Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Identificación de los doi: 10.3791/50156 Published: February 1, 2013

Summary

Un método de identificación de conductores desconocidos de la carcinogénesis utilizando un enfoque imparcial se describe. El método utiliza el

Abstract

Los análisis genómicos, proteómicos, transcriptómica y epigenómico de tumores humanos indican que hay miles de anomalías dentro de cada genoma del cáncer en comparación con el tejido normal correspondiente. Sobre la base de estos análisis es evidente que hay muchos conductores no descubiertos genéticas del cáncer 1. Lamentablemente, estos conductores están ocultos dentro de un número mucho mayor de anomalías de pasajeros en el genoma que no contribuyen directamente a la formación de tumores. Otro aspecto del genoma del cáncer es que hay una considerable heterogeneidad genética dentro de similares tipos de tumores. Cada tumor pueden albergar diferentes mutaciones que proporcionan una ventaja selectiva para la formación de tumor 2. Realización de una pantalla hacia delante imparcial genética en ratones proporciona las herramientas para generar tumores y analizar su composición genética, mientras que la reducción del fondo de mutaciones de pasajeros. La Bella Durmiente (SB) transposón sistema es uno de esos métodos 3. El sistema utiliza SB móvil vectores (transposones) que se pueden insertar en el genoma de la enzima transposasa. Las mutaciones se limitan a un tipo específico de célula mediante el uso de un alelo condicional transposasa que se activa por la recombinasa Cre. Muchas líneas de ratón que expresan existen recombinasa Cre en tejidos específicos. Al cruzar una de estas líneas con el alelo transposasa condicional (por ejemplo, Lox-stop-Lox-SB11), el sistema SB se activa sólo en las células que expresan la recombinasa Cre. La recombinasa Cre extirpará una casete de tope que bloquea la expresión del alelo de la transposasa, activando de este modo mutagénesis de transposones en el tipo de célula designada. Una pantalla SB es iniciada por la cría de tres cepas de ratones transgénicos para que los ratones experimentales llevar un alelo condicional transposasa, un concatémero de transposones, y un alelo específico de tejido de recombinasa Cre. Estos ratones se dejaron envejecer hasta que se forman los tumores y se convierten moribundo. Los ratones son luegoADN genómico practicó la necropsia y se aísla de los tumores. A continuación, el ADN genómico se somete a enlazador mediada-PCR (LM-PCR) que resulta en la amplificación de loci genómicos que contienen un transposón SB. LM-PCR realizada en un solo tumor se traducirá en cientos de amplicones diferentes que representan a los cientos de loci genómicos que contienen inserciones de transposones en un solo tumor 4. Las inserciones de transposones en todos los tumores son analizados y los sitios comunes de inserción (IIC) se identifican usando un método estadístico adecuado 5. Los genes dentro de la CEI es muy probable que sea oncogenes o genes supresores de tumores, y se consideran los genes candidatos cáncer. Las ventajas de utilizar el sistema de SB para identificar genes candidatos cáncer son: 1) el transposón puede ser fácilmente localizado en el genoma, ya que su secuencia es conocida, 2) transposición se puede dirigir a casi cualquier tipo de célula y 3) el transposón es capaz de introduciendo al mismo tiempo de ganancia y pérdida de función de las mutaciones 6. El following protocolo describe cómo diseñar y ejecutar una pantalla hacia delante genético utilizando el sistema de transposón SB para identificar genes candidatos cáncer (Figura 1).

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Crianza y Envejecimiento de Animales Transgénicos

  1. Seleccione las cepas de ratones transgénicos apropiados para su experimento. Un experimento típico se utilizan tres líneas transgénicas; una transposasa condicional del ratón, un ratón que alberga un concatémero de transposones, y un ratón que expresan la recombinasa Cre en las células que se cree que las células de origen para el cáncer deseada. Si el cáncer que está siendo modelado tiene una mutación conocida en un gran porcentaje de los pacientes puede ser deseable incluir esta mutación en el inicio. Ejemplos de estos "predisponentes" mutaciones incluyen Kras activados, TP53 dominantes negativos o un alelo Pten floxed. Mediante la adición de una mutación que predispone el modelo puede representar mejor el cáncer humano (véase 1.3). Transposasa Varios Bella Durmiente transposón y ratones están disponibles en el Instituto Nacional del Cáncer Ratón Repository ( http://mouse.ncifcrf.gov/ ).
  2. Ratones raza transposasa condicionales con ratones portadores de los transposones de obtener eventualmente ratones homocigotos para ambos alelos si es posible. Raza descendencia homocigota para ratones que expresan la recombinasa Cre para generar sus triples ratones transgénicos experimentales (Figura 2). Nota: La obtención de ratones homocigotos no siempre es posible o ideal. Por ejemplo, p53 negativos ratones homocigotos dominantes son mucho más difíciles de criar que los ratones heterocigotos. Además, es útil para asegurarse de que las camadas seguir la genética mendeliana para confirmar que el método de obtención tiene éxito.
  3. Si se utiliza un fondo predispuesto, ratones primera raza con la transposasa a ratones con el alelo de predisposición. Simultáneamente, los ratones de raza expresar Cre recombinasa a ratones portadores de los transposones. Crear ratones homocigotos para cada alelo, si es posible. Por último, criar la descendencia homocigota de los planes de mejoramiento dos anteriores para generar anim cuádruple transgénico experimentalals.
  4. Además de los animales de experimentación, generar cohortes de control de ratones. El grupo de control normalmente consta de camada de la cría experimental que sólo heredan dos de los tres alelos (Figura 2). En el caso de un fondo predispuesto, ratones, incluyendo tres de los cuatro alelos también será necesario.
  5. Monitorear los ratones experimentales y de control al día durante el desarrollo del tumor y / o moribundity. Sigue a tu animal de Atención Institucional y el empleo Comisión (IACUC) requisitos para la cría de animales. Además, es típico para determinar una edad en la que se va a sacrificar a un animal si no se ha convertido aún moribundo. Dieciocho meses es una edad típica en la que los ratones son sacrificados.

2. La necropsia de animales transgénicos

Nombre del reactivo Empresa Número de catálogo
Sure-Seal Inducción de Cámara Brain Tree Científico EZ-177
Criovial BioExpress C-3355-2
10% formalina tamponada Sigma Aldrich HT501128-4L

Reactivos Tabla 1. Necesario.

  1. Cuando el ratón está moribundo o se ha llegado al final de la vida útil determinada, practicar la eutanasia en animales utilizando un CO 2 cámara siguiendo las directrices de su IACUC. Generalmente, colocar al animal en una cámara de gas limpio, abrir el tanque de gas y ajustar el regulador a leer no más de 5 libras por pulgada cuadrada. Llene lentamente para minimizar la irritación nasal y ocular y la aversión al CO 2. Asegúrese de que el corazón del animal ya no late y no responde cuando se toca los ojos.
  2. Vaporizador exterior de ratón sacrificado con 70% de etanol.
  3. Coloque el ratón sobre una tabla necropsia y asegurar con pasadores de disección. Con unas tijeras und pinzas para abrir ratón y extraer los órganos. La determinación de los órganos que deben recogerse proyecto es dependiente. Sin embargo, se recomienda siempre para recoger el bazo y el hígado como estos órganos a menudo dar importante información sobre por qué el ratón estaba moribundo. También recoger el esternón para el análisis del potencial de médula ósea. Además, siempre es beneficioso para recoger cualquier órgano o tejido que parece anormal.
  4. Tejidos y tumores que están recogidos deben ser dividida en cuatro secciones. Una sección se fija en 10% formalina tamponada durante 18 h seguido por 70% de etanol. Esta sección se puede utilizar para la tinción H & E y / o IHC. Las tres secciones restantes, que son generalmente de 50 a 100 mg de tamaño, son congelaron rápidamente en nitrógeno líquido. Éstos se pueden utilizar para el ADN, el ARN y el aislamiento de proteínas.
  5. Tirar los pañuelos de la canal y el resto según las directrices de IACUC.

3. Aislamiento de ADN genómico de tumores

<Nombre> fuerte del reactivo Empresa Número de catálogo
Proteína solución de precipitación Qiagen 158910
Tampón de lisis celular Qiagen 158906
Proteinasa K Qiagen 158920
RNasa A Qiagen 158924
Tampón TE Promega V6232

Reactivos Tabla 2. Necesario.

  1. Finamente picada congelada la muestra de tumor (50 a 100 mg) utilizando una cuchilla de afeitar limpia.
  2. Place picado tejido en un tubo de microcentrífuga de 1,5 ml y añadir 1 ml de tampón de lisis celular que contiene 5 l de proteinasa K solución (20 mg / ml).
  3. Vortex a fondo.
  4. Incubar en un 55 ° C agitador regulado a 250 rpm durante al menos 4 horas, preferentemente durante la noche.
  5. Añadir 1 l de RNasa A una solución (10 mg / ml) y se invierte el tubo 25 veces.
  6. Incubar a 37 ° C durante 30 min.
  7. Enfriar a temperatura ambiente colocando en hielo durante 3 min.
  8. Añadir 333 l solución de precipitación de proteínas y agitar vigorosamente.
  9. Centrifugar a 14.000 rpm 10 min. Las proteínas deben pellet. Si pellet es muy pequeña, de nuevo vórtice, incubar en hielo durante 5 min, y luego volver a centrifugar.
  10. Vierta el ADN que contiene sobrenadante a un tubo de centrífuga limpio 15 ml.
  11. Añadir un volumen igual de isopropanol 100% y mezclar invirtiendo suavemente 50 veces.
  12. Centrifugar a 3.500 rpm durante 3 min.
  13. Desechar el sobrenadante.
  14. Añadir 1 ml de etanol al 70% y se invierte tubo varias veces para lavar el sedimento.
  15. Transferir el sedimento lavado junto con el etanol a un tubo de microcentrífuga de 1,5 ml.
  16. Centrifugar a 14.000 rpm durante 5 min a 4 ° C.
  17. Se retira etanol y se invierte el tubo se seque al aire (aproximadamente de 5 a 30 min).
  18. Resuspender el ADN pellet en 50 a 500 l de TE dependiendo del tamaño del precipitado de ADN.
  19. Opcional incubación a 37 ° C para resuspender el ADN.
  20. Almacenar a 4 ° C, o -20 ° C para el almacenamiento a largo plazo.

4. Enlazador mediada-PCR genómico utilizando ADN de los tumores

Nombre del reactivo Empresa Número de catálogo
BFAI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute placas de 96 pocillos Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Múltiples microplaca Genie, 120V Scientific Industries, Inc. SI-4000
ADN ligasa de T4 con tampón de ligación 5x Invitrogen 15224-041
BamHI New England Biolabs R0136S
25 mM de dNTPs BioExpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq ADN polimerasa Roche 12032929001
Agarosa Promega V3121
Tampón TAE Promega V4271
Tampón TE Promega V6232
El bromuro de etidio Promega H5041

Reactivos Tabla 3. Necesario.

Secuencias de engarce

BFAI enlazador + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

BFAI enlazador-5 'Phos-TAGTCCCTTAAGCGGAG 3'NH2

"> Enlazador NlaIII + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

NlaIII enlazador-5 '-Phos GTCCCTTAAGCGGAGCC 3'

Primer secuencias

Primaria PCR directo lado derecho (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

Primaria PCR adelante del lado izquierdo (BFAI): Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC

Primaria inversa PCR para el lado de la derecha y la izquierda: Spl Link1 1 GTAATACGACTCACTATAGGGC

Secundario lado derecho de PCR directo: Ejemplo de un código de barras secundario Illumina cebador 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (la de la N representan el código de barras 12 pb, la secuencia en mayúsculas se requieren para la plataforma Illumina, y la secuencia en minúsculas se unirá al transposón.)

Secundaria PCR adelante del lado izquierdo: Ejemplo de un código de barras de segunda Illuminadary 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa cebador (la de la N representan el código de barras 12 pb, la secuencia en mayúsculas se requieren para la plataforma Illumina, y la secuencia en minúsculas se unirá al transposón.)

Secundaria inversa PCR para el lado derecho e izquierdo: conector cebador anidado inversa 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. Recocer el + y - enlazadores para ambos enlazadores bfai y enlazadores NlaII mediante la mezcla de 50 l de enlazador + (100 mM) con 50 l de enlazador-(100 M) y añadir 2 l de NaCl (5 M) en un tubo de microcentrífuga de 1,5 ml. Lugar en 95 ° C del bloque de calor durante 5 min. Apagar bloque de calentamiento y dejar enfriar lentamente a temperatura ambiente (esto tarda una hora o más). Después de enfriar, los enlazadores recocidas puede ser almacenado en un congelador a -20 ° C hasta que se necesite.
  2. Preparar dos alícuotas de la ADN del tumor, cada parte alícuota que contenía 1 mg de ADN. Una alícuota será digerido ingenioha enzima de restricción que corte cerca de la "derecha" fin del transposón. La segunda alícuota se digiere con una enzima de restricción que corta cerca de la "izquierda" fin del transposón. Esto se hace para maximizar las posibilidades de amplificar cada sitio de inserción del transposón.
  3. Digerir el ADN del tumor en una alícuota con el "derecho" NlaII enzima lado, y digerir el ADN del tumor en la parte alícuota que utilice el lado "izquierdo" enzima BFAI: mezcle 1 l de enzima, 5 l Buffer 10x NEB # 4, ADN ( 1 g) y ddH 2 O hasta un volumen total de 50 l. Digerir el ADN durante la noche a 37 ° C en baño de agua o incubadora.
  4. Calentar inactivar enzimas (BFAI = 80 ° C durante 20 min, NlaIII = 65 ° C durante 20 min).
  5. Limpiar las muestras digeridas por la colocación de muestras en MinElute placa de 96 pocillos, en lugar placa de colector de vacío y el vacío durante aproximadamente 15 min hasta que los pozos aspecto seco.
  6. Retire la placa del distribuidor de vacío e inferior blot de placa de 96 pocillos con una toalla de papel para eliminar todo liquid
  7. Añadir 30 l ddH 2 O a cada pocillo y agitar en un conjunto agitador orbital a temperatura alta durante 2 min, o pipetear arriba y abajo de 20 a 40 veces.
  8. Traslado volumen total en los pozos (30 l) de MinElute placa de 96 pocillos en placas de 96 pocillos limpios.
  9. Realizar reacciones de ligación enlazador con el ADN digerido de la etapa 4,8 y enlazadores de paso 4,1. Mezclar 10 l de ADN digerido, 4 l tampón de ligación 5x, 5,5 enlazadores mu l recocido (950 g / l), 0,5 l ligasa de T4 (5 U / l).
  10. Incubar durante 4 horas a toda la noche a 16 ° C.
  11. Calentar inactivar la ligasa de ADN de T4 a 65 ° C durante 10 min.
  12. Limpie la ligadura con MinElute placas de 96 pocillos y un colector de vacío como se describe en los pasos 4,5 hasta 4,6.
  13. Resuspender en 30 l H 2 O y traslado a un lugar limpio placa de 96 pocillos.
  14. Realizar una segunda digestión del ADN con el fin de destruir restos concatémero transposones. Esto se consigue cortando el DNA una segunda vez usando una enzima que corta el plásmido vector ADN que se utilizó para crear los ratones transgénicos que contienen el transposón concatémero.
  15. Digerir el ADN utilizando BamHI (lado izquierdo y derecho): Mezcla de 25 l de enlazador-ligated ADN de paso 4,13, 5 l tampón NEB 10x # 3, 0,5 l BamHI (20 U / l), 0,5 l de BSA (10 mg / ml ) y 19 l ddH 2 O.
  16. Recopilación de 3-6 horas o durante la noche a 37 ° C.
  17. Realizar primaria PCR utilizando un cebador específico para el transposón y un cebador específico para el enlazador. Estos pueden variar dependiendo de lo que transposón y el enlazador está utilizando. Los cebadores enumerados en la tabla por encima de cebador de trabajo para el T2/Onc y transposones T2/Onc2.
  18. PCR primaria: 5 l tampón 10x, 2,0 l de MgCl2 (50 mM), 4 dNTPs mu l (2,5 nM), 1 l Cebador 1 (20 mM), 1 l Cebador 2 (20 mM), 0,25 l Platinum Taq (5 U / l), 3 l de ADN digerido con enlazadores (cantidad puede variar), hasta 50 l ddH 2 O.
  19. Programa de PCR: 94 ° C durante 5 min, 30 ciclos de 94 ° C por 30 seg, 60 y dpor ejemplo, C por 30 seg, 72 ° C durante 90 sec. Extensión final a 72 ° C durante 5 min.
  20. Limpiar producto de PCR usando MinElute placas de 96 pocillos y un colector de vacío como se describió anteriormente.
  21. Resuspender en 30 l H 2 O y traslado a un lugar limpio placa de 96 pocillos.
  22. Hacer una dilución 1:75 de la 1 ° PCR mediante la dilución de 2 l de ADN de la etapa 148 en 4,21 l ddH O 2
  23. Realizar PCR secundaria utilizando versiones de los cebadores anidados que también tienen la secuencia requerida para la máquina Illumina GAIIx así como un código de barras de base 12 par que es única para cada muestra de tumor de procesado (véase la tabla anterior cebador para ejemplos de estos cebadores).
  24. PCR secundaria: 10 l Tampón 10x con MgCl2, 8 mu l dNTPs (2,5 mM), 1 l Illumina código de barras cebador secundario (20 mM), 1 Nest Illumina 1 l cebador secundario (20 mM), 0,25 l de Taq FastStart (5 U / l ), 2 l de ADN primarios 1:75 PCR diluido, hasta 100 l ddH 2 O.
  25. Programa de PCR: 94 °; C durante 2 min, 30 ciclos de 94 ° C durante 30 s, 53 ° C durante 45 segundos, 72 ° C durante 90 segundos. Extensión final a 72 ° C durante 5 min.
  26. Ejecutar 45 l de esta reacción de PCR en un gel de agarosa al 1% que contiene bromuro de etidio (0,5 mg / ml). Debe haber una "mancha" de los productos de PCR que representan a los amplicones de inserciones de transposones muchos diferentes en el tumor (Figura 3).
  27. Limpiar restante 50 l de producto de PCR utilizando MinElute placas de 96 pocillos y un colector de vacío como se describió anteriormente. Lavar una vez utilizando 50 l ddH 2 O en los pocillos y aspirar de nuevo.
  28. Resuspender en 30 l de TE y transferir a una placa de 96 pocillos limpia.
  29. Determinar la concentración de ADN en cada muestra. Combinar cantidades iguales de ADN en un solo tubo de microcentrífuga de 1,5 ml. Esta será la biblioteca que se secuenciaron en un solo carril de una máquina Illumina HiSeq 2000. Es posible secuencia de varios cientos de tumores en un solo carril de una ejecución de Illumina.
  30. Presentarel único tubo que contiene cantidades iguales de ADN de todos los tumores para la secuenciación. Esto se puede hacer por su institución o comercialmente.

5. Análisis de inserciones de transposones

  1. Software para el análisis de transposón inserción de datos está disponible para su descarga gratuita a través de SourceForge ( http://sourceforge.net/projects/tapdancebio/ ). El programa, llamado Tapdance, requiere que el archivo de secuencia de la plataforma Illumina y un código de barras a un archivo de texto plano biblioteca.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Después de que el método de obtención se ha establecido, los criadores deben producir una camada cada 19-21 días. Tamaño de la camada puede variar entre 5 y 12 crías, dependiendo de la edad de los criadores y el fondo genético. Además, asegúrese de que el genotipo de la camada siguiente genética mendeliana como una manera de confirmar que el método de obtención es a la vez correcta y exitosa.

Para el experimento para tener éxito, la incidencia de tumores en los animales experimentales debe ser significativamente mayor que la incidencia de tumores en los animales de control. Si no "predisposición" mutación se incluyó en el experimento debe haber pocas o ninguna tumores en los animales de control. Si una "predisposición" mutación se incluyó en el experimento, la incidencia de tumores en estos animales debe ser mucho menor que la incidencia en los animales con la mutación y la actividad SB.

LM-PCR debe amplificar cientos de transposón inserciones en un solo tumor. Después de ejecutar haSi de la secundaria producto de PCR en un gel de 1%, no debe haber una "mancha" de ADN que representa esta amplificación (Figura 3). Si hay sólo una o dos bandas, ya sea SB no era activo en el tumor o se cometió un error en el protocolo (Figura 4).

Secuenciación 1-200 tumores en un solo carril de la plataforma Illumina GAIIx debe producir más de 30 millones de secuencias de 100 pb cada una (Figura 5).

Reactivos Tabla 1. Requerido para la sección 2.

Reactivos Tabla 2. Necesario para la sección 3.

Reactivos Tabla 3. Requerida para la sección 4.

Figura 1
Figura 1. Diagrama de flujo que muestra los pasospara llevar a cabo una pantalla hacia delante genético utilizando el sistema Sleeping Beauty. Primero, un modelo de ratón se genera. Los ratones se someterán a autopsia entonces moribundo y los tumores se recogieron y se aisló. ADN del tumor se purifica y se realiza enlazador mediada por PCR. Finalmente, el ADN amplificado tumor con inserciones de transposones se secuenciaron y se identificaron los sitios comunes de inserción.

Figura 2
Figura 2. Método de obtención de generar cohorte experimental. Los ratones que contienen la transposasa (Rosa26-LSL-SB11) se cruzan con los ratones portadores de la concatémero de transposones (T2-Onc). La descendencia después se aparearon con ratones que llevan el promotor específico de tejido designado impulsada Cre recombinasa (Cre).

Figura 3
Figura 3. Representanteresultados de PCR secundaria. El producto esperado tiene un frotis apariencia varía de 100 a 600 pares de bases.

Figura 4
Figura 4. Si LM-PCR se realiza correctamente, habrá una ausencia de la "mancha" de ADN. En su lugar, verá las bandas definitivas de ADN.

Figura 5
Figura 5. Ejemplo de datos de una ejecución de secuencia que muestra un solo carril de la plataforma Illumina GAIIx debe producir más de 30 millones de secuencias de 100 pares de bases cada uno.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Una pantalla hacia delante genética utilizando la Bella Durmiente transposón sistema proporciona un método para la identificación de las mutaciones que causan cáncer. Mediante la selección del promotor apropiado para controlar la recombinasa Cre en adición a cualquier mutaciones que predisponen, la pantalla SB identificará conocidos y nuevos genes candidatos cáncer.

El éxito de una pantalla SB depende en gran medida de los ratones seleccionados para la creación de la pantalla. Para el transposón, se recomienda el uso de dos diferentes cepas de ratón que llevan la concatémero de transposones oncogénicos en diferentes cromosomas 7. El pensamiento cuidadoso debe utilizarse cuando la elección de la recombinasa Cre específica de tejido que activará la transposasa SB. No debe haber evidencia de que la enzima Cre está activo en el tipo de células que es sospechosa de ser la célula de origen del cáncer que está siendo modelado. Ejemplos exitosos incluyen Villin-Cre (GI tracto cáncer), albúmina Cre-(carcinom hepatocelulara), y Ayuda Cre-(linfoma) 8-10.

El número de ratones necesarios para una pantalla éxito dependerá de la penetrancia tumor. En general, los tumores más y más ratones se traducirá en una pantalla más robusto. Para detectar una diferencia de 2 veces en el cáncer de latencia que debe ser de al menos 60 animales, tanto en los grupos control y experimentales. 11

La naturaleza versátil de estas pantallas es de gran alcance con respecto a otras técnicas en que se puede especificar la naturaleza de la enfermedad, seguir la progresión, y analizar la composición genética. Esta técnica ha tenido éxito en una serie de pantallas que han dado las listas de la CEI que identifican nuevos genes potenciales de manejo del cáncer. Con esta información, los estudios dirigidos puede realizarse para entender la función de estas nuevas mutaciones. En general, el uso de esta técnica puede conducir a la eventual diseño de nuevas terapias farmacéuticas dirigidas a eliminar los resultados de estos específico muta genéticaciones.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Los autores desean agradecer a Moriarity Branden, Largaespada David, y Keng Vicente de la Universidad de Minnesota, y Dupuy Adán en la Universidad de Iowa por su ayuda en el desarrollo del protocolo descrito anteriormente.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
Identificación de los<em&gt; La Bella Durmiente</em&gt; Transposón inserciones en tumores sólidos utilizando vinculador mediada por PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter