Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Identifizierung von doi: 10.3791/50156 Published: February 1, 2013

Summary

Verfahren zur Identifizierung unbekannter Fahrer von Karzinogenese Verwendung eines unvoreingenommene Ansatz beschrieben. Das Verfahren verwendet das

Abstract

Genomik, Proteomik, Transkriptom und epigenomischen Analysen von menschlichen Tumoren zeigen, dass es Tausende von Anomalien innerhalb der einzelnen Krebs-Genom im Vergleich zum angepassten normalem Gewebe. Basierend auf diesen Untersuchungen ist es offensichtlich, dass es viele unentdeckte genetischen Fahrer von Krebs ein. Leider sind diese Treiber sind in einer viel größeren Anzahl von Personen Anomalien im Genom, die nicht direkt zur Tumorbildung beitragen versteckt. Ein weiterer Aspekt der Krebsgenoms ist, dass es erhebliche genetische Heterogenität innerhalb ähnlicher Tumorarten. Jeder Tumor kann beherbergen verschiedene Mutationen, die einen selektiven Vorteil für die Tumorbildung 2 bereitzustellen. Durchführen eines unvoreingenommene vorne genetischen Screen bei Mäusen liefert die Werkzeuge, um Tumore zu generieren und zu analysieren, ihre genetische Zusammensetzung, bei gleichzeitiger Reduzierung der Hintergrund der Passagier Mutationen. The Sleeping Beauty (SB) Transposonsystem ist eine solche Methode 3. Das SB-System nutzt mobilen vektoren (Transposons), die über das Genom von der Transposase-Enzym eingesetzt werden kann. Mutationen werden auf einen bestimmten Zelltyp durch die Verwendung eines bedingten Transposase-Allel, die durch Cre-Rekombinase aktiviert ist begrenzt. Viele Mauslinien bestehen, dass ausdrückliche Cre-Rekombinase in bestimmten Geweben. Durch die Kreuzung eine dieser Leitungen zu dem bedingten Transposase Allels (zB Lox-Stop-Lox-SB11) wird der SB-System nur in Zellen, die Cre-Rekombinase ausdrückliche aktiviert. Die Cre-Rekombinase wird verbrauchsteuerpflichtigen einen Anschlag Kassette dass Blöcke Expression der Transposase-Allel und aktiviert damit Transposon-Mutagenese innerhalb der bezeichneten Zelltyp. Ein SB-Bildschirm wird durch Züchtung drei Stämmen von transgenen Mäusen eingeleitet, so dass die experimentelle Mäuse eine bedingte Transposase-Allel, ein Konkatamer von Transposons, und einen Gewebe-spezifischen Rekombinase Cre-Allel tragen. Diese Mäuse sind auf das Alter, bis die Tumoren Form erlaubt und werden sie verenden. Die Mäuse werden dannseziert und genomische DNA wird aus den Tumoren isoliert. Als nächstes wird die genomische DNA-Linker-vermittelten-PCR unterzogen (LM-PCR), die zu Amplifikation von genomischen Loci, die ein Transposon SB. LM-PCR durchgeführt auf einem einzigen Tumor in Hunderten von verschiedenen Amplikons, die die Hunderte von genomischen Loci mit Transposon-Insertionen in einem Tumor 4 führen. Die Transposon-Insertionen in allen Tumoren analysiert und gemeinsame Insertionsstellen (CISS) identifiziert werden unter Verwendung eines geeigneten statistischen Methode 5. Gene innerhalb der GUS sind sehr wahrscheinlich Onkogene oder Tumor-Suppressor-Gene, und gelten als Kandidaten Krebsgene. Die Vorteile der Verwendung des Systems, um Kandidaten SB Krebsgene identifiziert sind: 1) das Transposon kann leicht im Genom lokalisiert werden, weil seine Sequenz bekannt ist, 2) die Umsetzung kann auf nahezu jeden Zelltyp gerichtet sein und 3) das Transposon in der Lage ist Einführung sowohl Gewinn-und Verlust-of-function Mutationen 6. Die following Protokoll beschreibt, wie die Entwicklung und Umsetzung eine vorausschauende genetische Bildschirm mit dem SB Transposon System Kandidaten Krebsgene (Abbildung 1) zu identifizieren.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ein. Zucht und Altern von transgenen Tieren

  1. Wählen Sie die Stämme von transgenen Mäusen für Ihre Experiment. Ein typisches Experiment werden drei transgenen Linien; ein bedingter Transposase Maus, eine Maus beherbergen ein Konkatamer von Transposons, und eine Maus die Cre-Rekombinase in den Zellen vermutlich die Zellen des Ursprungs für die gewünschte Krebs. Wenn sich der Krebs zu modellierenden weist eine bekannte Mutation in einem großen Prozentsatz der Patienten kann es erwünscht sein, diese Mutation zu Beginn umfassen. Beispiele für diese "prädisponierenden" Mutationen sind aktiviert Kras, dominant negative TP53 oder eine floxed Pten Allel. Durch die Zugabe in einer prädisponierenden Mutation kann das Modell besser repräsentieren die menschliche Krebs (siehe 1.3). Mehrere Sleeping Beauty Transposase und Transposon-Mäuse sind von der National Cancer Institute Maus Repository (verfügbar http://mouse.ncifcrf.gov/ ).
  2. Breed bedingte Transposase Mäuse mit Mäusen beherbergt die Transposons, um schließlich zu erhalten Mäusen homozygot für beide Allele, wenn möglich. Breed homozygote Nachkommen zu Mäusen, die Cre-Rekombinase Ihre dreifach transgene Versuchsmäusen (Abbildung 2) zu erzeugen. Hinweis: Beziehen homozygote Mäuse sind nicht immer möglich oder ideal. Beispielsweise sind homozygot p53 dominant negative Mäusen viel schwieriger als heterozygote Mäuse zu züchten. Darüber hinaus ist es hilfreich, um sicherzustellen, dass Würfe Mendelschen Genetik folgen, um zu bestätigen, dass die Züchtungsschema erfolgreich ist.
  3. Bei Verwendung einer Prädisposition Hintergrund, erste Rasse Mäuse mit der Transposase an Mäusen mit dem prädisponierende Allel. Gleichzeitig Ausdruck Rasse Mäusen Cre-Rekombinase, um Mäuse, die Transposons. Erstellen homozygote Mäuse für jedes Allel, wenn möglich. Schließlich züchten die homozygote Nachkommen aus den beiden vorangegangenen Zuchtprogramme zu vervierfachen transgenen experimentellen anim erzeugenALS.
  4. Neben den Versuchstieren, erzeugen Kontrollkohorten von Mäusen. Die Kontrollgruppe besteht normalerweise aus Wurfgeschwistern aus dem experimentellen Zucht, die nur erben zwei der drei Allele (Abbildung 2). Im Falle eines prädisponiert Hintergrund wird Mäusen einschließlich drei der vier Allele auch notwendig sein.
  5. Überwachen Versuchs-und Kontrollmäusen täglich für Tumor-Entwicklung und / oder Siechtum. Folgen Sie Ihrem institutionelle Pflege der Tiere und die Nutzung Ausschuss (IACUC) Anforderungen für die Tierhaltung. Auch ist es üblich, ein Alter, in dem man ein Tier zu opfern, wenn es nicht noch geworden moribund bestimmen. Achtzehn Monate ist ein typisches Alter, in dem Mäuse eingeschläfert.

2. Necropsy transgener Tiere

Name des Reagenzes Firma Katalog-Nummer
Sure-Seal Induction Kammer Gehirn-Baum Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% gepuffertem Formalin Sigma Aldrich HT501128-4L

Tabelle 1. Reagenzien benötigt.

  1. Wenn eine Maus moribund ist oder hat das Ende des ermittelten Lebensdauer, einschläfern Tier mit einem CO 2-Kammer nach Ihrer IACUC Richtlinien. Generell stellen das Tier in einer Reingaskammer, öffnen Sie den Gastank und stellen Sie den Regler auf nicht höher als 5 Pfund pro Quadratzoll zu lesen. Füllen Sie langsam auf Nasen-und Augenreizungen und Abneigung gegen CO 2 zu minimieren. Stellen Sie sicher, dass das Tier das Herz nicht mehr schlagen und reagiert nicht, wenn in den Augen berührt.
  2. Spray Äußeren geopfert Maus mit 70% Ethanol.
  3. Bewegen Sie die Maus auf einer Autopsie Bord und befestigen Sie sie mit Sezieren Pins. Mit einer Schere eind Pinzette zu öffnen Maus und Organe entnehmen. Die Festlegung, welche Organe sollten gesammelt werden ist ein Projekt abhängig. Es wird jedoch empfohlen, immer sammeln die Milz und Leber als diese Organe geben oft wichtige Einblick, warum die Maus war moribund. Sammeln Sie auch das Brustbein zur Potenzialanalyse von Knochenmark. Darüber hinaus ist es immer günstig für jedes Organ oder Gewebe, das abnormale erscheint sammeln.
  4. Geweben und Tumoren, die gesammelt werden sollte in vier Abschnitte unterteilt werden. Ein Abschnitt wird in 10% gepuffertem Formalin für 18 Stunden um 70% Ethanol. Dieser Abschnitt kann für H & E-Färbung und / oder IHC eingesetzt werden. Die verbleibenden drei Abschnitten, die im allgemeinen 50 bis 100 mg in der Größe sind Schnappverbindung in flüssigem Stickstoff eingefroren. Diese können für die DNA-, RNA-und Protein-Isolierung verwendet werden.
  5. Entsorgen Karkasse und dem restlichen Gewebe nach IACUC Richtlinien.

3. Isolieren genomischer DNA aus Tumoren

<strong> Name des Reagenzes Firma Katalog-Nummer
Protein Precipitation Lösung Qiagen 158910
Zelllysepuffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE-Puffer Promega V6232

Tabelle 2. Reagenzien benötigt.

  1. Fein zerkleinern das gefrorene Tumorprobe (50 bis 100 mg) mit einem sauberen Rasierklinge.
  2. Ort zerkleinert Gewebe in einem 1,5 ml Mikrozentrifugenröhrchen und 1 ml der Zell-Lyse-Puffer mit 5 ul Proteinase K-Lösung (20 mg / ml).
  3. Vortex gründlich.
  4. Inkubieren in einem 55 ° C Schüttler bei 250 rpm eingestellt für mindestens 4 Stunden, am besten über Nacht.
  5. Fügen Sie 1 ul RNase A-Lösung (10 mg / ml) und invertieren Rohr 25 mal.
  6. Bei 37 ° C für 30 min.
  7. Abkühlen auf Raumtemperatur durch Anordnen auf Eis für 3 min.
  8. Fügen Sie 333 ul Protein Precipitation Lösung und Vortex kräftig.
  9. Zentrifuge bei 14.000 rpm 10 min. Proteine ​​sollten Pellet. Wenn Pellet ist sehr klein, Wirbel wieder auf Eis inkubieren für 5 min und dann re-Zentrifuge.
  10. Giesst Überstand enthaltende DNA in ein sauberes 15-ml-Zentrifugenröhrchen.
  11. Fügen gleichen Volumen 100% Isopropanol und mischen durch vorsichtiges Umdrehen 50 mal.
  12. Zentrifuge bei 3.500 rpm für 3 min.
  13. Überstand verwerfen.
  14. 1 ml 70% Ethanol und invertieren Röhrchen mehrmals um das Pellet zu waschen.
  15. Übertragen des gewaschenen Pellet zusammen mit dem Ethanol zu einem 1,5 ml Mikrozentrifugenröhrchen.
  16. Zentrifugieren bei 14.000 UpM für 5 min bei 4 ° C.
  17. Abgießen Ethanol und invertieren Rohr an der Luft trocknen (ca. 5 bis 30 min).
  18. Resuspendieren DNA pEllet in 50 bis 500 ul TE je nach Größe der DNA-Pellet.
  19. Optional Inkubation bei 37 ° C zu resuspendieren DNA.
  20. Lagerung bei 4 ° C oder -20 ° C für die langfristige Lagerung.

4. Linker Mediated-PCR unter Verwendung von genomischer DNA aus Tumoren

Name des Reagenzes Firma Katalog-Nummer
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute Platten mit 96 Vertiefungen Qiagen 28051
QIAvac 96 Vakuumkammer Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA-Ligase mit 5x Ligationspuffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25 mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE-Puffer Promega V4271
TE-Puffer Promega V6232
Ethidiumbromid Promega H5041

Tabelle 3. Reagenzien benötigt.

Linkersequenzen

BfaI Linker + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

BfaI Linker-5 '-Phos TAGTCCCTTAAGCGGAG 3'NH2

"> Linker NlaIII + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

NlaIII Linker-5 '-Phos GTCCCTTAAGCGGAGCC 3'

Primersequenzen

Primäre PCR vorne rechts (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

Primäre PCR vorne links (bfai): Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC

Primäre PCR Reverse sowohl für links und rechts: Spl Link1 1 GTAATACGACTCACTATAGGGC

Sekundären PCR vorderen rechten Seite: Beispiel einer Illumina strichcodierten sekundären Primer 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (Ns Die Betreiber der 12 bp Barcode-Sequenz in Großbuchstaben sind für die Plattform erforderlich Illumina und die Sequenz in Kleinbuchstaben wird dem Transposon binden.)

Sekundäre PCR vorne links: Beispiel einer Illumina strichcodiert gebrauchtdary Primer 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (Ns Die Betreiber der 12 bp Barcode-Sequenz in Großbuchstaben sind für die Plattform erforderlich Illumina und die Sequenz in Kleinbuchstaben wird dem Transposon binden.)

Sekundäre PCR Reverse sowohl für links und rechts: Linker verschachtelte Rückwärtsprimer 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. Glühen die + und - Linker für beide BfaI Linker und NlaII Linker durch Mischen von 50 ul von Linker + (100 uM) mit 50 ul Linker-(100 uM) und fügen Sie 2 ul NaCl (5 M) in einem 1,5 ml Mikrozentrifugenröhrchen. Place in 95 ° C Heizblock für 5 min. Schalten Sie Heizblock und lassen sich langsam auf Raumtemperatur abkühlen (dies dauert eine Stunde oder mehr). Nach dem Abkühlen kann geglühten Linker in einem -20 ° C-Gefrierschrank gelagert werden, bis sie benötigt.
  2. Bereiten Sie zwei Aliquots der Tumor-DNA, jedes Aliquot mit 1 ug DNA. Ein Aliquot wird wit verdaut werdenha Restriktionsenzym, das in der Nähe des "richtigen" Ende des Transposons geschnitten wird. Das zweite Aliquot wird mit einem Restriktionsenzym, das in der Nähe des "linken" Ende des Transposons schneidet verdaut werden. Dies geschieht, um die Chancen Verstärken jedes Transposon Insertionsstelle maximieren.
  3. Verdauen die Tumor-DNA in einem aliquoten mit der "richtigen" Seite Enzym NlaII und verdauen die Tumor-DNA in der anderen Aliquot mit der "linken" Seite Enzym BfaI: Kombinieren Sie 1 ul Enzym, 5 ul 10x NEB Buffer # 4, DNA ( 1 ug) und ddH 2 O auf ein Gesamtvolumen von 50 ul. Ausgewählte DNA über Nacht bei 37 ° C im Wasserbad oder Inkubator.
  4. Hitzeeinwirkung deaktivieren Enzyme (BfaI = 80 ° C für 20 min, NlaIII = 65 ° C für 20 min).
  5. Reinigen Sie die verdauten Proben, indem Proben in MinElute 96-Well-Platte, schauen Platzteller in Vakuumkammer und Vakuum für ca. 15 min bis zum Brunnen trocken.
  6. Entfernen Platte von Vakuum-Verteiler und blot unteren 96-Well-Platte mit einem Papiertuch, um alle liqui entfernend
  7. Fügen Sie 30 ul ddH 2 O in jede Vertiefung und schütteln auf einem Orbitalschüttler Satz auf hoch für 2 min, oder und Abpipettieren 20 bis 40 mal.
  8. Übertragen gesamte Volumen in Brunnen (30 ul) von MinElute 96-Well-Platte in einen sauberen 96-Well-Platten.
  9. Führen Linkerligation Reaktionen mit verdaute DNA von Schritt 4,8 und Linker von Schritt 4,1. Mix 10 ul verdaute DNA, 4 ul 5x Ligationspuffer 5,5 ul geglüht Linker (950 ug / ul), 0,5 ul T4-Ligase (5 U / ul).
  10. Inkubieren für 4 Stunden bis über Nacht bei 16 ° C.
  11. Erhitzen inaktivieren die T4-DNA-Ligase bei 65 ° C für 10 min.
  12. Clean up Ligation mit MinElute 96-Well-Platten und eine Vakuumkammer wie in den Schritten 4.5 beschrieben - 4,6.
  13. Resuspendieren in 30 ul H 2 O und übertragen auf eine saubere 96-Well-Platte.
  14. Führen Sie eine zweite DNA-Verdau, um zu zerstören verbleibenden Konkatamer Transposons. Dies wird durch das Schneiden der DNA ein zweites Mal unter Verwendung eines Enzyms, das die Plasmid v schneidet erreichtektor DNA, die verwendet werden, um die transgenen Mäuse der das Transposon enthaltenden Konkatamer erstellen.
  15. Ausgewählte DNA mit BamHI (links und rechts): Mix von 25 ul Linker-ligierten DNA aus Schritt 4,13, 5 ul 10x NEB Puffer Nr. 3, 0,5 ul BamHI (20 U / ul), 0,5 ul BSA (10 mg / ml ) und 19 ul ddH 2 O.
  16. Ausgewählte 3-6 Stunden oder über Nacht bei 37 ° C.
  17. Führen primären PCR unter Verwendung eines Primers spezifisch für das Transposon und einem Primer, die spezifisch für den Linker. Diese variieren je nachdem, was Transposon und Linker die Sie verwenden. Die Primer in dem Primer obigen Tabelle für die Arbeit und T2/Onc T2/Onc2 Transposons aufgeführt.
  18. Primäre PCR: 5 ul 10x Puffer, 2,0 ul MgCl2 (50 mM), 4 ul dNTPs (2,5 nM), 1 ul Primer 1 (20 uM), 1 ul Primer 2 (20 uM), 0,25 ul Platinum Taq (5 U / ul), 3 ul verdaute DNA mit Linker (Betrag kann variieren) bis zu 50 ul ddH 2 O.
  19. PCR-Programm: 94 ° C für 5 min, 30 Zyklen von 94 ° C für 30 sec, 60 & d.zB, C für 30 sec, 72 ° C für 90 sek. Abschließende Extension bei 72 ° C für 5 min.
  20. Bereinigen PCR-Produkt unter Verwendung MinElute 96 Well Platten und einen Vakuumverteiler, wie oben beschrieben.
  21. Resuspendieren in 30 ul H 2 O und übertragen auf eine saubere 96-Well-Platte.
  22. Einen 1:75 Verdünnung der 1 ° PCR durch Verdünnen von 2 ul DNA aus Schritt in 148 ul 4,21 ddH 2 O
  23. Führen sekundären PCR unter Verwendung verschachtelte Versionen der Primer, der auch die erforderliche Sequenz für das Illumina GAIIx Maschine sowie eine 12 Basenpaar Barcode, der einzigartig für jede Tumorprobe verarbeitet (siehe Tabelle oben Primer für Beispiele dieser Primer) ist.
  24. Sekundäre PCR: 10 ul 10x Puffer mit MgCl2, 8 ul dNTPs (2,5 mM), 1 ul Illumina strichcodiert sekundären Primer (20 uM), 1 ul Illumina Nest 1 sekundäre Primer (20 uM), 0,25 ul FastStart Taq (5 U / ul ), 2 ul DNA aus verdünnten primären PCR 1:75, bis 100 ul ddH 2 O.
  25. PCR-Programm: 94 °, C für 2 min, 30 Zyklen von 94 ° C für 30 sec, 53 ° C für 45 sec, 72 ° C für 90 sek. Abschließende Extension bei 72 ° C für 5 min.
  26. Ausführen 45 ul dieser PCR-Reaktion auf einem 1% Agarosegel mit Ethidiumbromid (0,5 mg / ml). Es sollte ein "schmieren" von PCR-Produkten vertreten Amplikons der vielen verschiedenen Transposon-Insertionen in den Tumor (Abbildung 3).
  27. Bereinigen restlichen 50 ul PCR-Produkt unter Verwendung MinElute 96 Well Platten und einen Vakuumverteiler, wie oben beschrieben. Waschen einer Zeit, indem 50 pl ddH 2 O in den Vertiefungen und Absaugen wieder.
  28. Resuspendieren in 30 ul TE und übertragen auf eine saubere 96-Well-Platte.
  29. Bestimmung der Konzentration von DNA in jeder Probe. Kombinieren gleiche Mengen an DNA in einer einzelnen 1,5-ml-Mikrozentrifugenröhrchen. Dies wird die Bibliothek, die in einem einzigen Spur einer Illumina HiSeq 2000 Maschine sequenziert werden. Es ist möglich, mehrere hundert Tumoren Sequenz in einer einzelnen Spur einer Illumina Lauf.
  30. Einreichendie einzelnen Röhrchen mit gleichen Mengen von DNA aus allen Tumoren zur Sequenzierung. Dies kann durch Ihre Institution oder kommerziell durchgeführt werden.

5. Analyse der Transposon Insertions

  1. Software zur Analyse von Transposon-Insertion Daten verfügbar zum kostenlosen Download via SourceForge ( http://sourceforge.net/projects/tapdancebio/ ). Das Programm, genannt Tapdance erfordert die Sequenz-Datei von der Illumina-Plattform und einem Barcode-Bibliothek Karte Textdatei.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nach dem Züchtungsschema festgestellt wurde, sollten Züchter produzieren einen Wurf alle 19-21 Tage. Wurfgröße variiert zwischen 5 und 12 Welpen, je nach dem Alter der Züchter und den genetischen Hintergrund. Darüber hinaus stellen Sie sicher, dass der Genotyp des Wurfes Mendelschen Genetik folgt als einen Weg, um zu bestätigen, dass die Züchtungsschema als richtig und erfolgreich ist.

Für das Experiment erfolgreich zu sein, sollte Tumorinzidenz bei den Versuchstieren deutlich größer sein als Tumor-Inzidenz bei den Kontrolltieren. Wenn kein "prädisponierende" Mutation in das Experiment einbezogen wurde sollte es wenig bis gar keine Tumoren in den Kontrolltieren sein. Wenn ein "Prädisposition" Mutation in dem Experiment eingeschlossen wurde, sollte Tumorinzidenz in diesen Tieren deutlich geringer als die Inzidenz bei Tieren mit der Mutation und SB-Aktivität.

LM-PCR sollte Hunderte von Transposon-Insertionen in einem Tumor zu verstärken. Nach dem Ausführen half des sekundären PCR-Produkt auf einem 1% igen Gel sollte ein "Schmieren" von DNA repräsentiert diese Verstärkung (Abbildung 3). Wenn es nur ein oder zwei Bänder sind, war entweder SB nicht im Tumor aktiv oder ein Fehler in dem Protokoll hergestellt (Abbildung 4).

Sequenzierung 1-200 Tumoren in einem einzigen Spur der Illumina GAIIx Plattform sollte über 30 Millionen Sequenzen von 100 bp je (Abbildung 5) zu produzieren.

Tabelle 1. Reagenzien für Abschnitt 2 erforderlich.

Tabelle 2. Reagenzien für Abschnitt 3 erforderlich.

Tabelle 3. Reagenzien für Abschnitt 4 erforderlich.

Abbildung 1
Abbildung 1. Flussdiagramm, das die Schrittezur Durchführung einer nach vorne genetische Bildschirm mit dem Dornröschen-System. Zunächst wird ein Mausmodell generiert. Mäuse werden dann seziert, wenn aufgefundenen und Tumoren gesammelt und getrennt. Tumor-DNA gereinigt und Linker vermittelten-PCR durchgeführt. Schließlich wird verstärkt Tumor-DNA mit Transposon-Insertionen sequenziert und gemeinsame Insertionsstellen identifiziert.

Abbildung 2
Abbildung 2. Züchtungsschema experimentelle Kohorte zu generieren. Mäuse mit der Transposase (Rosa26-LSL-SB11) an Mäusen beherbergt die Konkatamer von Transposons (T2-Onc) gekreuzt. Die Nachkommen werden dann an Mäusen, die die bezeichnete gewebespezifischen Promotor gesteuert Cre-Rekombinase (Cre) gepaart.

Abbildung 3
Abbildung 3. VertreterErgebnisse der Sekundärer PCR. Die erwartete Produkt hat einen Abstrich Aussehen Bereich von 100 bis 600 Basenpaaren.

Abbildung 4
Abbildung 4. Wenn LM-PCR nicht erfolgreich ist, wird es ein Fehlen des "Schmier" von DNA sein. Stattdessen sehen Sie endgültige DNA-Banden.

Abbildung 5
Abbildung 5. Beispiel Daten aus einer Sequenzierung run, die eine einzelne Spur der Illumina GAIIx Plattform demonstriert sollte über 30 Millionen Sequenzen von 100 Basenpaaren je produzieren.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Eine vorausschauende genetische Bildschirm mit dem Dornröschen Transposon-System bietet eine Methode zur Identifizierung von Mutationen, die Krebs verursachen. Durch Auswahl des geeigneten Promotors mit Cre-Rekombinase zusätzlich zu irgendwelchen Mutationen prädisponierende steuern, wird der Bildschirm zu identifizieren SB bekannten und neuartigen Kandidaten Krebsgene.

Der Erfolg einer SB-Bildschirm ist weitgehend abhängig von den Mäusen für die Erstellung des Bildschirms ausgewählt. Für das Transposon, empfehlen wir mit zwei verschiedenen Maus-Stämme, die die Konkatamer der onkogenen Transposons auf verschiedenen Chromosomen 7. Bedacht sollte bei der Wahl des Gewebe-spezifischen Rekombinase Cre, die das SB Transposase aktivieren wird. Es sollte Beweise dafür, dass das Cre-Enzym in der Zelle aktiven Typ, der wobei die Zelle, aus dem der Krebs zu modellierenden Verdacht ist. Erfolgreiche Beispiele sind Villin-Cre (GI-Trakt Krebs), Albumin-Cre (hepatozelluläres Karzinoma) und Aid-Cre (Lymphom). 8-10

Die Zahl der Mäuse für eine erfolgreiche Leinwand benötigt wird auf dem Tumor Penetranz abhängen. Im allgemeinen wird mehr und mehr Tumoren Mäuse in einer robusteren Bildschirm resultieren. Um ein 2-facher Unterschied in der Krebstherapie Latenz detektieren sollte es mindestens 60 Tieren sowohl in der Kontrolle und Versuchsgruppen. 11

Die vielseitige Natur dieser Bildschirme ist in Bezug auf andere Techniken, dass man die Natur der Krankheit angeben, folgen Sie dem Verlauf kann, und zu analysieren, die genetische Zusammensetzung mächtig. Diese Technik wurde in einer Reihe von Bildschirmen, die CIS Listen, die neue potenziellen Krebs Fahren Gene zu identifizieren ergeben haben erfolgreich. Mit dieser Information kann gerichteten Studien durchgeführt, um die Funktion dieser neuen Mutationen zu verstehen. Insgesamt kann die Anwendung dieser Technik auf die eventuelle Design neuer Arzneimitteltherapien gerichtet führen, um die Ergebnisse dieser spezifischen genetischen Mutationen zu eliminierentionen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgments

Die Autoren bedanken sich bei Branden Moriarity, David Largaespada und Vincent Keng an der University of Minnesota danken und Adam Dupuy an der University of Iowa für ihre Unterstützung bei der Entwicklung des oben beschriebenen Protokoll.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
Identifizierung von<em&gt; Dornröschen</em&gt; Transposon Insertionen in Solid Tumors mit Linker-vermittelte PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter