Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Tanımlanması doi: 10.3791/50156 Published: February 1, 2013

Summary

Tarafsız bir yaklaşım kullanarak karsinogenez bilinmeyen sürücüsü tespit için bir yöntem tarif edilmektedir. Yöntem kullanır

Abstract

Insan tümörlerinin genomik, proteomik Transkriptomik ve epigenomic analizler eşleştirilmiş normal dokuya göre her kanser genom içerisindeki anomalilerin binlerce olduğunu göstermektedir. Bu analizlere dayanarak kansere 1 keşfedilmeyen birçok genetik sürücü olmadığını açıktır. Ne yazık ki bu sürücüler doğrudan tümör oluşumuna katkıda bulunmayan genomundaki yolcu anomalilerin çok daha fazla sayıda içinde gizlidir. Kanser genomun bir başka yönü de benzer tümör tipleri içinde hatırı sayılır genetik heterojenlik olmasıdır. Her tümör tümör oluşumu 2 bir selektif avantaj sağlayan farklı mutasyon barındırabilir. Yolcu mutasyonlar arka azaltırken farelerde tarafsız bir ileri genetik ekran Sahne, tümörler oluşturmak ve kendi genetik kompozisyon analiz etmek için araçlar sağlar. Sleeping Beauty (SB) transpozon sistemi böyle bir yöntem 3'tür. SB sistemi mobil v kullanırtransposase enzim tarafından genomu boyunca yerleştirilebilir ectors (transpozonlar). Mutasyonlar, Cre rekombinaz tarafından aktive olan bir koşullu transposase alelinin kullanımı ile belirli bir hücre tipi ile sınırlıdır. Birçok fare hatları belli dokularda bulunduğunu ifade Cre Rekombinaz var. Koşullu transposase alleli (örn. Lox-stop-Lox-SB11) şu satırları birini geçerek, SB sistem sadece ifade Cre Rekombinaz hücreleri aktive edilir. Cre Rekombinaz ÖTV durak kaset olacak ki böylece belirlenmiş hücre tipi olan transpozon mutajenez aktive transposase allel blok ifadesi. Deneysel fareler bir şartlı transposase alel, transpozonlar bir concatamer, ve bir doku-spesifik Cre rekombinaz alleli böylece bir SB ekran transgenik farelerde üç cins üreme ile başlatılır. Bu fareler tümörler şeklinde yaşına kadar izin ve can çekişen hale gelir. Daha sonra fareler bulunmaktadırnekropsi ve genomik DNA tümör izole edilmiştir. Daha sonra, genomik DNA bağlayıcı aracılı-PCR ile yapılmıştır (LM-PCR) bir SB transpozon içeren genomik bir lokus amplifikasyon olarak sonuçlanır. LM-PCR, tek bir tümör 4 transpozon eklemeler içeren genomik lokus yüzlerce temsil farklı amplikonlarının yüzlerce neden olacaktır tek bir tümör üzerinde gerçekleştirildi. Tüm tümörlerde transpozon eklemeleri analiz edilir ve ortak ekleme siteleri (CISs) uygun istatistiksel metodun 5 kullanılarak tanımlanır. BDT içindeki genler onkogenler ve tümör baskılayıcı genler olması kuvvetle muhtemeldir, ve aday kanser genleri kabul edilir. Kanser aday genlerin tanımlanması için SB sistemini kullanmanın avantajları şunlardır: kendi dizisi, 2 bilindiğinden, 1) transpozon kolaylıkla aktarılması hemen hemen herhangi bir hücre tipi yönlendirilir ve 3) transpozon yeteneğine sahip olabilir) genomuna yerleştirilebilir tanıtan hem kazanç ve kayıp fonksiyon-mutasyonlar 6. Following protokolü aday kanser genleri (Şekil 1) tanımlamak için SB transpozon sistemini kullanan bir ileri genetik ekran hazırlamak ve yürütmek açıklamaktadır.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Yetiştirme ve Transgenik Hayvan Yaşlanma

  1. Denemeniz için uygun transgenik farelerin suşları seçin. İstenen kanser için kökenli hücreler olduğu düşünülmektedir hücrelerde Cre rekombinaz eksprese eden bir koşullu transposase fare, transpozonlar bir concatamer barındıran, bir fare, bir fare, bir Tipik bir deneyde üç transjenik çizgileri kullanırlar. Modellenen kanser hastalarının büyük bir kısmı bilinen bir mutasyon olması halinde, başlangıcında bu mutasyon dahil etmek tercih edilebilir. Bu "hazırlayıcı" mutasyon örnekleri aktive Kras, dominant negatif TP53 veya floxed PTEN allel içerir. Predispozan bir mutasyon ekleyerek model daha iyi (1.3) insan kanser temsil edebilir. Çeşitli Sleeping Beauty transposase ve transpozonlar fareler Ulusal Kanser Enstitüsü Fare Deposu (edinilebilir http://mouse.ncifcrf.gov/ ).
  2. Sonunda eğer mümkünse her iki allel için homozigot fareler elde etmek transpozonlar yataklık farelerle Breed koşullu transposase fareler. Sizin üçlü transgenik deney farelerinin (Şekil 2) oluşturmak için Cre Rekombinaz ifade farelere Breed homozigot yavrular. Not: Elde homozigot fareler her zaman mümkün veya ideal değildir. Örneğin, homozigot p53 dominant negatif farelerde çok daha zor heterozigot farelerde daha doğurmak için vardır. Buna ek olarak, ibrelerin ıslahı başarılı olduğunu onaylamak için Mendel genetiği izleyin emin olmanıza yardımcı olur.
  3. Bir yatkınlık arka kullanıyorsanız, predispozan alleli ile farelere transposase ile ilk cins fareler. Aynı zamanda, ırkı fareler transpozonlar taşıyan farelere Cre Rekombinaz ifade. Her allel mümkünse için homozigot fareler oluşturun. Son olarak, dörtlü transgenik deneysel anim oluşturmak için önceki iki yetiştirme düzenleri homozigot yavrular doğurmakals.
  4. Deney hayvanları ek olarak, fareler kontrol Kusaklara oluşturur. Kontrol grubuna normal olarak sadece üç allel (Şekil 2) arasında iki devralan deneysel ıslah littermates oluşur. Bir arka plan yatkın olması durumunda, dört allel üçü de dahil olmak üzere fareler de gerekli olacaktır.
  5. Tümör gelişimi ve / veya can çekişme için günlük deney ve kontrol farelerde izleyin. Sizin kurumsal hayvan bakımı ve hayvancılık için kullanımı komitesi (IACUC) gereksinimleri izleyin. Ayrıca, henüz can çekişmekte olmamıştır eğer bir hayvan kurban edeceği bir yaş belirlemek için tipiktir. Onsekiz ay fareler ötenazi hangi tipik bir yaştır.

2. Transgenik Hayvanlar nekropsi

Reaktif Adı Şirket Katalog numarası
Sure-Seal induction Odası Beyin Ağacı Bilimsel EZ-177
Cryovial Bioexpress C-3355-2
% 10 tamponlu formalin Sigma Aldrich HT501128-4L

Tablo 1. Reaktifler gereklidir.

  1. Bir fare can çekişen veya belirlenen ömrünün sonuna geldiğinde, sizin IACUC yönergeleri izleyerek bir CO 2 odalarını kullanarak hayvan ötenazi. Genellikle, temiz bir gaz odasında hayvan yerleştirin gaz tankı açmak ve inç kare başına en yüksek 5 daha kilo okumak için regülatörü ayarlayın. CO 2 nazal ve oküler irritasyon ve kaçınma en aza indirmek için yavaş doldurun. Hayvan kalbi artık atıyor ve göz dokunduğu zaman yanıt vermiyor emin olun.
  2. % 70 etanol ile kurban fare Sprey dış.
  3. Sıra bir otopsi gemide fare ve diseksiyon iğne ile sabitleyin. Makas bir kullanınd cımbız fare açın ve organları kaldırmak. Toplanan hangi organların belirlenmesi proje bağlıdır. Ancak, bu organlar genellikle fare işlemez hale gelmişti neden çok önemli ipuçları verir her zaman olduğu gibi dalak ve karaciğer toplamak için tavsiye edilir. Ayrıca kemik iliği potansiyeli analizi için sternum toplamak. Buna ek olarak, her zaman anormal görünür herhangi bir organ ya da doku toplamak için faydalıdır.
  4. Toplanan Dokular ve tümörler dört bölüme ayrılmıştır olmalıdır. % 10% 70 etanol, ardından 18 saat süreyle tamponlu formalin içinde bir kısım düzeltilmiştir. Bu bölüm, H & E boyama ve / veya IHC için de kullanılabilir. Genellikle boyut olarak 50 ila 100 mg olup geri kalan üç bölüm, sıvı nitrojen içinde dondurulur ek bulunmaktadır. Bu DNA, RNA ve protein izolasyonu için de kullanılabilir.
  5. IACUC kurallarına göre karkas ve kalan dokuların atın.

3. Tümörler genomik DNA İzolasyon

<reaktif strong> adı Şirket Katalog numarası
Protein Yağış çözümü Qiagen 158910
Hücre lizis tamponu Qiagen 158906
Proteinaz K Qiagen 158920
RNaz A Qiagen 158924
TE Tampon Promega V6232

Tablo 2. Reaktifler gereklidir.

  1. İnce temiz bir jilet ile dondurulmuş tümör numunesi (50 ila 100 mg) kıyma.
  2. Sıra bir 1.5 ml mikrosantrifüj tüpü içinde kıyılmış ve doku 5 ul Proteinaz K çözeltisi (20 mg / ml) içeren bir hücre parçalama tamponu 1 ml ekleyin.
  3. Iyice vorteksleyin.
  4. ° C çalkalayıcı tercihen gecede en az 4 saat, 250 rpm olarak ayarlanan bir 55 inkübe edin.
  5. 1 ul RNaz bir çözeltisi (10 mg / ml) eklenir ve boru 25 kez ters.
  6. 30 dakika süre ile 37 ° C'de inkübe edin.
  7. 3 dakika için buz üzerine yerleştirilmesi ile oda sıcaklığına soğutun.
  8. 333 ul Protein yağış çözüm ve şiddetle vorteks ekleyin.
  9. 14.000 rpm 10 dakika santrifüjleyin. Proteinler pelet gerekir. Pelet tekrar çok küçük, girdap ise, daha sonra 5 dakika, ve yeniden santrifüj boyunca buz üzerinde inkübe edilir.
  10. Temiz bir 15 ml santrifüj tüp içine supernatant DNA içeren kapalı dökün.
  11. 100% izopropanol eşit hacmi ekleyin ve yavaşça tersine 50 kat karıştırın.
  12. 3 dk süreyle 3500 rpm'de santrifüj.
  13. Süpernatantı atın.
  14. % 70 etanol 1 ml ekleyin ve pelet yıkamak için tüp birkaç kez ters.
  15. Bir 1.5 ml mikrosantrifüj tüpüne etanol ile yıkanmış topak aktarın.
  16. 4 ° C'de 5 dakika boyunca 14,000 rpm'de santrifüje
  17. Etanol kapalı dökün ve hava kuru (yaklaşık 5 ila 30 dakika) için tüp ters.
  18. Süspanse DNA pellet TE 50 ila 500 ul DNA pelet boyutuna bağlı olarak.
  19. 37 İsteğe inkübasyon ° C DNA süspansiyonu.
  20. Uzun süreli depolama boyunca 4 ° C veya -20 ° C'de depolayın.

4. Tümörler dan Linker Aracılı-PCR kullanarak genomik DNA

Reaktif Adı Şirket Katalog numarası
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
96 oyuklu plakalar MinElute Qiagen 28051
QIAvac 96 Vakum manifoldu Qiagen 19504
Multi-mikroplak Genie, 120V Scientific Industries, Inc SI-4000
5x ligasyon tampon ile T4 DNA ligaz Invitrogen 15224-041
BamHI New England Biolabs R0136S
25 mM dNTP Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polimeraz Roche 12032929001
Agaroz Promega V3121
TAE Tampon Promega V4271
TE Tampon Promega V6232
Etidyum bromür Promega H5041

Tablo 3. Reaktifler gereklidir.

Linker Diziler

BfaI bağlayıcının + 5 'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3'

BfaI linker-5 'Phos-TAGTCCCTTAAGCGGAG 3'NH2

"> NlaIII bağlayıcı + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

NlaIII linker-5 '-Phos GTCCCTTAAGCGGAGCC 3'

Astar Diziler

İleri Primer PCR sağ tarafında (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC: Primer PCR ön taraftır (BfaI) sol

Sağ ve sol her iki taraf için Birincil PCR ters: Spl Link1 1 GTAATACGACTCACTATAGGGC

İkincil PCR sağ ön tarafa: Bir Illumina barkodlu ikincil astar 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa Örneği (N adlı 12 bp barkod temsil, büyük harf sırası Illumina platformu için gereklidir, ve küçük harf sırası transpozon bağlanacaktır.)

Bir Illumina barkodlu secon Örnek: İkincil PCR ileri sol tarafdary astar 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (N adlı 12 bp barkod temsil, büyük harf sırası Illumina platformu için gereklidir, ve küçük harf sırası transpozon bağlanacaktır.)

Sağ ve sol her iki taraf için İkincil PCR ters: bağlayıcının iç içe ters primerler 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. + Tavlama ve - BfaI bağlayıcılara ve NlaII bağlayıcılar her ikisi için bağlayıcı bir ilintileyici (100 uM), 50 ul bağlayıcı ile 50 ul + (100 uM) karıştırılarak ve bir 1.5 ml mikrosantrifüj tüpü içinde 2 ul NaCl (5 M) ilave edilir. 95 5 dak ° C ısıya blok yerleştirin. Isıtma bloğu kapatın ve (bu bir saat veya daha fazla sürer) yavaş yavaş oda sıcaklığına soğumaya bırakın. Gerekinceye kadar soğutulduktan sonra, tavlanmış linkerler bir dondurucuda -20 ° C'de muhafaza edilebilir.
  2. DNA tümör iki kısım, 1 ug DNA ihtiva eden her bir tablet hazırlanır. Bir kısım zekâ sindirilir olacaktransposonun "doğru" sonuna yakın kesecek ha restriksiyon enzim. İkinci kısım transposonun "sol" sonuna yakın kesen bir kısıtlama enzimi ile sindirilmiş olacaktır. Bu her transpozon insersiyon yükselterek şansını maksimize etmek için yapılır.
  3. "Sağ" tarafında enzim NlaII kullanarak bir kısım ise tümör DNA sindirimi ve "sol" tarafında enzim BfaI kullanarak diğer kısım ise tümör DNA sindirimi: enzim 1 ul, 5 ul 10x NEB Tampon 4. DNA (birleştir 1 ug) ve 50 ul toplam hacim için GKD 2 O. 37 gecede Digest DNA ° su banyosu veya kuvöz C.
  4. Enzimleri inaktive ısıtın (BfaI = 80 ° C 20 dakika, NlaIII = 65 ° C, 20 dakika).
  5. MinElute 96 plaka örnekleri koyarak sindirilmiş örnekler temizleyin, kuyular kadar yaklaşık 15 dakika süreyle vakum manifoldu ve vakum yer plaka kuru gözükmelidir.
  6. Tüm Liqui çıkarmak için vakum manifoldu ve kağıt havlu ile 96 plaka blot alt plakasını çıkarınd
  7. Her bir kuyunun 30 ul GKD 2 O ekleyin ve 2 dakika boyunca yüksek orbital çalkalayıcı seti sallamak veya 20 ila 40 kez aşağı yukarı pipetle ve.
  8. Temiz 96 kuyucuğu içine MinElute 96 plaka kuyularda tüm hacmi (30 ul) aktarın.
  9. Adım 4.8 ve adım 4,1 linkers gelen sindirilmiş DNA bağlayıcı ligasyon reaksiyonları gerçekleştirin. 10 ul sindirilmiş DNA, 4 ul 5x ligasyon tamponu, 5.5 ul tavlanmış bağlayıcı (950 ug / ul), 0.5 mikrolitre T4 ligaz (5 U / ul) karıştırılır.
  10. 16 gece boyunca ile 4 saat için inkübe ° C.
  11. 10 dakika boyunca 65 ° C'de T4 DNA ligaz inaktive ısıtın.
  12. 4.6 - MinElute 96 kuyucuğu ve gibi adımlar 4,5 açıklandığı bir vakum manifoldu kullanılarak ligasyonu temizleyin.
  13. 30 ul H 2 O süspanse edin ve temiz bir 96 plaka transfer.
  14. Concatamer transpozonlar kalan yok etmek için ikinci bir DNA sindirimi gerçekleştirin. Bu plazmid v kesen bir enzimi kullanılarak DNA bir ikinci kesme işlemi ile elde edilirtranspozon concatamer ihtiva eden transjenik farelerin oluşturmak için kullanılan Ector DNA.
  15. Digest DNA BamHI (hem sağ hem sol tarafında) kullanarak: Mix adım 4.13, 5 ul 10x NEB tampon # 3, 0.5 ul BamHI (20 U / ul), 0.5 ul BSA (den ilintileyiciniz bağlanan DNA 25 ul 10 mg / ml ) ve 19 ul GKD 2 O.
  16. 37 Digest 3-6 saat veya gece boyunca ° C.
  17. Linker için transpozon ve astar özel için özel bir astar kullanılarak primer PCR gerçekleştirin. Bunlar kullandığınız ne transpozon ve linker bağlı olarak değişiklik gösterecektir. Primerler T2/Onc ve T2/Onc2 transpozonlar çalışma yukarıdaki astar tabloda listelenmiştir.
  18. Birincil PCR: 5 ul 10x tampon, 2.0 ul MgCl2 (50 mM), 4 ul dNTP (2.5 nM), 1 ul Primer 1 (20 uM), 1 ul Primer 2 (20 uM), 0.25 ul Taq Platin (5 U / ) ul, linkers 3 ul Sindirilmiş DNA (miktarı değişebilir), en fazla 50 ul GKD 2 O.
  19. PCR Programı: 94 ° C de 5 dakika, 94 30 döngüleri ° C için 30 sn, 60 ve dörneğin, 30 saniye için C, 90 sn için 72 ° C'dir. 72 Final uzantısı ° C de 5 dakika.
  20. MinElute 96 oyuklu plakalar ve yukarıda tarif edildiği gibi bir vakum manifoldu kullanılarak PCR ürünü temizleyin.
  21. 30 ul H 2 O süspanse edin ve temiz bir 96 plaka transfer.
  22. 148 ul GKD 2 O içine adım 4.21 DNA 2 ul seyreltilmesi ile 1 bir 1:75 seyreltme ° PCR Yap
  23. Ayrıca Illumina GAIIx makine hem de (bu primerler ile ilgili örnekler için yukarıda astar tabloya bakınız) işlenmiş her bir tümör numune için eşsiz olan bir 12 baz çifti barkod için gerekli dizisine sahip primerlerin iç içe versiyonları ile ikincil PCR gerçekleştirin.
  24. İkincil PCR: MgCl2 10 ul 10x Tampon, 8 ul dNTP (2.5 mM), 1 ul Illumina ikincil astar (20 uM), 1 ul Illumina Nest 1 ikincil astar (20 uM), 0.25 ul FastStart Taq (barkodlu 5 U / ul ), primer PCR seyreltilmiş 1:75 2 ul DNA, 100 ul GKD 2 O.
  25. PCR Programı: 94 °, 2 dakika için C, 90 sn için 45 saniye, 72 ° C'de 30 saniye, 53 ° C de 94 ° C arasında 30 devir. 72 Final uzantısı ° C de 5 dakika.
  26. Etidiyum bromid (0.5 ug / ml) ihtiva eden bir% 1 agaroz jeli üzerinde Bu PCR reaksiyonu 45 ul çalıştırın. Tümör içinde birçok farklı transpozon ekleme (Şekil 3) arasında amplikonlar temsil eden PCR ürünleri bir "smear" olmalıdır.
  27. MinElute 96 oyuklu plakalar ve yukarıda tarif edildiği gibi bir vakum manifoldu kullanılarak PCR ürünü kalan 50 ul temizleyin. Kuyularda 50 ul GKD 2 O yerleştirerek tekrar vakumlama tarafından bir kez yıkayın.
  28. 30 ul TE süspanse edin ve temiz bir 96 plaka transfer.
  29. Her örnek DNA'nın konsantrasyonu tayin edilir. Tek bir 1.5 ml mikrofuge'de tüp DNA eşit miktarda karıştırın. Bu, bir Illumina HiSeq 2000 makine, tek bir şerit halinde sıralı kütüphane olacaktır. Bir Illumina çalışma tek bir şeritte sıra birkaç yüz tümörlerin mümkündür.
  30. Sunmaksıralama için tüm tümörlerin DNA eşit miktarlarda içeren tek tüp. Bu, kurum ya da ticari olarak yapılabilir.

5. Eklemeler Transposon analizi

  1. Transpozon ekleme verileri analiz etmek için yazılım SourceForge (üzerinden ücretsiz indirmek için kullanılabilir http://sourceforge.net/projects/tapdancebio/ ). TapDance adlandırılan program, Illumina platformu ve kütüphane haritası metin dosyasına bir barkod gelen sıra dosyası gerektirir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Yetiştirme programı kurulduktan sonra, yetiştiriciler her 19-21 günde bir çöp üretmek gerekir. Çöp boyutu yetiştiriciler ve genetik arka plan yaşına bağlı olarak, 5 ila 12 yavru değişecektir. Ayrıca, çöp genotip ıslahı doğru ve başarılı olduğunu teyit etmek için bir yol olarak Mendel genetiği aşağıda olduğundan emin olun.

Deney başarılı olması için, deney hayvanlarında tümör oluşumunda kontrol hayvanlarında tümör oluşumunda önemli ölçüde daha büyük olması gerekir. Hayır "hazırlayıcı" mutasyon bu deneye dahil edilmiştir, kontrol hayvanlarda tümörlere az olması gerekir. Bir "predispozan" mutasyon deneyi dahil, bu hayvanlarda tümör insidansı mutasyon ve SB aktiviteye sahip hayvanlarda insidansı çok daha düşük olmalıdır.

LM-PCR, tek bir tümör transpozon eklenenleri yüzlerce yükseltmek gerekir. Ha çalıştırdıktan sonra% 1 jel üzerinde ikincil PCR ürünü olursa, bu amplifikasyon temsil eden bir DNA "smear" (Şekil 3) olması gerekir. Bir ya da iki grup varsa, SB ya da tümör içinde aktif değildi ya da bir hata (Şekil 4) protokol yapılmıştır.

Illumina GAIIx platformun tek bir şeritte 1-200 tümörler Dizileme 100 bp her (Şekil 5) 30 milyon dizileri üzerinde üretmek gerekir.

Tablo 1. Reaktifler bölüm 2 için gereklidir.

Tablo 2. Reaktifler bölüm 3 için gereklidir.

Tablo 3. Reaktifler bölüm 4 için gereklidir.

Şekil 1
Şekil 1. Adımları gösteren akış şemasıuyuyan güzel sistemini kullanan bir ileri genetik ekran yürütmek için. İlk olarak, bir fare modeli oluşturulur. Can çekişen ve tümörler toplanmış ve izole edildiklerinde Fareler daha sonra nekropsi edilir. Tümör saflaştırılmış DNA ve bağlayıcı-PCR aracılığında gerçekleştirilir. Nihayet, transpozon eklemeleri ile amplifiye tümörün DNA dizilimini ve ortak ekleme siteleri tanımlanır.

Şekil 2,
Şekil 2. Deneysel kohort oluşturmak için şeması Islahı. Transposase (Rosa26-LSL-SB11) içeren Fare transpozonlar (T2-ONC) arasında concatamer barındıran farelere kesilmişlerdir. Yavrular daha sonra Cre Rekombinaz (Cre) tahrik belirlenen doku spesifik promotor taşıyan farelere şeklindeki vardır.

Şekil 3
Şekil 3,. Temsilciİkincil PCR sonuçları. beklenen ürün görünüm 100 ila 600 baz çifti kadar böyle bir karalama var.

Şekil 4,
LM-PCR başarısız olursa, Şekil 4., DNA "smear" yokluğu durumunda olacaktır. Bunun yerine, DNA'nın kesin bantları göreceksiniz.

Şekil 5,
Illumina GAIIx platformun tek şeritli gösteren bir dizi çalıştırın Şekil 5. Örnek veri 100 baz çiftlerinin her biri 30 milyon dizileri üzerinde üretmek gerekir.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Uyuyan güzel transpozon sistemi kullanan bir ileri genetik ekran neden olan kanser mutasyonları tanımlamak için bir yöntem sağlar. Herhangi hazırlayıcı mutasyon ek olarak Cre rekombinaz kontrol etmek için uygun bir promotörün seçerek, SB ekran bilinen belirlemek ve yeni aday genleri kanser olacaktır.

Bir SB ekranının başarısı ekranı yaratmak için seçilen fareler üzerinde büyük ölçüde bağlıdır. Transpozon için, farklı kromozomlar 7 onkojenik transpozonlar concatamer taşıyan iki farklı fare suşları kullanmanızı öneririz. SB transposase aktive edecek doku-spesifik Cre rekombinaz seçiminde dikkatli bir düşünce kullanılmalıdır. Cre enzim modellenen kanserlerin köken hücre olduğundan şüpheleniliyor hücre tipi aktif olduğunu kanıtlar olmalıdır. Başarılı örnekler Villin-Cre (gastrointestinal kanser), Albumin-Cre (hepatoselüler karsinom dahila) ve yardım-Cre (lenfoma). 8-10

Başarılı bir ekran için gerekli olan farelerin sayısı, tümör penetrans bağlı olacaktır. Genel olarak, daha fazla tümör bulunduğunda ve daha fareler daha güçlü bir ekran neden olur. Kanser gecikme bir 2 kat fark saptamak için en az 60 hayvan deney ve kontrol gruplarına hem de olmalıdır. 11

Bu ekranlar çok yönlü bir doğa, hastalığın doğası belirtmek ilerlemesini takip ve genetik kompozisyon analiz edebileceğiniz diğer teknikler açısından güçlüdür. Bu teknik, yeni potansiyel kanser sürüş genleri tanımlamak BDT listeleri vermiştir ekranlar bir dizi başarılı olmuştur. Bu bilgi ile, directed yeni çalışmalar, bu mutasyonların işlevini anlamak için uygulanabilir. Genel olarak, bu tekniğin kullanımı bu spesifik genetik mutasyonlar sonuçlarını ortadan kaldırmak amacıyla yeni ilaç tedavilerinin nihai tasarımına yol açabilirFONKSİYONLARIN.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa etmek başka bir şey var.

Acknowledgments

Yazarlar protokolü yukarıda açıklanan geliştirme konusundaki yardım için Iowa Üniversitesi Minnesota Üniversitesi'nde Branden Moriarty, David Largaespada ve Vincent Keng teşekkür, ve Adam Dupuy olurdu.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
Tanımlanması<em&gt; Sleeping Beauty</emLinker-aracılı PCR kullanarak Solid Tümörlerde&gt; Transposon Eklemeler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter