Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Identificatie van doi: 10.3791/50156 Published: February 1, 2013

Summary

Werkwijze voor het identificeren van onbekende oorzaken van kanker met een objectieve benadering beschreven. De methode maakt gebruik van de

Abstract

Genomic, proteomics, transcriptoom, en epigenomisch analyses van menselijke tumoren aan te geven dat er duizenden van afwijkingen binnen elke kanker genoom in vergelijking met geëvenaard normaal weefsel. Op basis van deze analyses is het duidelijk dat er vele onbekende genetische oorzaken van kanker 1. Helaas zijn deze drivers zijn verborgen in een veel groter aantal passagiers afwijkingen in het genoom die niet direct bijdragen aan de vorming van tumoren. Een ander aspect van de kanker genoom dat er een aanzienlijke genetische heterogeniteit binnen soortgelijke tumortypen. Elke tumor kan haven verschillende mutaties die een selectief voordeel voor tumorvorming 2 verzoekt. Het uitvoeren van een onpartijdige vooruit genetische screen in muizen biedt de tools om tumoren te genereren en analyseren van hun genetische samenstelling, terwijl het verminderen van de achtergrond van de passagier mutaties. The Sleeping Beauty (SB) transposon systeem is een dergelijke methode 3. Het SB systeem maakt gebruik van mobiele vEctors (transposons) die het gehele genoom worden ingebracht door de transposase enzym. Mutaties zijn beperkt tot een specifiek celtype door het gebruik van een voorwaardelijke transposase allel dat wordt geactiveerd door Cre recombinase. Veel muis lijnen bestaan ​​die uitdrukkelijke Cre-recombinase in specifieke weefsels. Door kruising van een van deze lijnen de voorwaardelijke transposase allel (bijvoorbeeld Lox-stop-Lox-SB11) wordt de SB systeem alleen geactiveerd in cellen die Cre recombinase. Het Cre-recombinase zal accijnzen een stop cassette dat blokkeert de expressie van het transposase allel, waardoor het activeren van transposon mutagenese binnen het aangewezen celtype. Een SB scherm wordt geïnitieerd door drie stammen fokken van transgene muizen, zodat de experimentele muizen dragen een voorwaardelijke transposase allel een concatamer van transposons en een weefsel-specifieke Cre recombinase allel. Deze muizen mogen leeftijd tot tumoren vorm en ze worden ten dode opgeschreven. De muizen worden vervolgenssterven en genomisch DNA wordt geïsoleerd uit de tumoren. Vervolgens wordt het genomische DNA onderworpen aan linker-gemedieerde PCR (LM-PCR) die resulteert in amplificatie van genomische loci die een transposon SB. LM-PCR uitgevoerd op een tumor zal resulteren in honderden verschillende amplicons die de honderden genomische loci die transposon inserties in een tumor 4. Het transposon inserties in alle tumoren worden geanalyseerd en gemeenschappelijke insteekopeningen (CISS) geïdentificeerd met behulp van een geschikte statistische methode 5. Genen binnen de CIS zeer waarschijnlijk oncogenen of tumor suppressor genen, en worden beschouwd als kandidaat kankergenen. De voordelen van het systeem SB kandidaat kanker genen te identificeren zijn: 1) het transposon gemakkelijk kan worden gelokaliseerd in het genoom omdat de sequentie bekend is, 2) de omzetting kan worden gericht op bijna elk celtype en 3) het transposon kan introductie van zowel de winst-en verlies-van-functie mutaties 6. De following protocol wordt beschreven hoe u bedenken en uitvoeren van een voorwaartse genetische screen gebruik van de SB transposon systeem voor kandidaat-kanker genen (Figuur 1) te identificeren.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Veredeling en Aging van transgene dieren

  1. Selecteer de stammen van transgene muizen geschikt is voor uw experiment. Een typisch experiment zullen drie transgene lijnen, een voorwaardelijke transposase muis, een muis herbergt een concatamer van transposons en een muis expressie Cre Recombinase in de cellen beschouwd als de cellen van oorsprong voor de gewenste kanker. Als de kanker wordt gemodelleerd met een bekende mutatie in een groot percentage van de patiënten kan het wenselijk zijn om deze mutatie bij aanvang nemen. Voorbeelden van deze "predisponerende" mutaties omvatten geactiveerd Kras, dominant negatieve TP53 of een floxed PTEN allel. Door het toevoegen van een predisponerende mutatie van het model kan beter vertegenwoordigen de kanker bij de mens (zie 1.3). Verschillende Doornroosje transposase en transposon muizen zijn verkrijgbaar bij het ​​National Cancer Institute Mouse Repository ( http://mouse.ncifcrf.gov/ ).
  2. Breed voorwaardelijke transposase muizen met muizen die de transposons uiteindelijk verkrijgen muizen die homozygoot zijn voor beide allelen indien mogelijk. Breed homozygote nageslacht Recombinase Cre muizen die om triple transgene experimentele muizen (Figuur 2) genereren. Opmerking: Het verkrijgen van homozygote muizen niet altijd mogelijk of ideaal. Bijvoorbeeld homozygoot dominante negatieve p53 muizen veel moeilijker te fokken dan heterozygote muizen. Bovendien is het nuttig om te zorgen dat nesten Mendeliaanse genetica volgt te bevestigen dat de kweekschema succesvol is.
  3. Bij gebruik van een gepredisponeerd achtergrond eerste ras muizen met de transposase aan muizen met predisponerende allel. Tegelijkertijd breed Recombinase Cre muizen die met muizen die de transposons. Maak homozygote muizen voor elk allel indien mogelijk. Tot slot, fokken de homozygote nakomelingen van de vorige twee fokprogramma's te verviervoudigen transgene experimentele anim genererenALS.
  4. Naast de proefdieren genereren cohorten controle muizen. De controlegroep bestaat doorgaans uit nestgenoten van proeffokstation dat slechts erven twee van de drie allelen (figuur 2). Bij een gepredisponeerd achtergrond zal muizen, inclusief drie van de vier allelen ook nodig.
  5. Monitor experimentele en controle muizen dagelijks voor de ontwikkeling van tumoren en / of moribundity. Volg je de institutionele dierlijke zorg en gebruik comite (IACUC) eisen voor de veehouderij. Ook is het typisch om te bepalen een leeftijd waarin u een dier te offeren als het is nog niet ten dode opgeschreven. Achttien maanden is een typische leeftijd waarop muizen geëuthanaseerd.

2. Autopsie van transgene dieren

Naam van het reagens Vennootschap Catalogusnummer
Sure-Seal Inductie Kamer Brain Tree Wetenschappelijke EZ-177
Cryovial Bioexpress C-3355-2
10% gebufferde formaline Sigma Aldrich HT501128-4L

Tabel 1. Reagentia nodig.

  1. Wanneer een muis stervende is of het einde van de bepaalde levensduur, euthanaseren dier met een CO 2 kamer na uw IACUC richtlijnen. In het algemeen, plaats het dier in een schone gaskamer, opent u de gastank en stel de regelaar op niet hoger dan 5 pond lezen per vierkante inch. Vul langzaam naar neus-en oogirritatie en afkeer van CO 2 te beperken. Zorg ervoor dat het dier hart niet meer kloppen en niet reageert bij aanraking in het oog.
  2. Spray buitenkant van opgeofferd muis met 70% ethanol.
  3. Plaats de muis op een autopsie bord en zet vast met ontleden pinnen. Gebruik een schaar eend pincet om de muis te openen en te verwijderen organen. Bepalen welke organen moeten worden verzameld is het project afhankelijk. Het is echter aan te raden om altijd het verzamelen van de milt en de lever als deze organen vaak belangrijk inzicht te geven in de reden waarom de muis was ten dode opgeschreven. Verzamelen ook het borstbeen voor mogelijke analyse van beenmerg. Bovendien is altijd nuttig om elk orgaan of weefsel dat abnormaal lijkt verzamelen.
  4. Weefsels en tumoren die worden verzameld moet worden verdeeld in vier secties. Een deel wordt gefixeerd in 10% gebufferde formaline gedurende 18 uur gevolgd door 70% ethanol. Deze sectie kan worden gebruikt voor H & E kleuring en / of IHC. De overige drie delen, die in het algemeen 50 tot 100 mg omvang, snel bevroren in vloeibare stikstof. Deze kunnen gebruikt worden voor DNA, RNA en eiwit isolatie.
  5. Gooi karkas en de resterende weefsels volgens IACUC richtlijnen.

3. Isoleren Genomisch DNA van tumoren

<strong> Naam van het reagens Vennootschap Catalogusnummer
Protein Precipitation oplossing Qiagen 158910
Cellysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232

Tabel 2. Reagentia nodig.

  1. Fijn gehakt de bevroren tumormonster (50 tot 100 mg) met een schoon scheermesje.
  2. Plaats gehakt weefsel in een 1,5 ml microcentrifuge buis en voeg 1 ml van cel lysis buffer die 5 ul Proteinase K oplossing (20 mg / ml).
  3. Vortex grondig.
  4. Incubeer in een 55 ° C schudinrichting bij 250 rpm ingesteld ten minste 4 uur, bij voorkeur overnacht.
  5. Voeg 1 ul RNase A oplossing (10 mg / ml) en omkeren buis 25 keer.
  6. Incubeer bij 37 ° C gedurende 30 minuten.
  7. Koel af tot kamertemperatuur door op ijs gedurende 3 min.
  8. Voeg 333 ul Eiwit Neerslag oplossing en vortex krachtig.
  9. Centrifugeer bij 14.000 rpm 10 min. Eiwitten moeten pellet. Als pellet is zeer klein, vortex weer, incubeer op ijs gedurende 5 minuten, en probeer dan opnieuw centrifuge.
  10. Giet het supernatans bevattend DNA in een schone centrifugebuis van 15 ml.
  11. Voeg gelijk volume 100% isopropanol en meng voorzichtig omkeren 50 keer.
  12. Centrifugeer bij 3.500 tpm gedurende 3 minuten.
  13. Gooi supernatant.
  14. Voeg 1 ml 70% ethanol en omkeren buis meerdere malen om de pellet te wassen.
  15. Breng de pellet gewassen met ethanol om een ​​1,5 ml microcentrifugebuis.
  16. Centrifugeer bij 14.000 rpm gedurende 5 min bij 4 ° C.
  17. Giet ethanol en zwenken buis aan de lucht drogen (ongeveer 5 tot 30 min).
  18. Resuspendeer DNA pEllet in 50 tot 500 ui TE afhankelijk van de grootte van DNA pellet.
  19. Optioneel incubatie bij 37 ° C te mengen DNA.
  20. Bewaar bij 4 ° C of -20 ° C voor lange termijn opslag.

4. Linker-Mediated PCR gebruikmaking van genomisch DNA van tumoren

Naam van het reagens Vennootschap Catalogusnummer
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute platen met 96 putjes Qiagen 28051
QIAvac 96 Vacuum spruitstuk Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc SI-4000
T4 DNA ligase met 5x ligatiebuffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25 mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE buffer Promega V4271
TE Buffer Promega V6232
Ethidiumbromide Promega H5041

Tabel 3. Reagentia nodig.

Linker Sequences

BfaI linker + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

BfaI linker-5'-Phos TAGTCCCTTAAGCGGAG 3'NH2

"> NlaIII linker + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

NlaIII linker-5'-Phos GTCCCTTAAGCGGAGCC 3 '

Primersequenties

Primaire PCR voren rechterkant (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

Primaire PCR LV opzij (BfaI): Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC

Primaire PCR omgekeerde voor zowel rechts en links: Spl Link1 1 GTAATACGACTCACTATAGGGC

Secundaire PCR forward rechterkant: Voorbeeld van een barcode Illumina secundaire primer 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (The N vertegenwoordigen de 12 bp barcode, sequentie in hoofdletters zijn vereist voor de Illumina platform, en de volgorde kleine letters zullen binden aan het transposon.)

Secundaire PCR LV kant: Voorbeeld van een Illumina barcode Secondary primer 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (The N vertegenwoordigen de 12 bp barcode, sequentie in hoofdletters zijn vereist voor de Illumina platform, en de volgorde kleine letters zullen binden aan het transposon.)

Secundaire PCR omgekeerde voor zowel links en rechts: linker geneste reverse primer 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. Annealen de + en - linkers zowel BfaI linkers en linkers NlaII door mengen 50 ul linker + (100 uM) met 50 ul van linker-(100 uM) en voeg 2 ui NaCl (5 M) in een 1,5 ml microcentrifugebuis. In 95 ° C warmteblok gedurende 5 minuten. Schakel verwarmingsblok en laat langzaam afkoelen tot kamertemperatuur (dit duurt een uur of meer). Na afkoelen kan uitgegloeid linkers worden opgeslagen in een -20 ° C vriezer tot gebruik.
  2. Bereid twee aliquots van de tumor DNA, elk aliquot met 1 ug DNA. Een aliquot wordt gedigereerd witha restrictie-enzym dat in de buurt van de 'juiste' einde van de transposon te snijden. Het tweede aliquot wordt gedigereerd met een restrictie enzym dat knipt op een "links" einde van het transposon. Dit wordt gedaan om de kans te amplificeren elke transposoninsertie site te maximaliseren.
  3. Digest de tumor DNA in een aliquot met behulp van de "juiste" kant enzym NlaII, en verteren de tumor DNA in het andere monster met behulp van de "linker" kant enzym BfaI: combineer 1 pi van het enzym, 5 pi 10x NEB buffer # 4, DNA ( 1 ug) en ddH 2 O tot een totaal volume van 50 ul. Digest DNA overnacht bij 37 ° C in een waterbad of incubator.
  4. Verwarm enzymen te inactiveren (BfaI = 80 ° C gedurende 20 min, NlaIII = 65 ° C gedurende 20 min).
  5. Reinig de verteerde monsters door het plaatsen van monsters in MinElute plaat met 96 putjes, laat de plaat staan ​​in vacuüm manifold en vacuüm gedurende ongeveer 15 min tot bronnen kijken droog.
  6. Verwijder de plaat uit vacuüm spruitstuk en blot bodem van plaat met 96 putjes met een papieren handdoek om alle liqui verwijderend
  7. Voeg 30 ul ddH 2 O aan elk putje en schud op een schudapparaat ingesteld op hoog voor 2 min, of op en neer pipetteren 20 tot 40 keer.
  8. Breng gehele volume in wells (30 ul) van MinElute plaat met 96 putjes in schone platen met 96 putjes.
  9. Voer linker ligatiereacties met gedigereerd DNA uit stap 4.8 en linkers uit stap 4.1. Mix 10 ul gedigereerd DNA, 4 pi 5x ligatiebuffer, 5,5 pl gegloeid linkers (950 pg / pl), 0,5 pi T4 ligase (5 U / pl).
  10. Incubeer gedurende 4 uur tot een nacht bij 16 ° C.
  11. Verwarm het inactiveren T4 DNA ligase bij 65 ° C gedurende 10 minuten.
  12. Opruimen ligatie met MinElute 96 putjes en een vacuüm mondstuk zoals beschreven in stap 4,5 tot 4,6.
  13. Resuspendeer in 30 ul H2O en naar een schone plaat met 96 putjes.
  14. Voer een tweede DNA-vertering om te vernietigen resterende concatamer transposons. Dit wordt bereikt door het snijden van de DNA nogmaals met een enzym dat het plasmide v snijdtector DNA dat werd gebruikt om de transgene muizen die het transposon concatamer maken.
  15. Digest DNA met BamHI (links en rechts): Mix 25 pl linker-geligeerde DNA uit stap 4,13, 5 pl 10x NEB buffer # 3, 0,5 pl BamHI (20 U / ul), 0,5 ui BSA (10 mg / ml ), en 19 ul ddH 2 O.
  16. Digest 3-6 uur of overnacht bij 37 ° C.
  17. Voer primaire PCR met een primer specifiek voor de transposon en een primer specifiek voor de linker. Deze zullen variëren afhankelijk van wat transposon en linker u gebruikt. De primers die in de bovenstaande tabel primer werk voor de T2/Onc en T2/Onc2 transposons.
  18. Primaire PCR: 5 pl 10x buffer, 2,0 pl MgCl2 (50 mM), 4 pi dNTPs (2,5 nM), 1 pi Primer 1 (20 uM), 1 pi Primer 2 (20 uM), 0,25 pl Platinum Taq (5 U / ul), 3 pl gedigesteerd DNA met linkers (bedrag kan variëren) tot 50 pi ddH 2 O.
  19. PCR programma: 94 ° C gedurende 5 min, 30 cycli van 94 ° C gedurende 30 sec, 60 & deg; C gedurende 30 sec, 72 ° C gedurende 90 sec. Laatste verlenging bij 72 ° C gedurende 5 minuten.
  20. Opruimen PCR product met MinElute 96 putjes en een vacuüm mondstuk zoals hierboven beschreven.
  21. Resuspendeer in 30 ul H2O en naar een schone plaat met 96 putjes.
  22. Maak een 1:75 verdunning van de 1 ° PCR door verdunning 2 pl DNA uit stap in 148 ui 4,21 ddH 2 O
  23. Voert secundaire PCR met geneste versies van de primers die ook de vereiste volgorde voor de Illumina GAIIx machine en een 12 base paar barcode die uniek is voor elk tumormonster verwerkt (zie primer bovenstaande tabel voorbeelden van deze primers).
  24. Secundaire PCR: 10 pl 10x buffer met MgCl2, 8 pi dNTPs (2,5 mM), 1 gl Illumina barcode secundaire primer (20 uM), 1 pi Illumina Nest 1 tweede primer (20 uM), 0,25 pi FastStart Taq (5 U / pl ), 2 pi DNA van primaire PCR verdund 1:75 tot 100 pl ddH 2 O.
  25. PCR programma: 94 °; C gedurende 2 min, 30 cycli van 94 ° C gedurende 30 sec, 53 ° C gedurende 45 sec, 72 ° C gedurende 90 sec. Laatste verlenging bij 72 ° C gedurende 5 minuten.
  26. Run 45 pi van deze PCR-reactie op een 1% agarose gel die ethidiumbromide (0,5 ug / ml). Er zou een "smear" van PCR producten die amplicons van de vele transposon inserties in de tumor (Figuur 3).
  27. Opruimen resterende 50 pl PCR product met MinElute 96 putjes en een vacuüm mondstuk zoals hierboven beschreven. Was een keer door het plaatsen van 50 ul ddH 2 O in de putten en stofzuigen weer.
  28. Resuspendeer in 30 ul TE en naar een schone plaat met 96 putjes.
  29. De concentratie van DNA in elk monster. Combineer gelijke hoeveelheden DNA in een 1,5 ml microfugebuis. Dit zal de bibliotheek die wordt afgewisseld met een enkele rijstrook van een Illumina HiSeq 2000 machine. Het is mogelijk om honderden sequentie tumoren in een laan van een Illumina run.
  30. Voorleggende interne buis met gelijke hoeveelheden DNA van alle tumoren sequencing. Dit kan gedaan worden door uw instelling of commercieel.

5. Analyse van Transposon Insertions

  1. Software voor het analyseren van transposon insertie gegevens is beschikbaar als gratis download via SourceForge ( http://sourceforge.net/projects/tapdancebio/ ). Het programma, genaamd tapdance, vereist de volgorde bestand van de Illumina platform en een barcode voor bibliotheek kaart tekstbestand.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Na de kweek regeling is vastgesteld, moet kwekers produceren een nestje elke negentien-eenëntwintig dagen. Worpgrootte varieert tussen 5 en 12 pups, afhankelijk van de leeftijd van de kwekers en de genetische achtergrond. Bovendien, zorg ervoor dat het genotype van het nest Mendeliaanse genetica volgt als een manier om te bevestigen dat het fokken regeling is zowel correct en succesvol.

Voor het experiment slagen, moet tumorincidentie in de proefdieren significant groter zijn dan tumorincidentie in de controledieren. Als er geen "predisponerende" mutatie is opgenomen in het experiment moet er weinig tot geen tumoren in de controledieren. Als een "predisponerende" mutatie in het experiment moeten tumorincidentie in deze dieren veel lager dan de incidentie in dieren met de mutatie en SB activiteit.

LM-PCR te amplificeren honderden transposon inserties in een tumor. Na het uitvoeren van haAls de secundaire PCR product op een 1% gel, moet er een "smear" van DNA die deze amplificatie (Figuur 3). Als er slechts een of twee banden, ofwel SB niet actief was in de tumor of een fout is gemaakt in het protocol (figuur 4).

Sequencing één-tweehonderd tumoren in een laan van de Illumina GAIIx platform moeten produceren meer dan 30 miljoen sequenties van 100 bp elk (figuur 5).

Tabel 1. Reagentia die nodig zijn voor sectie 2.

Tabel 2. Reagentia die nodig is voor deel 3.

Tabel 3. Reagentia die nodig zijn voor hoofdstuk 4.

Figuur 1
Figuur 1. Stroomschema dat de stappenvoor het uitvoeren van een voorwaartse genetische scherm met behulp van de Schone Slaapster systeem. Eerst wordt een muismodel gegenereerd. Muizen worden dan necropsie ze stervend waren en tumoren worden verzameld en geïsoleerd. Tumor DNA wordt gezuiverd en linker gemedieerde PCR uitgevoerd. Tenslotte wordt geamplificeerd tumor DNA met inserties transposon sequentie en gemeenschappelijke insertieplaatsen geïdentificeerd.

Figuur 2
Figuur 2. Breeding regeling experimentele cohort genereren. Muizen die het transposase (Rosa26-LSL-SB11) zijn gekruist met muizen die de concatamer van transposons (T2-Onc). De nakomelingen worden vervolgens gekoppeld aan muizen die de aangewezen weefsel-specifieke promotor gedreven Cre-recombinase (Cre).

Figuur 3
Figuur 3. VertegenwoordigerSecundaire resultaten van PCR. Het verwachte product heeft een uitstrijkje als verschijning van 100 tot 600 BASE paren.

Figuur 4
Figuur 4. Als LM-PCR is mislukt, zal er een afwezigheid van de "smear" van DNA. In plaats daarvan ziet u de definitieve bands van DNA.

Figuur 5
Figuur 5. Voorbeeld van gegevens van een sequencing run dat een enkele rijstrook van de Illumina GAIIx platform toont moeten produceren meer dan 30 miljoen sequenties van 100 basenparen per stuk.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Een voorwaartse genetische scherm met behulp van de Sleeping Beauty transposon systeem biedt een methode voor het identificeren van mutaties die kanker veroorzaken. Door de juiste promotor Cre recombinase controle naast eventuele predisponerende mutaties zal de SB scherm identificeren bekende en nieuwe kandidaat kankergenen.

Het succes van een SB scherm is grotendeels afhankelijk van de geselecteerde muizen voor het maken van het scherm. Voor het transposon, raden wij u aan twee verschillende muizenstammen dragen van de concatamer van oncogene transposons op verschillende chromosomen 7. Je moet goed nadenken worden gebruikt bij de keuze van de weefsel-specifieke Cre-recombinase dat de SB transposase zal activeren. Het dient duidelijk dat het Cre-enzym is actief in het celtype dat ervan verdacht wordt de cel van oorsprong van de kanker wordt gemodelleerd worden. Succesvolle voorbeelden zijn villin-Cre (maag-darmkanaal kanker), albumine-Cre (hepatocellulair carcinoma), en hulp-Cre (lymfoom). 8 tot 10

Het aantal muizen nodig voor een succesvolle scherm afhangen van de tumor penetrantie. In het algemeen zal meer tumoren en muizen resulteert in een meer robuuste scherm. Een 2-voudig verschil in latentie kanker sporen er ten minste 60 dieren in zowel de controle-en experimentele groepen 11.

De veelzijdige aard van deze schermen is krachtig ten opzichte van andere technieken in dat men de aard van de ziekte geeft, de progressie en analyseren van de genetische samenstelling. Deze techniek is succesvol geweest in een aantal schermen die hebben opgeleverd CIS lijsten die nieuwe potentiële kanker rijden genen te identificeren. Met deze informatie kan gerichte studies worden uitgevoerd om de functie van deze nieuwe mutaties begrijpen. Algemeen kan het gebruik van deze techniek tot het uiteindelijke ontwerp van nieuwe geneesmiddelen als doel de resultaten van deze specifieke genetische muta eliminerengen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De auteurs willen graag Branden Moriarity, David Largaespada, en Vincent Keng dank aan de Universiteit van Minnesota, en Adam Dupuy aan de Universiteit van Iowa voor hun hulp bij de ontwikkeling van het hierboven beschreven protocol.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
Identificatie van<em&gt; Sleeping Beauty</em&gt; Transposon inserties in vaste tumoren met Linker-gemedieerde PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter