארת. השיטה משתמשת

Abstract

ניתוח גנומי, proteomic, transcriptomic, וepigenomic של גידולים אנושיים מצביע על כך שיש אלף חריגות בתוך כל הגנום סרטן בהשוואה לרקמות מתאימות. בהתבסס על ניתוחים אלו ניתן לראות כי יש הרבה נהגים גנטיים ידועים של הסרטן 1. למרבה צער הנהגים האלה חבויים בתוך מספר גדול בהרבה של אנומליות נוסע בגנום שלא תורם באופן ישיר להיווצרות גידול. היבט נוסף של הגנום של הסרטן הוא שקיימת הטרוגניות גנטית ניכרה בתוך סוגי גידולים דומים. כל גידול יכול נמל מוטציות שונות המעניקות יתרון סלקטיבי להיווצרות גידול 2. ביצוע מסך גנטי קדימה משוחד בעכברים מספק את הכלים ליצירת גידולים ולנתח ההרכב הגנטי שלהם, תוך הפחתת רקע המוטציות נוסעות. היפיפייה נרדמת המערכת (SB) transposon היא שיטה אחת כזאת 3. המערכת מנצלת SB הנייד vectors (transposons) שניתן להוסיף לאורך הגנום על ידי אנזים transposase. מוטציות מוגבלות לסוג תא מסוים באמצעות שימוש באלל transposase המותנה שמופעל על ידי Cre recombinase. קווי עכבר רבים קיימים שrecombinase המפורש Cre ברקמות ספציפיות. על ידי חצייה אחד מהקווים הללו לאלל transposase המותנה (למשל קס-stop-קס-SB11), מערכת SB מופעלת רק בתאים שמבטאים Cre recombinase. Cre recombinase יהיה בלו קלטת תחנה שחוסמת ביטוי של אלל transposase, הפעלת mutagenesis transposon בתוך סוג התא המיועד לכך. מסך SB הוא שיזם רביית שלושה זנים של עכברים מהונדסים כך שעכברי הניסוי לשאת אלל מותנה transposase, concatamer של transposons, ואלל recombinase Cre רקמות ספציפיות. עכברים אלה אפשרו לגיל ועד צורת גידולים והם הופכים גוססים. העכברים הם אזהדנ"א הגנומי necropsied ומבודד מהגידולים. בשלב הבא, הדנ"א הגנומי נתונת המקשר בתיווך-PCR (LM-PCR) כי תוצאות בהגברה של לוקוסים הגנומי המכילים SB transposon. LM-PCR בוצע על גידול חד יגרום למאה amplicons השונה המייצג את מאה לוקוסים הגנומי המכילים הוספות transposon ב4 גידול יחידים. הוספות transposon בכל הגידולים מנותחות ואתרי החדרה נפוצים (CISS) מזוהים באמצעות שיטה סטטיסטית מתאימה 5. הגנים בתוך חבר העמים הם סבירים מאוד להיות אונקוגנים או גני מדכאי סרטן, והם נחשבים לגנים סרטניים מועמד. היתרונות של שימוש במערכת SB לזיהוי גנים סרטניים מועמדים הם: 1) transposon יכול בקלות להיות ממוקם בגנום בגלל הרצף שלו ידוע, 2) טרנספוזיציה יכולה להיות מופנה לכמעט כל סוג תא ו3) transposon מסוגל מציג גם רווח והפסד מוטציות-of-פונקצית 6. Following הפרוטוקול מתאר כיצד לתכנן ולהוציא לפועל מסך קדימה גנטי באמצעות מערכת transposon SB לזיהוי גנים סרטניים מועמד (איור 1).

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. גידול והזדקנות של בעלי חיים מהונדסים

  1. בחר את הזנים של עכברים מתאימים לניסוי שלך מהונדסים. ניסוי טיפוסי יהיה להשתמש בשלושה קווים מהונדסים; עכבר מותנה transposase, עכבר מחסה concatamer של transposons, ועכבר מבטא Cre recombinase בתאים שסברו שהתאים מהמוצא לסרטן הרצוי. אם הסרטן שעצב יש מוטציה ידועה באחוז גדול מהחולים זה יכול להיות רצוי לכלול מוטציה זו בהתחלה. דוגמאות של מוטציות אלה "predisposing" כוללות Kras מופעל, TP53 השלילי דומיננטי או אלל PTEN floxed. על ידי הוספה במוטצית predisposing המודל טוב יותר עשוי לייצג סרטן בבני האדם (ראה 1.3). transposase כמה יפהפה נרדם ועכברי transposon זמינים ממכון הסרטן המאוס המאגר הלאומי (http://mouse.ncifcrf.gov/).
  2. עכברי גזע מותנים transposase עם עכברי חסת transposons סופו של דבר להשיג עכברים הומוזיגוטים לשני אללים אם ניתן. גזע צאצאי הומוזיגוטים לעכברים המבטאים Cre recombinase לייצר עכברים הטרנסגניים הניסיוניים המשולשים (איור 2). הערה: עכברים הומוזיגוטים קבלה הם לא תמיד אפשריים או אידיאליים. לדוגמה, עכברים שליליים דומיננטיים הומוזיגוטים p53 הם הרבה יותר קשה מאשר לגדל עכברים הטרוזיגוטיים. בנוסף, כדאי לוודא שהמלטות לעקוב גנטיקת מנדליים כדי לאשר שתכנית הרבייה מוצלחת.
  3. אם אתם משתמשים ברקע נטייה, גזע העכברים ראשונים עם transposase לעכברים עם אלל predisposing. במקביל, עכברי גזע מבטאים Cre recombinase לעכברים הנושאים את transposons. יצירת עכברים הומוזיגוטים לכל אלל אם זה אפשרי. לבסוף, יתרבה צאצאי הומוזיגוטים משני תוכניות הרבייה הקודמות ליצירה ניסיונית ינעימו מהונדס מרובעals.
  4. בנוסף בניסויים בעכברים, ליצור קבוצות בקרה של עכברים. קבוצת הביקורת בדרך כלל מורכבת מהמלטה מהגידול הניסיוני שיורשות שניים משלושת אללים (איור 2) בלבד. במקרה של רקע נטייה, עכברים, כולל שלושה מתוך ארבעה אללים יהיו גם צורך בכך.
  5. פקח על עכברי ניסוי ובקרה יומיומיים להתפתחות גידול ו / או moribundity. בצע טיפולך המוסדי בעלי החיים ושימוש בדרישות ועדה (IACUC) לגידול בעלי חיים. כמו כן, הוא אופייני לקביעת גיל שבו אתה מוכן להקריב בעלי חיים אם זה עדיין לא הפך גוסס. שמונה עשרה חודשים הם גיל אופייני שבי עכברים מורדמים.

2. נתיחה לאחר מוות של בעלי חיים מהונדסים

שם המגיב חברה מספר קטלוגים
בטח-חותם Inducלשכת tion מוח מדעי עץ EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered פורמלין סיגמה אולדריץ HT501128-4L

לוח 1. ריאגנטים הנדרשים.

  1. כאשר עכבר הוא גוסס או שהגיע לסוף תוחלת החיים שנקבע, להרדים בעלי חיים באמצעות 2 CO קאמרי בעקבות הנחיות IACUC. באופן כללי, הנח את החיה בתא גזים נקי, לפתוח את מכל הדלק ולהתאים את הרגולטור לקרוא לא עולה על 5 ק"ג לסנטימטר רבוע. מלא לאט כדי למזער את גירוי ואף וסלידה עיני לCO 2. ודא שלבו של בעל החיים פועם כבר לא ואינו מגיב כאשר נגע בעיניים.
  2. ריסוס של עכבר חיצוני הקריב עם אתנול 70%.
  3. מקום עכבר על לוח נתיחה לאחר מוות ולאבטח עם סיכות מנתחים. השתמש במספרייםד פינצטה כדי לפתוח את העכבר ולהוציא איברים. קביעה אילו איברים יש לאסוף היא פרויקט תלוי. עם זאת, מומלץ תמיד לגבות את הטחול ובכבד כאיברים אלה לעתים קרובות לתת תובנה חשובה למה העכבר היה גוסס. גם לאסוף עצם החזה לניתוח הפוטנציאל של מוח עצם. בנוסף, זה תמיד מועיל לאיסוף כל איבר או רקמה שמופיע חריג.
  4. רקמות וגידולים שנאספו צריכות להיות מחולקות לארבעה חלקים. סעיף אחד קבוע ב10% נאגרו פורמלין תמורת 18 שעות אחריו אתנול 70%. סעיף זה יכול לשמש לצביעת H & E ו / או IHC. שלושת הסעיפים הנותרים, שהם בדרך כלל 50-100 מ"ג בגודל, הם צמד הקפוא בחנקן נוזלי. אלה יכולים לשמש לDNA, RNA ובידוד חלבון.
  5. השלך רקמות גווייה ונותר על פי הנחיות IACUC.

3. בידוד הדנ"א הגנומי מגידולים

<שם> חזק של ריאגנט חברה מספר קטלוגים
פתרון רטיבות חלבון Qiagen 158910
חיץ תמוגה תא Qiagen 158906
Proteinase K Qiagen 158920
RNase Qiagen 158924
TE המאגר Promega V6232

טבלה 2. ריאגנטים הנדרשים.

  1. דק לרכך מדגם גידול הקפוא (50-100 מ"ג), תוך שימוש בסכין גילוח נקי.
  2. מקום טחון הרקמה בצינור microcentrifuge מ"ל 1.5 ולהוסיף 1 מ"ל של חיץ תמוגה תא המכיל פתרון 5 μl proteinase K (20 מ"ג / מ"ל).
  3. מערבולת ביסודיות.
  4. דגירה ב55 ° C ייקר להגדיר ב 250 סל"ד לפחות 4 שעות, רצוי למשך הלילה.
  5. הוסף RNase μl פתרון 1 (10 מ"ג / מ"ל) ולהפוך 25 פעמי צינור.
  6. לדגור על 37 מעלות צלזיוס למשך 30 דקות.
  7. מצנן לטמפרטורת חדר על ידי נחת על קרח 3 דקות.
  8. הוסף פתרון 333 μl חלבון רטיבות ומערבולת במרץ.
  9. צנטריפוגה בסל"ד 14000 10 דקות. חלבונים צריכים גלולים. אם גלולה היא, מערבולת קטנה מאוד שוב, לדגור על קרח למשך 5 דקות, ולאחר מכן מחדש צנטריפוגה.
  10. יוצק את DNA המכיל supernatant לתוך צינור צנטריפוגות נקיה 15 מ"ל.
  11. הוסף נפח שווה של 100% isopropanol ולערבב בעדינות 50 פעמי היפוך.
  12. צנטריפוגה בסל"ד 3500 עבור 3 דקות.
  13. בטל supernatant.
  14. הוסף 1 מ"ל של אתנול 70% ולהפוך כמה פעמים בצינור כדי לשטוף את הגלולה.
  15. להעביר את הגלולה השטופה יחד עם אתנול לצינור microcentrifuge 1.5 מ"ל.
  16. צנטריפוגה בסל"ד 14000 למשך 5 דקות ב 4 ° C.
  17. יוצק את אתנול ולהפוך לצינור אוויר יבש (כ 5 עד 30 דקות).
  18. Resuspend DNA עמellet ב50-500 μl של TE תלוי בגודל של ה-DNA הגלולה.
  19. דגירה אופציונלית על 37 מעלות צלזיוס לresuspend-DNA.
  20. חנות ב 4 ° C, או -20 ° C עבור אחסון לטווח ארוך.

4. DNA לינקר המתווך-PCR שימוש הגנום מגידולים

שם המגיב חברה מספר קטלוגים
BfaI ניו אינגלנד Biolabs R0568S
NlaIII ניו אינגלנד Biolabs R0125S
MinElute 96 גם צלחות Qiagen 28051
סעפת אבק QIAvac 96 Qiagen 19504
Multi-microplate Genie, 120V תעשיות מדע, בע"מ SI-4000
ligase DNA T4 עם מאגר הקשירה 5x Invitrogen 15224-041
BamHI ניו אינגלנד Biolabs R0136S
25 מ"מ dNTPs Bioexpress C-5014-200
Taq פלטינום Invitrogen 10966-034
DNA פולימראז תקי FastStart רוש 12032929001
Agarose Promega V3121
TAE המאגר Promega V4271
TE המאגר Promega V6232
Ethidium רומיד Promega H5041

לוח 3. ריאגנטים הנדרשים.

רצפי לינקר

BfaI מקשר + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

BfaI מקשר-5 'Phos-TAGTCCCTTAAGCGGAG 3'NH2

"> NlaIII מקשר + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

NlaIII מקשר-5 'Phos-GTCCCTTAAGCGGAGCC 3'

רצפי פריימר

העיקרי PCR קדימה צד ימין (NlaIII): SPL IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

העיקרי PCR קדימה השאיר צד (BfaI): SPL IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC

הפך עיקרי PCR לצד ימין ושמאל: SPL Link1 1 GTAATACGACTCACTATAGGGC

PCR צד ימין קדימה משני: דוגמה לפריימר המשני המינימרקטים Illumina 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (N מייצג את הברקוד של 12 נ"ב, רצף במקרה העליון נדרשים לפלטפורמת Illumina, והרצף באותיות קטנות יהיה לאגד את transposon.)

המשני PCR קדימה השאיר צד: דוגמה לsecon המינימרקטים Illuminaפריימר 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa dary (N מייצג את הברקוד של 12 נ"ב, רצף במקרה העליון נדרשים לפלטפורמת Illumina, והרצף באותיות קטנות יהיה לאגד את transposon.)

הפך משני PCR לצד ימין ושמאל: פריימר ההפוך המקונן מקשר 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. Anneal + ו - linkers עבור שתי linkers BfaI וlinkers NlaII על ידי ערבוב של 50 μl מקשר + (100 מיקרומטר) עם 50 μl של מקשר-(100 מיקרומטר) ולהוסיף 2 NaCl μl (5 M) בצינור microcentrifuge 1.5 מ"ל. מקום בבלוק 95 מעלות חום צלזיוס למשך 5 דקות. בטל בלוק חימום ולתת לאט מגניב לטמפרטורת חדר (זה לוקח כשעה או יותר). לאחר קירור, linkers annealed ניתן לאחסן במקפיא -20 ° C עד צורך.
  2. להכין שני aliquots של ה-DNA, גידול כל aliquot המכיל 1 מיקרוגרם של ה-DNA. aliquot אחד יהיה מתעכל שנינותאנזים הגבלה חה שחתך קרוב לקצה "הנכון" של transposon. Aliquot השני יהיה מעוכל עם אנזים הגבלה שחותך קרוב לסוף "השמאלי" של transposon. הדבר זה נעשה על מנת למקסם את הסיכויים של הגברה כל אתר הכנסת transposon.
  3. לעכל את ה-DNA הגידול בaliquot אחד באמצעות NlaII "הנכון" צד האנזים, ולעכל את ה-DNA הגידול בaliquot האחר באמצעות צד אנזים BfaI "השמאל": לשלב μl 1 של אנזים, # 4 הצפת NEB 10x μl 5, ה-DNA ( מיקרוגרם 1) וDDH 2 O להיקף כולל של 50 μl. דנ"א דייג'סט הלילה על 37 מעלות צלזיוס באמבט מים או חממה.
  4. מחמם להשבית אנזימים (BfaI = 80 מעלות צלזיוס במשך 20 דקות, NlaIII = 65 מעלות צלזיוס למשך 20 דקות).
  5. נקה את הדגימות מתעכלות על ידי נחת דגימות בצלחת גם MinElute 96, צלחת מקום בסעפת ואקום וואקום לכ 15 דקות עד שבארות להיראות יבשה.
  6. הסרת צלחת מסעפת ואקום ותחתון כתם של צלחת גם 96 עם מגבת נייר כדי להסיר את כל LIQUIד
  7. הוסף 30 μl DDH 2 O לכל באר וללחוץ על סט מסלולית ייקר על גבוה עבור 2 דקות, או פיפטה מעלה ומטה 20-40 פעמים.
  8. להעביר את כל נפח בבארות (30 μl) מהצלחת גם MinElute 96 ל96 גם צלחות נקיות.
  9. לביצוע תגובות קשירה מקשרות עם דנ"א מתעכל מצעד 4.8 וlinkers מ שלב 4.1. מערבב 10 דנ"א μl מתעכל, 4 חיץ μl 5x קשירה, 5.5 linkers annealed μl (950 מיקרוגרם / μl), ligase T4 0.5 μl (5 U / μl).
  10. דגירה במשך 4 שעות ללילה בגיל 16 ° C.
  11. מחמם להשבית ligase DNA T4 על 65 מעלות צלזיוס למשך 10 דקות.
  12. לנקות באמצעות קשירת MinElute 96 גם צלחות וסעפת ואקום כמתואר בשלבים 4.5-4.6.
  13. Resuspend ב30 μl H 2 O ולהעביר לצלחת גם נקיה 96.
  14. בצע עיכול ה-DNA שני כדי להשמיד נותר transposons concatamer. זו מושגת על ידי חיתוך ה-DNA בפעם שנייה באמצעות אנזים שחותך v פלסמידדנ"א Ector ששמש כדי ליצור את העכברים הטרנסגניים מכילים transposon concatamer.
  15. דייג'סט דנ"א באמצעות BamHI (צד ימין ומשמאל): מערבבים 25 μl של DNA מקשר-גבעול מצעד 4.13, חיץ 5 μl 10x NEB # 3, 0.5 BamHI μl (20 U / μl), 0.5 BSA μl (10 מ"ג / מ"ל ), ו 19 μl DDH 2 O.
  16. דייג'סט 3-6 שעות או לילה בשעת 37 ° C.
  17. לבצע PCR הראשוני באמצעות פריימר ספציפי לtransposon וספציפי פריימר למקשר. אלה ישתנו בהתאם למה transposon ומקשר אתה משתמש. את פריימרים מפורטים בטבלה לעיל פריימר לעבודה T2/Onc וT2/Onc2 transposons.
  18. PCR העיקרי: 5 החיץ μl 10x, 2.0 MgCl2 μl (50 מ"מ), 4 dNTPs μl (2.5 ננומטר), פריימר 1 μl 1 (20 מיקרומטר), פריימר 1 μl 2 (20 מיקרומטר), 0.25 μl פלטינום תקי (5 U / μl), 3-DNA μl מתעכל עם linkers (סכום עשוי להשתנות), עד 50 μl DDH 2 O.
  19. PCR תכנית: שניות 94 מעלות צלזיוס למשך 5 דקות, 30 מחזורים של 94 ° C למשך 30, 60 & dלדוגמה: C למשך 30 שניות, 72 מעלות צלזיוס במשך 90 שניות. סיומת סופית ב 72 מעלות צלזיוס למשך 5 דקות.
  20. לנקות את המוצר באמצעות PCR MinElute 96 גם צלחות וסעפת ואקום כמתואר לעיל.
  21. Resuspend ב30 μl H 2 O ולהעביר לצלחת גם נקיה 96.
  22. הפוך דילול 1:75 של 1 ° PCR על ידי דילול 2 μl של דנ"א מהצעד 4.21 ל148 DDH 2 O μl
  23. לבצע PCR המשני באמצעות גרסות מקוננות של פריימרים שמכילים גם את הרצף הנדרש למכונת GAIIx Illumina כמו גם ברקוד זוג בסיס 12 שהוא ייחודי לכל דגימת גידול מעובד (ראה טבלה לעיל פריימר לדוגמאות של פריימרים האלה).
  24. המשני PCR: 10 המאגר μl 10x עם MgCl2, 8 dNTPs μl (2.5 מ"מ), 1 Illumina μl המינימרקטים פריימר המשני (20 מיקרומטר), קן 1 μl Illumina 1 פריימר המשני (20 מיקרומטר), 0.25 μl FastStart Taq (5 U / μl ), 2-DNA μl מ1:75 מדוללים עיקריים PCR, עד 100 μl DDH 2 O.
  25. PCR תכנית: 94 מעלות, C עבור 2 דקות, 30 מחזורים של 94 מעלות צלזיוס למשך 30 שניות, 53 מעלות צלזיוס למשך 45 שניות, 72 ° C למשך 90 שניות. סיומת סופית ב 72 מעלות צלזיוס למשך 5 דקות.
  26. הפעלת 45 μl תגובת PCR זה ב% agarose ג'ל המכיל 1 ethidium רומיד (0.5 מיקרוגרם / מ"ל). לא צריך להיות "כתם" של מוצרי PCR מייצגים amplicons של הוספות הרבות והשונות transposon בגידול (איור 3).
  27. לנקות 50 μl הנותר של המוצר באמצעות PCR MinElute 96 גם צלחות וסעפת ואקום כמתואר לעיל. לשטוף פעם אחת על ידי הצבת 50 DDH 2 O μl בבארות ולשאוב שוב.
  28. Resuspend ב30 TE μl ולהעביר לצלחת גם נקיה 96.
  29. לקבוע את הריכוז של ה-DNA בכל דגימה. שלב כמויות שווות של דנ"א בצינור microfuge אחת 1.5 מ"ל. זה יהיה הספרייה שמיצתה בנתיב יחיד של מכונת Illumina HiSeq 2000. ניתן רצף כמה מאה גידולים בנתיב אחד של ריצת Illumina.
  30. להגישצינור יחיד המכיל כמויות שווות של DNA מכל הגידולים לריצוף. ניתן לעשות זאת על ידי המוסד שלך או באופן מסחרי.

5. ניתוח של הוספות Transposon

  1. תוכנה לניתוח transposon הכנסת נתונים זמינה להורדה בחינם דרך SourceForge (http://sourceforge.net/projects/tapdancebio/). התכנית, הנקראת TapDance, דורשת את קובץ הרצף מפלטפורמת Illumina וברקוד לקובץ טקסט מפת ספרייה.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

לאחר תכנית הרבייה כבר נקבע, מגדלים צריכים לייצר המלטה כל 19-21 ימים. גודל המלטה משתנה בין 5 ל 12 גורים, בהתאם לגילו של המגדלים והרקע הגנטי. בנוסף, ודא שהגנוטיפ של ההמלטה כדלקמן גנטיקה המנדלית כדרך לאשר כי תכנית הרבייה היא גם נכונה ומוצלחת.

לניסוי כמוצלח, שכיחות גידולים בחיות הניסוי צריכה להיות גבוהה משמעותי מגידול בשכיחות פקד החיים. אם לא מוטציה "predisposing" נכללה בניסוי צריך להיות כמה שאין גידולים בפקד החיים. אם מוטציה "predisposing" נכללה בניסוי, שכיחות גידולים בבעלי חיים אלה צריכות להיות נמוכות בהרבה משכיחות בחיות עם המוטציה ופעילות SB.

LM-PCR צריך להגביר מאת הוספות transposon בגידול אחד. לאחר ההפעלה חהLF של מוצר PCR המשני בג'ל 1%, לא צריך להיות "כתם" של ה-DNA המייצג הגברה זה (איור 3). אם יש רק אחד או שתיים להקות, בין אם SB לא היה פעיל בגידול או שגיאה נעשתה בפרוטוקול (איור 4).

סידור 1-200 גידולים בנתיב אחד של פלטפורמת GAIIx Illumina צריך לייצר למעלה מ -30 מיליון רצפים של 100 נקודתי בסיס כל אחת (איור 5).

לוח 1. ריאגנטים נדרשו לסעיף 2.

הטבלה 2. ריאגנטים נדרשו לסעיף 3.

הלוח 3. ריאגנטים נדרשו לסעיף 4.

איור 1
איור 1. תרשים זרימה המציג את השלביםלבצע את מסך קדימה גנטי באמצעות המערכה היפיפייה הנרדמת. ראשית, במודל עכבר שנוצר. עכברים מכן necropsied כשגוסס וגידולים נאספים ומבודד. דנ"א גידול מטוהר ותיווך-PCR מקשר בצע. לבסוף, ה-DNA גידול מוגבר עם הוספות transposon היא רצף ואתרי החדרה נפוצים מזוהים.

איור 2
איור 2. רביית ערכה ליצירת קבוצה ניסיונית. עכברים המכילים transposase (Rosa26-LSL-SB11) הם חצו לעכברי מחסה concatamer של transposons (T2-ONC). אז צאצאיהם הזדווגו לעכברים שנשאו את האמרגן ספציפי הרקמות המיועדות מונע Cre recombinase (Cre).

איור 3
איור 3. נציגתוצאות PCR המשני. המוצר הצפוי יש למרוח כמו מראה הנע 100-600 זוגות בסיסים.

איור 4
איור 4. אם LM-PCR הוא לא מוצלח, יהיה היעדרם של "הכתם" של ה-DNA. במקום זאת, תוכל לראות להקות סופיות של ה-DNA.

איור 5
איור 5. נתוני דוגמה מריצת רצף שממחישה נתיב יחיד של פלטפורמת GAIIx Illumina צריכים לייצר למעלה מ -30 מיליון רצפים של 100 זוגות בסיסים כל אחד.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

מסך קדימה גנטי באמצעות המערכה היפיפייה הנרדמת transposon מספק שיטה לזיהוי מוטציות הגורמת לסרטן. על ידי בחירת האמרגן המתאים לשלוט Cre recombinase בנוסף לכל מוטציות predisposing, מסך SB יזהה ידוע וגנים סרטניים מועמד חדש.

ההצלחה של מסך SB היא תלויה במידה רבה את העכברים שנבחרו ליצירת המסך. לtransposon, מומלץ להשתמש בשני זנים שונים של עכברים שנשאו concatamer של transposons אונקוגניות על כרומוזומים שונים 7. מחשבה זהירה צריכה לשמש בעת בחירת recombinase Cre רקמות הספציפיות שיפעיל transposase SB. לא צריך להיות עדות לכך שאנזים Cre הוא פעיל בסוג התא שנחשד תא מוצא של סרטן המודל. דוגמאות מוצלחות כוללות Villin-Cre (GI מערכת הסרטן), אלבומין-Cre (hepatocellular carcinomא), וסיוע-Cre (לימפומה). 8-10

מספר העכברים הנדרשים למסך מוצלח יהיה תלוי חדירנות גידול. באופן כללי, יותר גידולים ועוד עכברים יגרמו מסך חזק יותר. כדי לזהות הבדל 2-לקפל בסרטן ההשהיה צריכים להיות לפחות 60 בעלי חיים הוא בבקרה וקבוצות ניסוי. 11

הטבע הצדדי של מסכים אלו הוא רב עצמה ביחס לשיטות אחרות בכך שניתן לציין את אופי המחלה, בצעו את ההתקדמות, ולנתח את ההרכב הגנטי. טכניקה זו הייתה מוצלחת במספר המסכים שהניב רשימות חבר עמים המזהים גני נהיגה פוטנציאליים חדשים לסרטן. בעזרת מידע זה, מחקרים מכוונים ניתן לבצע כדי להבין את תפקידם של מוטציות אלה רומן. באופן כללי, השימוש בטכניקה זו עשויה להוביל לעיצוב הסופי של טיפולים התרופתיים החדשים שמטרתם לחסל את התוצאות של אלה מוטציות הגנטיות הספציפיותtions.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לי מה לחשוף.

Acknowledgments

המחברים מבקשים להודות לMoriarity Branden, הדוד Largaespada, ווינסנט Keng באוניברסיטת מינסוטה, והאדם Dupuy באוניברסיטה איווה על סיועם בפיתוח הפרוטוקול שתואר לעיל.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
זיהוי<em&gt; יפהפה נרדם</em&gt; הוספות Transposon בגידולים מוצקים באמצעות PCR לינקר בתיווך
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter