Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Identifisering av doi: 10.3791/50156 Published: February 1, 2013

Summary

En metode for å identifisere ukjente drivere av karsinogenese bruker en Objektive tilnærming er beskrevet. Metoden bruker

Abstract

Genomisk, proteomikk, transcriptomic, og epigenomic analyser av menneskelige svulster indikerer at det er tusenvis av anomalier innenfor hver kreft genom forhold til matchet normalt vev. Basert på disse analysene er det innlysende at det er mange uoppdagede genetiske bilførere kreft 1. Dessverre disse driverne er skjult i et mye større antall personbiler anomalier i genomet som ikke direkte bidrar til tumordannelse. Et annet aspekt ved kreft genomet er at det er betydelig genetisk heterogenitet innenfor lignende tumortyper. Hver svulst kan havnen forskjellige mutasjoner som gir en selektiv fordel for tumordannelse 2. Utføre en upartisk frem genetisk skjermen i mus gir verktøy for å generere svulster og analysere deres genetiske sammensetning, og samtidig redusere bakgrunnen for personbiler mutasjoner. The Sleeping Beauty (SB) transposon systemet er en slik metode 3. SB-systemet benytter mobil vektorer (transposoner) som kan settes inn gjennom genomet ved transposase enzymet. Mutasjoner er begrenset til en bestemt celletype gjennom bruk av en betinget transposase allel som aktiveres av Cre rekombinase. Mange mus linjer eksisterer som uttrykker Cre rekombinase i bestemte vev. Ved å krysse en av disse linjene i betinget transposase allelet (f.eks Lox-stop-Lox-SB11), er SB-systemet aktiveres bare i celler som uttrykker Cre rekombinase. Den Cre rekombinase vil avgiftsdirektoratet en stopp kassett som blokkerer uttrykk for transposase allelet, og dermed aktivere transposon mutagenese innenfor det angitte celletype. En SB-skjermen er initiert av avl tre stammer av transgene mus slik at de eksperimentelle mus bære en betinget transposase allelet, en concatamer av transposoner, og en vev-spesifikk Cre rekombinase allelet. Disse musene er lov til alder før svulster form og de blir døende. Musene er såobdusert og genomisk DNA ble isolert fra svulster. Deretter blir det genomiske DNA underkastet linker-mediert-PCR (LM-PCR) som resulterer i amplifikasjon av genomisk loci inneholdende en SB transposon. LM-PCR utført på et enkelt svulst vil resultere i hundrevis av distinkte amplikonene representerer hundrevis av genomiske loci inneholdende transposon innsettinger i en enkelt svulst 4. De transposon innsettinger i alle svulster blir analysert og felles Innleggelse (CISS) er identifisert ved hjelp av en hensiktsmessig statistisk metode 5. Gener innenfor CIS er svært sannsynlig å være onkogener eller tumorsuppressorgener, og anses kandidat kreftgener. Fordelene med å bruke SB system for å identifisere kandidat kreftgener er: 1) den transposon lett kan lokaliseres i genomet fordi dens sekvens er kjent, 2) innarbeiding kan rettes til nesten hvilken som helst celle type og 3) den er i stand til transposon innføre både gevinst-og tap-av-funksjon mutasjoner 6. Den følgende områderng protokollen beskriver hvordan å utvikle og gjennomføre en fremskutt genetisk skjerm bruker SB transposon system for å identifisere kandidat kreftgener (figur 1).

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Avl og aldring av transgene dyr

  1. Velg de stammer av transgene mus som passer for eksperimentet. Et typisk forsøk vil bruke tre transgene linjer, en betinget transposase mus, en mus skjule en concatamer av transposoner, og en mus uttrykker Cre rekombinase i cellene antas å være cellene Opprinnelsesreglene for ønskede kreft. Hvis kreften blir modellert har en kjent mutasjon i en stor prosentandel av pasientene kan det være ønskelig å ta med denne mutasjon ved starten. Eksempler på disse "disponerende" mutasjoner inkluderer aktiverte Kras, dominerende negative TP53 eller floxed PTEN allel. Ved å legge inn en disponerende mutasjon modellen kan bedre representere menneskelig kreft (se 1.3). Flere Sleeping Beauty transposase og transposon mus er tilgjengelig fra National Cancer Institute Mouse Repository ( http://mouse.ncifcrf.gov/ ).
  2. Rase betingede transposase mus med mus skjuler de transposoner til slutt få mus homozygote for begge allelene hvis mulig. Rasen homozygote avkom til mus som uttrykker Cre rekombinase å generere trippel transgene eksperimentelle mus (figur 2). Merk: Innhenting homozygote mus er ikke alltid mulig eller ideelle. For eksempel, homozygote p53 dominerende negative mus er mye vanskeligere å avle enn heterozygote mus. I tillegg er det nyttig å sørge for at kull følger mendelsk genetikk for å bekrefte at avl ordningen er vellykket.
  3. Hvis du bruker en disponert bakgrunn, første rase mus med transposase til mus med disponerende allelet. Samtidig rasen mus uttrykker Cre rekombinase til mus som bærer transposoner. Lag homozygote mus for hvert allel hvis mulig. Til slutt avle homozygot avkom fra de to foregående avlsarbeid for å generere firedoble transgene eksperimentell animals.
  4. I tillegg til de forsøksdyr, generere kontroll kohorter av mus. Kontrollgruppen består normalt av littermates fra den eksperimentelle avl som bare arver to av de tre allelene (figur 2). I tilfelle av en disponert bakgrunn, vil mus inkludert tre av de fire allelene også være nødvendig.
  5. Overvåke eksperimentelle og kontroll mus daglig for tumor utvikling og / eller moribundity. Følg din institusjonelle dyr omsorg og bruk komité (IACUC) krav til husdyrhold. Dessuten er det vanlig å finne en alder der du vil ofre et dyr hvis det ikke har blitt enda døende. Atten måneder er en typisk alder hvor mus avlives.

2. Obduksjon av transgene dyr

Navnet på reagensen Selskapet Katalognummer
Sure-Seal inducsjon Chamber Brain Tre Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% buffret formalin Sigma Aldrich HT501128-4L

Tabell 1. Reagenser nødvendig.

  1. Når en mus er døende eller har nådd slutten av den beregnede levetiden, avlive dyr ved hjelp av en CO 2 kammer følger dine IACUC retningslinjer. Vanligvis plasserer dyret i en ren gasskammer, åpner gasstanken og justere regulator for å lese ikke høyere enn 5 pounds per kvadrattomme. Fyll sakte for å hindre nasal og okulær irritasjon og aversjon mot CO 2. Sørg for at dyrets hjerte er ikke lenger slo og reagerer ikke når berørt i øyet.
  2. Spray utvendig ofret mus med 70% etanol.
  3. Sted musen på en obduksjon bord og fest med dissecting pinner. Bruk saks end pinsett til å åpne musen og fjerne organer. Bestemme hvilke organer bør samles er prosjektet avhengig. Men det anbefales å alltid samle milt og lever som disse organene gir ofte viktig innsikt i hvorfor musen var døende. Også samle sternum for den potensielle analyse av benmarg. I tillegg er det alltid fordelaktig å samle ethvert organ eller vev som virker unormalt.
  4. Vev og svulster som samles bør deles inn i fire seksjoner. En seksjon er løst i 10% bufret formalin i 18 timer etterfulgt av 70% etanol. Denne delen kan brukes for H & E farging og / eller IHC. De resterende tre seksjoner, som er generelt 50 til 100 mg i størrelse, er snap frosset i flytende nitrogen. Disse kan brukes for DNA, RNA og protein isolasjon.
  5. Kast kadaveret og gjenstående vev i henhold til IACUC retningslinjer.

3. Isolere genomisk DNA fra Svulster

<strong> Navnet på reagensen Selskapet Katalognummer
Protein Nedbør løsning Qiagen 158910
Cellelyse buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232

Tabell 2. Reagenser nødvendig.

  1. Fint hakke frosne svulsten prøven (50 til 100 mg) ved hjelp av en ren barberblad.
  2. Plass hakket vev i et 1,5 ml mikrosentrifugerør, og tilsett 1 ml celle lyseringsbuffer inneholdende 5 pl proteinase K-løsning (20 mg / ml).
  3. Vortex grundig.
  4. Inkuber i en 55 ° C rister satt på 250 rpm i minst 4 timer, fortrinnsvis over natten.
  5. Tilsett 1 pl RNase A oppløsning (10 mg / ml) og invertere tube 25 ganger.
  6. Inkuber ved 37 ° C i 30 min.
  7. Avkjøl til romtemperatur ved å plassere på is i 3 min.
  8. Legg 333 ul Protein Nedbør løsning og virvle kraftig.
  9. Sentrifuger ved 14.000 rpm 10 min. Proteiner bør pellet. Hvis pelleten er svært liten, vortex igjen, inkubere på is i 5 min, og deretter re-sentrifuge.
  10. Hell av supernatanten inneholdende DNA inn i en ren 15 ml sentrifugerør.
  11. Legg tilsvarende volum av 100% isopropanol og bland ved forsiktig inverterende 50 ganger.
  12. Sentrifuger ved 3500 rpm i 3 min.
  13. Kast supernatant.
  14. Tilsett 1 ml av 70% etanol og invertere tube flere ganger for å vaske pelleten.
  15. Overfør den vaskede pellet sammen med etanol til et 1,5 ml mikrosentrifugerør.
  16. Sentrifuger ved 14.000 rpm i 5 min ved 4 ° C.
  17. Hell av etanol og invertere røret å lufttørke (ca. 5-30 min.)
  18. Gjensuspender DNA pEllet i 50-500 pl TE avhengig av størrelsen på DNA-pellet.
  19. Valgfritt inkubering ved 37 ° C for å resuspendere DNA.
  20. Oppbevar ved 4 ° C, eller -20 ° C for langtidslagring.

4. Linker Mediated-PCR Bruke genomisk DNA fra Svulster

Navnet på reagensen Selskapet Katalognummer
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 brønners plater Qiagen 28051
QIAvac 96 vakuummanifold Qiagen 19504
Multi-mikroplate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA-ligase med 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25 mm dNTPs Bioexpress C-5014-200
Platina Taq Invitrogen 10966-034
FastStart Taq DNA polymerase Roche 12032929001
Agarose Promega V3121
TAE buffer Promega V4271
TE Buffer Promega V6232
Etidiumbromid Promega H5041

Tabell 3. Reagenser nødvendig.

Linker sekvenser

BfaI linker + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

BfaI linker-5 'Phos-TAGTCCCTTAAGCGGAG 3'NH2

"> NlaIII linker + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

NlaIII linker-5 'Phos-GTCCCTTAAGCGGAGCC 3'

Primer sekvenser

Primær PCR fram på høyre side (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

Primær PCR fram til venstre side (BfaI): Spl IRDR L1 en CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC

Primær PCR revers for både høyre og venstre side: Spl link1 en GTAATACGACTCACTATAGGGC

Sekundær PCR fram på høyre side: Eksempel på en Illumina strekkodet videregående primer 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (N er representerer 12 bp strekkode, sekvens i store bokstaver kreves for Illumina plattformen, og sekvensen med små bokstaver vil binde til transposon.)

Sekundær PCR fram til venstre side: Eksempel på en Illumina strekkodet secondary primer 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (N er representerer 12 bp strekkode, sekvens i store bokstaver kreves for Illumina plattformen, og sekvensen med små bokstaver vil binde til transposon.)

Sekundær PCR revers for både høyre og venstre side: linker nestet omvendt primer 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. Anneal + og - linkere for både BfaI linkere og NlaII linkere ved å blande 50 ul av linkeren + (100 uM) med 50 ul av linker-(100 uM) og tilsett 2 ul NaCl (5 M) i et 1,5 ml mikrosentrifugerør. Sted i 95 ° C varme blokk for 5 min. Slå av varmeblokk og la sakte avkjøles til romtemperatur (dette tar en time eller mer). Etter avkjøling kan annealed linkere lagres i en -20 ° C fryser inntil nødvendig.
  2. Forbered to alikvoter av svulsten DNA, hver alikvot inneholdende 1 ug av DNA. En delmengde vil bli fordøyd viddha begrensning enzym som vil kutte nær den "riktige" enden av transposon. Den andre alikvot blir spaltet med et restriksjonsenzym som kutter nær den "venstre" ende av transposon. Dette er gjort for å maksimere sjansene for å forsterke hver transposon innstikkstedet.
  3. Fordøye svulsten DNA i en delmengde med den "riktige" siden enzym NlaII, og fordøye svulsten DNA i den andre delmengde med "venstre" side enzym BfaI: Kombiner en ul enzym, 5 pl 10x NEB Buffer # 4, DNA ( 1 ug) og DDH 2 O til et totalt volum på 50 ul. Fordøye DNA over natten ved 37 ° C i vannbad eller inkubator.
  4. Heat innaktivere enzymer (BfaI = 80 ° C i 20 min, NlaIII = 65 ° C i 20 min).
  5. Rengjør fordøyd prøver ved å plassere prøvene i MinElute 96 brønners plate, sted plate i vakuum manifold og vakuum i ca 15 minutter før brønnene ser tørr.
  6. Fjern platen fra vakuummanifold og blot bunn av 96 brønns plate med papirhåndkle for å fjerne alle avviklingd
  7. Tilsett 30 pl DDH 2 O til hver brønn, og rist på en orbital shaker innstilt på høy i 2 min, eller pipetter opp og ned 20 til 40 ganger.
  8. Overfør hele volumet i brønner (30 pl) fra MinElute 96 brønns plate i rene 96 brønnplatene.
  9. Utfør linker ligation reaksjoner med fordøyd DNA fra trinn 4,8 og linkere fra trinn 4.1. Bland 10 ul fordøyd DNA, 4 pl 5x ligation buffer, 5,5 ul annealed linkere (950 ug / ul), 0,5 ul T4 ligase (5 U / pl).
  10. Inkuber i 4 timer til over natten ved 16 ° C.
  11. Heat inaktivere T4 DNA-ligase ved 65 ° C i 10 min.
  12. Rydd opp ligation med MinElute 96 brønners plater og et vakuum manifold som beskrevet i trinn 4.5 til 4.6.
  13. Resuspender i 30 ul H 2 O og overføre til en ren plate med 96 brønner.
  14. Utføre en andre DNA fordøyelsen for å ødelegge gjenværende concatamer transposoner. Dette oppnås ved å kutte DNA en andre gang ved hjelp av et enzym som kutter plasmidet vEctor DNA som ble brukt til å lage transgene mus som inneholder transposon concatamer.
  15. Digest DNA ved bruk BamHI (både venstre og høyre side): Bland 25 ul av linker-ligert DNA fra trinn 4,13, 5 pl 10x NEB buffer 3, 0,5 pl BamHI (20 U / pl), 0,5 pl BSA (10 mg / ml ), og 19 pl DDH 2 O.
  16. Digest 3-6 hr eller natten over ved 37 ° C.
  17. Utfør primær PCR ved hjelp av en primer spesifikk for transposon og en primer spesifikk for linkeren. Disse vil variere avhengig av hva transposon og linker du bruker. Primerne oppført i primer tabellen ovenfor arbeid for T2/Onc og T2/Onc2 transposoner.
  18. Primær PCR: 5 pl 10x buffer, 2,0 pl MgCl2 (50 mM), 4 pl dNTPs (2,5 nM), 1 pl Primer 1 (20 pM), 1 pl Primer 2 (20 uM), 0,25 pl Platinum Taq (5 U / ul), 3 pl samleversjon DNA med linkere (beløpet kan variere), opp til 50 ul DDH 2 O.
  19. PCR-programmet: 94 ° C i 5 min, 30 sykluser av 94 ° C i 30 sek, 60 & df.eks, C i 30 sek, 72 ° C i 90 sek. Endelige forlengelse ved 72 ° C i 5 min.
  20. Rydde opp PCR produkt ved hjelp MinElute 96 brønnplatene og en vakuummanifold som beskrevet ovenfor.
  21. Resuspender i 30 ul H 2 O og overføre til en ren plate med 96 brønner.
  22. Foreta en 1:75 fortynning av en ° PCR ved å fortynne 2 ul av DNA fra trinn 4,21 inn 148 pl DDH 2 O
  23. Utfør secondary PCR hjelp nestede versjoner av primere som også har den nødvendige sekvens for Illumina GAIIx maskin samt en 12 basepar strekkode som er unik for hver tumor prøve behandlet (se primer tabell ovenfor for eksempler på slike primere).
  24. Sekundær PCR: 10 ul 10X Buffer med MgCl2, 8 pl dNTPs (2,5 mM), 1 pl Illumina strekkodet sekundær primer (20 uM), 1 pl Illumina Nest 1 sekundær primer (20 uM), 0,25 pl FastStart Taq (5 U / pl ), 2 ul DNA fra primære PCR utvannet 1:75, opp til 100 ul DDH 2 O.
  25. PCR Program: 94 °, C i 2 min, 30 sykluser av 94 ° C i 30 sek, 53 ° C i 45 sek, 72 ° C i 90 sekunder. Endelige forlengelse ved 72 ° C i 5 min.
  26. Run 45 pl av denne PCR reaksjonen på en 1% agarosegel inneholdende etidiumbromid (0,5 ug / ml). Det bør være en "smøre" av PCR-produkter som representerer amplikonene av de mange forskjellige transposon innsettinger i tumor (figur 3).
  27. Rydde opp resterende 50 pl av PCR-produktet ved hjelp av MinElute 96 brønnplatene og en vakuummanifold som beskrevet ovenfor. Vaske en gang ved å plassere 50 ul DDH 2 O i brønnene og støvsuging igjen.
  28. Resuspender i 30 ul TE og overføre til en ren plate med 96 brønner.
  29. Bestemme konsentrasjonen av DNA i hver prøve. Bland like mengder DNA i en enkelt 1,5 ml mikrosentrifuge-rør. Dette vil være biblioteket som er delt inn i ett kjørefelt av en Illumina HiSeq 2000 maskin. Det er mulig å sekvensere flere hundre svulster i en enkelt av en lane Illumina løp.
  30. Send innenkelt rør som inneholder like mengder av DNA fra alle svulster for sekvensering. Dette kan gjøres ved institusjonen din eller kommersielt.

5. Analyse av transposon Innsettinger

  1. Programvare for å analysere transposon innsetting data er tilgjengelig for gratis nedlasting via SourceForge ( http://sourceforge.net/projects/tapdancebio/ ). Programmet, kalt TapDance, krever sekvensen filen fra Illumina plattform og en strekkode til bibliotek kart tekstfil.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Etter avl ordningen er etablert, bør oppdrettere produserer et kull hver 19-21 dager. Kull størrelse vil variere mellom 5 og 12 unger, avhengig av alderen på oppdrettere og den genetiske bakgrunnen. I tillegg må du kontrollere at genotypen av søppel følger mendelsk genetikk som en måte å bekrefte at avl ordningen er både riktig og vellykket.

For forsøket skal være vellykket, bør svulst forekomst i de forsøksdyr være betydelig større enn tumor forekomst i kontrollgruppene dyr. Hvis ingen "disponerende" mutasjon ble inkludert i eksperimentet det bør være få eller ingen tumorer i kontrolldyrene. Hvis en "predisponerende" mutasjon ble inkludert i eksperimentet svulstforekomsten i disse dyrene være mye lavere enn insidensen i dyr med mutasjon og SB aktivitet.

LM-PCR bør forsterke hundrevis av transposon innsettinger i en enkelt svulst. Etter å ha kjørt haLF av den sekundære PCR produktet på en 1% gel, bør det være en "utsmøring" av DNA som representerer denne forsterkning (figur 3). Hvis det er bare én eller to band, var enten SB ikke aktiv i svulst eller en feil ble gjort i protokollen (figur 4).

Sekvensering 1-200 svulster i en enkelt kjørefelt av Illumina GAIIx plattformen bør produsere over 30.000.000 sekvenser av 100 bp hver (fig. 5).

Tabell 1. Reagenser kreves for seksjon 2.

Tabell 2. Reagenser kreves for 3. ledd.

Tabell 3. Reagenser kreves for § 4.

Figur 1
Figur 1. Flytdiagram som viser trinneneå gjennomføre en frem Screeningsteknikken bruker Tornerose systemet. Først blir en mus modell generert. Mus er så obduksjon når døende og svulster er samlet og isolert. Tumor DNA renses og linkeren mediert-PCR utført. Endelig, blir forsterket tumor DNA med transposon innsettinger sekvensert og felles Innleggelse identifisert.

Figur 2
Figur 2. Avl ordningen til å generere eksperimentell kohort. Mus inneholder transposase (Rosa26-LSL-SB11) er krysset til mus skjuler det concatamer av transposoner (T2-ONC). Avkommet blir så parret med mus som bærer utpekt vev promoter drevet Cre rekombinase (CRE).

Figur 3
Figur 3. Representantresultatene av Sekundær PCR. Det forventede produktet har en smøre lignende utseende varierer 100-600 basepar.

Figur 4
Figur 4. Hvis LM-PCR er vellykket, vil det være et fravær av "utsmøring" av DNA. I stedet vil du se definitive band av DNA.

Figur 5
Figur 5. Eksempel data fra en sekvensering kjøre som demonstrerer et enkelt kjørefelt av Illumina GAIIx plattformen skal produsere over 30 millioner sekvenser av 100 basepar hver.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En forward genetisk skjermbildet ved hjelp av Sleeping Beauty transposon gir en metode for å identifisere mutasjoner som forårsaker kreft. Ved å velge riktig arrangøren å kontrollere Cre rekombinase i tillegg til eventuelle disponerende mutasjoner, vil SB-skjermen identifisere kjente og nye kandidat kreftgener.

Suksessen til en SB-skjermen er i stor grad avhengig av mus valgt for å skape skjermen. For transposon, anbefaler vi at du bruker to ulike musestammer bærer concatamer av onkogene transposoner på forskjellige kromosomer 7. Forsiktig trodde bør brukes når du velger vev-spesifikke Cre rekombinase som vil aktivere SB transposase. Det bør være bevis på at Cre enzymet er aktiv i celletypen som er mistenkt for å være cellen opprinnelsesland av kreft blir modellert. Vellykkede eksempler inkluderer Villin-Cre (GI tarmkanalen kreft), Albumin-Cre (hepatocellulær carcinoma), og Aid-Cre (lymfom). 8-10

Antallet mus som kreves for en vellykket skjerm vil avhenge svulsten penetrans. Generelt vil flere svulster og flere mus resultere i en mer robust skjerm. Å detektere en to-gangers forskjell i kreft ventetid bør det være minst 60 dyr i både kontroll og eksperimentelle grupper. 11

Den allsidige naturen av disse skjermene er kraftig i forhold til andre teknikker i at man kan spesifisere hva slags sykdom, følger progresjonen, og analysere den genetiske sammensetning. Denne teknikken har vært vellykket i en rekke skjermer som har gitt CIS lister som identifiserer nye potensielle kreft kjøring gener. Med denne informasjonen kan adresserte studier utføres for å forstå funksjonen av disse nye mutasjoner. Total, kan bruken av denne teknikken føre til at eventuell design av nye legemiddel terapier rettet mot å eliminere resultatene av disse spesifikke genetiske Mutasjoner.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Forfatterne ønsker å takke Branden Moriarity, David Largaespada, og Vincent Keng ved University of Minnesota, og Adam Dupuy ved Universitetet i Iowa for deres hjelp i å utvikle protokollen beskrevet ovenfor.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
Identifisering av<em&gt; Sleeping Beauty</em&gt; Transposon Innsettinger i solide svulster ved hjelp Linker-mediert PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter