Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

VIGS-Mediated dépistage génétique avant pour l'identification des gènes impliqués dans la résistance non hôte

doi: 10.3791/51033 Published: August 23, 2013

Summary

Induite par le virus gene silencing est un outil utile pour identifier les gènes impliqués dans la résistance non hôte des plantes. Nous démontrons l'utilisation d'agents pathogènes bactériens exprimant GFPuv dans l'identification des gènes des plantes silencieux sensibles aux pathogènes non hôtes. Cette approche est simple, rapide et facilite le dépistage à grande échelle et un protocole similaire peut être appliquée à l'étude de divers autres interactions plantes-microorganismes.

Abstract

la résistance aux maladies non hôte des plantes contre les pathogènes bactériens est contrôlé par des voies de défense complexes. La compréhension de ce mécanisme est important pour le développement de plantes résistantes aux maladies durables contre la large gamme d'agents pathogènes. Induite par le virus gene silencing (VIGS) basée en avant génétique dépistage est une approche utile pour l'identification de gènes de défense des plantes conférer une résistance non hôte. Virus rattle du tabac (TRV) à base de vecteur VIGS est vecteur de VIGS la plus efficace à ce jour et a été utilisé efficacement pour faire taire des gènes cibles endogènes dans Nicotiana benthamiana.

Dans ce manuscrit, nous démontrons une approche de dépistage génétique avant pour réduire au silence des clones individuels à partir d'une banque d'ADNc dans N. benthamiana et évaluer la réponse des gènes des plantes silencieux pour compromis résistance non hôte contre les agents pathogènes non hôtes, Pseudomonas syringae pv. tomato T1, P. syringae pv. GlycINEA et X. campestris pv. vesicatoria. Ces bactéries pathogènes sont conçus pour expriment la protéine GFPuv et leurs colonies fluorescents verts peuvent être vus à l'oeil nu sous la lumière UV dans les non hôte d'agents pathogènes des plantes inoculées si le gène cible silence est impliqué dans la transmission de la résistance aux non hôte. Cela facilite l'identification fiable et rapide des gènes des plantes silencieux sensibles aux pathogènes non hôtes. En outre, les informations de gène candidat prometteur peut être connu par séquençage de l'insert de gène de plante dans TRV vecteur. Ici, nous démontrons la capacité haut débit de la génétique avant VIGS-médiation pour identifier les gènes impliqués dans la résistance non hôte. Environ 100 ADNc peuvent être réduits au silence individuellement dans environ deux à trois semaines et leur pertinence dans la résistance non hôte contre plusieurs pathogènes bactériens non hôte peut être étudiée en une semaine par la suite. Dans ce manuscrit, nous énumérons les étapes détaillées impliqués dans ce dépistage. Avant VIGS à médiation génétique screening approche peut être étendue non seulement à l'identification des gènes impliqués dans la résistance non hôte, mais aussi à l'étude des gènes conférant plusieurs tolérances de stress biotiques et abiotiques dans diverses espèces végétales.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

résistance non hôte est la résistance de toutes les espèces végétales contre les courses d'un 1,2 pathogène particulier. Ceci confère à large spectre et une résistance durable aux maladies dans les plantes 2,3. Cependant, son mécanisme, en particulier contre les bactéries pathogènes, n'est pas bien comprise 4. Dépistage des mutants ou des plantes silencieux que la résistance non hôte de compromis et de haute profilage de transcription d'débit pour l'identification de gènes exprimés de manière différentielle au cours de la résistance non hôte 5-9 sont deux grandes approches utilisées auparavant pour disséquer résistance non hôte bactérien. Parce que la résistance de non hôte est contrôlé par un mécanisme complexe (s) 4, avec la participation de nombreux gènes, une approche de génomique fonctionnelle à haut débit pour l'identification des gènes est essentielle pour mieux comprendre le mécanisme de résistance non hôte (s).

Induite par le virus gene silencing (VIGS) a été utilisée avec succès pour réduire au silence végétal endogènegènes dans de nombreuses espèces végétales. 10,11 Nicotiana benthamiana est l'une des meilleures plantes adaptées pour VIGS 10,12 et sa séquence du génome du projet est maintenant disponible 13. virus rattle du tabac (TRV) à base VIGS a été largement utilisé comme outil génétique inverse pour caractériser les gènes impliqués dans la résistance non hôte 2,4,14. Cette VIGS vecteurs et les dérivés sont maintenant disponibles à travers Arabidopsis Centre de Ressources Biologiques (CARL, http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html ). VIGS a également été utilisé comme un outil génétique en avant pour l'identification des gènes impliqués dans l'immunité des plantes 15-17, la résistance non hôte particulier 6,18. Évaluation de la réponse hypersensible (HR) médiée par la mort cellulaire induite par les plantes contre un agent pathogène non hôte spécifique et l'évaluation de la mort cellulaire induite par la maladie sont deux grands essais principalement utilisés pour IDENTIFIERg gène susceptible plantes silence. Cependant, la mort cellulaire HR est induite seulement contre de type II non hôtes pathogènes et non contre du type I non hôtes pathogènes 2. Par conséquent, les tests RH ne peuvent pas être universellement utilisés pour identifier les stratégies de résistance non hôtes utilisés par les plantes, en particulier contre vaste gamme de type I non hôtes pathogènes. En outre, la perte partielle de la résistance non hôte dans une usine taire des gènes ne conduit pas toujours à des symptômes de la maladie 6 et donc la notation de la maladie ne peut pas être utilisé pour l'identification des plantes compromettre la résistance non hôte. En revanche, l'évaluation de la croissance des agents pathogènes non hôtes dans les gènes des plantes silencieux est une meilleure méthode pour étudier la perte de résistance non hôte dans le gène plantes silencieux.

Par rapport aux test de croissance conventionnel 6,19, une méthode plus rapide pour évaluer la croissance bactérienne non hôte sur les gènes des plantes silencieux peut raccourcir le temps nécessaire pour avancer génétique dépistage. Nous avons déjà signalé une méthode pour observer les bactériesL lumière de la croissance des pathogènes sur des feuilles à l'oeil nu sous ultraviolet (UV) en utilisant des bactéries exprimant la protéine fluorescente verte (GFP) 19. Dans ce manuscrit, nous démontrons l'utilité de GFPuv exprimer pathogènes bactériens non hôte pour faciliter l'identification des gènes des plantes silencieuses qui sont compromises pour la résistance non hôte. Cette méthode est précise pour l'identification des plantes sensibles et prête pour le criblage à haut débit.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. croissance des plantes et Gene Silencing cible

  1. conditions de croissance des plantes:
    1. Semez N. benthamiana graines sur le sol moins mélange rempotage, Metro-Mix 350 et germer les graines dans une chambre de croissance. Toute autre sol ou hors-sol moyenne peuvent également être utilisés à la place de Metro-Mix.
    2. Transplantés trois semaines vieux plants dans des pots individuels et les cultiver dans une serre maintenue à 21 ± 2 ° C ainsi que d'autres conditions de croissance tels que détaillés dans la littérature précédente 12. Deux à trois jours après la transplantation, les plantes peuvent être utilisées pour TRV inoculation.
  2. Grandir TRV2 clones:
    TRV est un virus bipartite et son génome est constitué d'ARN 1 et RNA2. ARN 1 code pour une ARN polymérase dépendante de l'ARN et une protéine de mouvement 20,21. RNA2 code pour une protéine d'enveloppe (CP) et deux protéines non-structurales partir des ARN sous-génomique 21. Les deux ARN1 et RNA2 sont nécessaires pour la formation de vir mûriNous particules et leur propagation 20,21. construction d'une banque d'ADNc dans TRV2 vecteur est décrit dans la littérature précédente 22,23. En bref, bibliothèque VIGS utilisé dans cette étude a été construit à partir de l'ARN extrait à partir de tissus foliaires exposées à divers éliciteurs biotiques et abiotiques.
    1. Sortez Agrobacterium (souche GV2260) contenant les clones d'ADNc dans TRV2 vecteur (une plaque de 96 puits) du congélateur. Peu à peu, les décongeler et après les cultures atteignent la température ambiante, inoculer la culture Agrobacterium individu sur Luria-Bertani (LB) de plaque de gélose avec la rifampicine (10 mg / ml) et à la kanamycine (50 pg / ml) en utilisant un réplicateur de 96 broches.
    2. Incuber les plaques à 28 ° C pendant deux jours. Nous cultivons habituellement quatre colonies identiques pour chaque clone de sorte que inoculum Agrobacterium adéquat est disponible pour piquer inoculation de deux usines. Effectuez toutes les étapes dans des conditions stériles.
  3. VIGS:
    1. CroîtreAgrobacterium (GV2260) portant TRV1 à 28 ° C en milieu liquide LB avec des antibiotiques mentionnés ci-dessus. Récolte des cellules par centrifugation des cultures cultivées pendant une nuit, remettre en suspension dans le tampon d'inoculation (10 mM MES, pH 5,5, 200 uM acétosyringone), et incuber pendant 3 heures à température ambiante sur un agitateur à 50 tours par minute.
    2. Récolter les cellules par centrifugation et remettre en suspension dans du tampon MES 5 mM (pH 5,5) et inoculer (DO600 = 0,3) dans le côté abaxial de 3-4 N. benthamiana feuilles à l'aide d'une seringue sans aiguille. Procédure d'inoculation détaillée est démontré dans la littérature précédente 24. Plus tard, sur le site de TRV1 inoculation, inoculer TRV2 colonies respectives en piquant les feuilles avec un cure-dent.
    3. Maintenir les plantes avec une nutrition adéquate, la croissance vigoureuse est important pour VIGS efficaces 12. Environ deux semaines après l'inoculation, les transcriptions des gènes ciblés vont commencer à diminuer et les plantes sont prêtes pour le CONI pathogènelation à trois semaines après inoculation VRT.

2. Préparation des cultures non hôtes pathogènes et l'inoculation des plantes

  1. Détails de pathogènes utilisés dans cette étude:
    Pseudomonas syringae pv. Tabaci, P. syringae pv. tomato T1, P. syringae pv. glycinea et Xanthomonas campestris pv. vesicatoria sont utilisés dans cette étude. Cultivez P. souches syringae dans B King (KB) milieu liquide supplémenté avec la rifampicine (10 mg / ml), à la kanamycine (50 pg / ml) à 28 ° C pendant 12 heures. Cultivez X. campestris pv. vesicatoria en milieu liquide LB pendant 16 heures. Tous les agents pathogènes hébergent un plasmide qui peut exprimer GFPuv comme décrit dans la littérature précédente 19.
  2. Préparation des cultures pathogènes pour l'inoculation de la plante:
    1. Récolter les cellules bactériennes par centrifugation et confirmer la présence de fluorescence verte à l'aide de CapelongueLampe UV velength dans l'obscurité. Laver les cellules deux fois avec de l'eau stérile et remettre en suspension à la concentration voulue avec de l'eau stérile.
    2. Inoculer le pathogène respectif (s) sur le côté abaxial de gène cible feuilles réduites au silence (5 e à 8 e) que les taches (environ 1,5 cm diamètre). Plusieurs agents pathogènes non hôtes peuvent être testés simultanément pour leur croissance dans les gènes des plantes silencieux cibles. Simultanément inoculer le hôte-pathogène, car cela peut être utilisé comme un contrôle positif pour la visualisation de la croissance bactérienne planta. Aussi inoculer le contrôle de vecteur (TRV :: 00) plantes.

3. Observation des in planta croissance des bactéries pathogènes

  1. Exposer les feuilles inoculées à une lumière UV de grande longueur d'onde dans l'obscurité. Les colonies bactériennes peuvent être considérés comme points fluorescents verts dans le côté abaxial de la feuille dans le fond de la fluorescence rouge émise par la surface de la feuille.
  2. Observer la croissance des pathogènesde 2 jours après l'inoculation (ppp) à 5 dpi. L'observation de tous les jours pendant cet intervalle de temps est nécessaire.
  3. Après le premier écran, la sélection des clones dont les silencing entraîne la croissance d'un ou plusieurs agent pathogène non hôte (s).
  4. Répétez VIGS pour les clones sélectionnés et encore tester la réponse des gènes des plantes silencieux à des agents pathogènes non hôte (s). Ce deuxième niveau de contrôle est fait pour éliminer les faux positifs obtenus au cours du premier écran.

4. Confirmation des plantes présélectionnés pour Résistance non hôte compromise

  1. Taire les clones d'ADNc sélectionnées sur l'écran, comme décrit ci-dessus. Inoculer toute la plante avec pathogène non hôte (s) en immergeant les plantes avec des cultures pathogènes respectifs avec 0,01% (v / v) Silwet L-77 et en soumettant les plantes submergées à vide pendant 3 - 5 min. Quantifier la croissance bactérienne par dosage de croissance conventionnel 6,18,19 comme décrit ci-dessous.
  2. À 0 h après inoculation (HPI),3 et 5 dpi dpi, recueillir deux échantillons de feuilles de cinq répétitions biologique pour chaque agent pathogène non hôte (s) de feuilles inoculées à l'aide d'un poinçon feuille (0,5 cm 2). Broyer les échantillons de feuilles, de série diluée et la plaque de la sève sur gélose KB complété avec des antibiotiques appropriés et incuber à 28 ° C pendant 2 jours. Comptez le nombre de colonies bactériennes en utilisant un compteur de colonies et calculer la croissance bactérienne dans les feuilles telles que décrites dans la littérature précédente 6.
  3. Plantes sensibles aux agents pathogènes de non hôte (s) devraient montrer un nombre plus élevé de la croissance des pathogènes par rapport à la lutte antivectorielle.

5. Le séquençage de l'insert et identification de gène cible

  1. Effectuer colonie PCR pour le clone sélectionné à l'aide attB1 et attB2 amorces ou en utilisant les amorces flanquant le site de clonage dans le vecteur TRV2. Exécutez le produit PCR sur le gel et vérifier pour l'amplification de la bande unique.
  2. insertion de gènes des plantes dans le vecteur TRV2 peut être séquencé à l'aide attBamorces ou amorces flanquant le site de clonage.
  3. Effectuer BLAST en utilisant la séquence et identifier les détails de gènes.
  4. Obtenir séquence du gène pleine longueur avec les régions non traduites (UTR).
  5. Sélectionnez 300-400 pb fragments de trois régions différentes de la séquence et de les cloner dans TRV2 vecteur. Effectuer indépendamment VIGS en utilisant tous les trois constructions de VIGS et confirmer le compromis de résistance non hôte dans les trois usines réduits au silence des gènes.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'objectif majeur de cette étude est de démontrer une méthode pour l'identification facile et précise d'un gène silencieux N. benthamiana qui sont compromises pour la résistance non hôte. Il ya quatre grandes étapes de cette méthodologie. La première étape est de faire taire individuellement grand nombre de gènes en utilisant TRV-VIGS. Nous avions fait taire environ 5.000 gènes 6,18 sur une période d'environ 1,5 ans en utilisant le protocole décrit à la figure 1. Certains des gènes des plantes silencieux montré diverses modifications phénotypiques, y compris un retard de croissance, le jaunissement et le photo-blanchiment phénotypes (Figure 2).

Deuxième étape est l'identification des gènes des plantes silencieux montrant la sensibilité aux agents pathogènes non hôte (s). Nous avons utilisé des bactéries exprimant GFPuv et suivi leur croissance in planta (figures 3A-3C). Afin de démontrer le processus d'identification du gène plantes sensibles au non hôte p silenceathogen (s), nous avons utilisé trois agents pathogènes non hôtes, P. syringae pv. tomato T1, P. syringae pv. glycinea et X. campestris pv. vesicatoria. Comme prévu, le non-taire (lutte antivectorielle) N. benthamiana inoculés avec ces agents pathogènes ne se développent pas comme ils ne pouvaient pas surmonter l'immunité des plantes. Cependant, P. syringae pv. tomato T1 formé colonies fluorescentes vertes sur NbSGT1 gène (un gène impliqué dans la résistance non hôte 25) des plantes silencieux (figure 3D). Ces données démontrent le processus d'identification des gènes des plantes silencieux compromis pour la résistance non hôte. Ce protocole peut être directement appliqué à transmettre dépistage génétique. Par exemple, les résultats représentatifs prélevés dans l'un de nos écran précédent génétique vers l'avant (figure 4) montre deux gènes végétaux silencieux indépendantes avec différents degrés de P. syringae pv. tomato croissance T1 (Figure 5

La troisième étape est la confirmation de la croissance bactérienne dans les gènes végétaux silencieux identifiées à partir de l'écran par la quantification de la croissance bactérienne. Un exemple pour l'estimation de la croissance bactérienne in planta dans le gène NbSGT1 plantes silencieux est représenté en figure 3E. Les résultats ont montré que la croissance planta de P. syringae pv. tomato T1 était beaucoup plus élevé dans les NbSGT1 plantes silencieux par rapport aux plants témoins non-taire (TRV :: 00) (figure 3F). La perte de résistance non hôte due à une inactivation de gène particulier peut être partielle ou complète. Selon ce, dans la mesure de la croissance des pathogènes non hôte sur les gènes des plantes silencieux peut varier.

Quatrième étape est le séquençage de l'insert dans TRV2 vecteur. BLAST est effectuée en utilisant cette séquence pour identifier le gène et ses détails.

Figure 1 Figure 1. Bande dessinée montrant les étapes à faire taire un grand nombre de gènes en utilisant VIGS VRT basées. Trois semaine N. benthamiana sont transplantées dans des pots individuels et autorisés à se développer pendant quelques jours. Agrobacterium portant TRV1 construction est infiltré dans trois à quatre feuilles à l'aide de la seringue inutile. Plus tard, 96 clones d'ADNc cultivées sur plaque de gélose LB sont prises individuellement à l'aide d'un cure-dent et dressées à l'endroit inoculé TRV1 des usines respectives. Environ 3 semaines après l'inoculation, gene silencing cible se trouve dans les feuilles supérieures nouvellement cultivés non inoculés. Ces feuilles (5 e à 8 e) sont utilisés pour tester la croissance de l'agent pathogène non hôte (s).

Figure 2
Figure 2. VIGS médiation avant le dépistage génétique dansN. benthamiana montre divers changements dans le phénotype de la plante. Trois semaine N. benthamiana inoculés indépendamment avec VRT respective concepts comme les aperçurent dans la figure 1 comme une partie de l'écran vers l'avant génétique sont affichés. Les photographies ont été prises 21 jours après inoculation VRT.

Figure 3
Figure 3. Fluorescence verte de GFPuv exprimer pathogènes bactériens et son utilisation pour l'identification des gènes impliqués dans la résistance non hôte. Pseudomonas syringae pv. Tabaci, un hôte-pathogène, portant GFPuv construire strié sur la plaque KB-support présente une fluorescence verte sous la lumière UV de grande longueur d'onde dans l'obscurité ( A). Ces bactéries sont cultivées sur un milieu KB et remis en suspension dans l'eau (B) et inoculés sur N. benthamiana 4 CFU / ml). Au bout de 3 jours après l'inoculation (dpi) colonies bactériennes sont considérées comme des taches fluorescentes vertes à l'oeil nu d'un côté abaxial des cellules épidermiques feuilles (C, à gauche). La même feuille photographié sous une lumière normale (visible) est également indiquée (C, à droite). GFPuv exprimer P. syringae pv. tabaci (Pstab, 1 x 10 4 ufc / ml) et de trois agents pathogènes non hôtes, P. syringae pv. tomate T1 (PstT1, 1 x 10 4 ufc / ml), P. . syringae pv glycinea (PSG, 3 x 10 5 UFC / ml) et Xanthomonas campestris pv vesicatoria (XCV, 3 x 10 4 CFU / ml) sont inoculés sur le côté abaxial de feuilles de lutte contre les vecteurs (TRV :: 00.; D, à gauche) et NbSGT1 gènes végétaux silencieux (D, à droite). Les colonies bactériennes de Pstab sont visibles sur les feuilles et celles des PstT1 ne sont vus que sur la Ngène bSGT1 taire feuilles. PstT1 croissance dans le gène NbSGT1 silence feuilles chiffré à 24, 24 et 72 heures après l'inoculation (HPI, E) est représentée dans le graphique. Cliquez ici pour agrandir la figure .

Figure 4
Figure 4. Vue d'ensemble de protocole suivi pour VIGS médiation avant le dépistage génétique pour l'identification de gènes impliqués dans la résistance non hôte. Une banque d'ADNc dans TRV2 vecteur construit en utilisant l'ARN à partir de pathogène non hôte (s) inoculé N. benthamiana feuilles peuvent être utilisés pour le dépistage. Les clones individuels de la banque d'ADNc sont réduits au silence en N. benthamiana par TRV-VIGS. GFPuv respectifs exprimant bactérie pathogène non hôte (s) sont inoculés sur les gènes feuilles des plantes silencieux. Entre 2 et4 ppp les points inoculés sont observés à l'aide d'une lampe UV dans l'obscurité et les plantes montrant la croissance des pathogènes non hôte sont identifiées. Après cet examen préliminaire, les clones sélectionnés sont réduits au silence à nouveau et la croissance des pathogènes non hôte est confirmé. Cet écran de second niveau est fait pour éliminer les faux positifs. Plus tard, des clones confirmés sont réduits au silence pour une troisième fois et la croissance bactérienne respective est estimée. Inserts de clones respectifs dans le vecteur TRV2 sont séquencées et l'information génétique est identifiée. Simultanément test HR peut également être effectuée sur les gènes des plantes silencieux pour identifier les gènes qui contribuent aux RH induite contre les agents pathogènes non hôtes de type II.

Figure 5
Figure 5. La croissance des pathogènes bactériens non hôte dans le gène silencieux plantes qui ont été identifiés comme faisant partie d'un écran génétique avant. Des photos de l'forward génétique dépistage que les gènes identifiés impliqués dans la résistance non hôte de N. benthamiana contre PstT1, le PSG et XCV. Les photographies prises pendant deux gènes végétaux silencieux représentatives à 3 dpi après inoculation sont présentées ici. Concentrations bactériennes utilisées pour l'inoculation sont décrits dans la figure 3. 43D4 ou 94C1 indique le numéro de la plaque de 96 puits, suivie du numéro bien.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

l'immunité des plantes limite la croissance des agents pathogènes non hôtes et, par conséquent, peu ou pas de fluorescence verte est émise à partir de plantes de lutte antivectorielle feuilles inoculées avec des agents pathogènes non hôte sous une lumière UV de grande longueur d'onde (figure 3D). Cependant, quand un gène impliqué dans la résistance non hôte est réduit au silence, le gène silencieux plantes favorisent la croissance des agents pathogènes et de fluorescence verte non hôte est vu (figure 3F). C'est le principe de base de la méthode décrite dans ce manuscrit. Cette méthode a deux avantages majeurs sur l'analyse basées sur la FC. Un, l'identification des plantes silencieux sensibles aux agents pathogènes non hôte par dosage GFPuv basée augmente la précision que la croissance planta peut être consulté. Deuxièmement, cette méthode permet d'identifier les gènes impliqués dans les deux type I résistance non hôte 2,26 (ne conduit pas à la mort cellulaire visible) et de type II résistance non hôte 2,26 (entraîne la mort de la cellule de réaction d'hypersensibilité).Par exemple, nous avons déjà identifié un clone appelé 6C8 et les usines silencieuses étaient sensibles à la fois de type 1 et de type 2 agents pathogènes 18.

En outre, il est possible que deux ou plusieurs clones indépendants utilisés pour VIGS entraîné gènes des plantes silence avec des phénotypes similaires car ils arrivent à faire taire un gène particulier. Cette redondance est utile car il confirme le phénotype de silence. La réalisation de ces répétitions dépend de la bibliothèque utilisée pour le dépistage et le type de gène (comme certains gènes sont fortement exprimés et donc se répètent dans une bibliothèque). En outre, le clonage quasi-totalité des gènes codés par N. génome benthamiana dans une bibliothèque VIGS ADNc et les réduire au silence est, indépendamment possible.

Pour mettre en œuvre efficacement le dépistage génétique avant pour l'identification des gènes impliqués dans la résistance non hôte en utilisant VIGS suivis par analyse de fluorescence GFPuv, les conseils suivants sont utiles.

Afinpour VIGS succès (1), utiliser 3 - 4 plantes au stade de la feuille de VRT inoculation, (2) un optimum TRV1 et TRV2 titre est important. Depuis TRV2 titre peut être un facteur limitant pour l'initiation de VIGS, inoculer au moins 4 colonies bactériennes entièrement cultivées de Agrobacterium TRV2, et (3) de maintenir des conditions environnementales optimales 12. Température de l'environnement joue un rôle majeur dans l'induction VIGS optimales.

Les étapes critiques pour la détection efficace de la fluorescence verte des agents pathogènes comprennent: (1) utiliser toujours cultures pathogènes frais récoltés lors de la phase de croissance exponentielle et ne les rangez pas avant l'inoculation, et (2) la mort cellulaire des ressources humaines doit être évitée, car ils peuvent auto fluorescence sous UV lumière et négativement influencer les observations. Ceci est particulièrement important lorsque de type II non hôte pathogène (par exemple, P. syringae pv. Tomato T1) est utilisé pour l'étude. Utilisez faible concentration de l'agent pathogène non hôte si HR microscopique est suspectée ou evidenced.

Dépannage:

(1) Incohérence dans gene silencing et l'apparition du phénotype silencieux variables parmi réplique:

Changer de gants pour chaque clone lors de l'ensemencement VRT. Aussi, assurez-vous que la colonie TRV2 Agrobacterium ne contient pas plusieurs clones par PCR sur colonie. Si colonie PCR révèle plus d'une bande, il est possible que plus d'un clone est présent dans la colonie. Afin de séparer les clones, leur série sur la plaque de gélose LB et l'écran des clones par PCR sur colonie. Après l'identification de clones individuels, effectuer VIGS indépendamment pour chacun d'eux et identifier le gène silencieux usine compromettre la résistance de non hôte.

(2) Les défauts de croissance important dans les usines silencieuses:

Si le gène cible silence (s) est impliquée dans le métabolisme de base de plantes, des défauts de croissance sont attendus. Toutefois, certains des gènes régime réduit au silencets peut montrer supérieur multiplication des TRV par rapport aux plantes de lutte antivectorielle et cela peut provoquer un effet additif sur la gravité du phénotype. Essai de lésion locale 12 sur Chenopodium plantes amaranticolor peut être effectuée pour déterminer si les plantes ont plus silencieux titre TRV par rapport aux plantes de lutte antivectorielle. Dans ces circonstances, les plantes environ 4 semaines peuvent être utilisés pour VIGS pour réduire la sévérité du phénotype.

(2) hors-cible gene silencing:

Gene silencing non spécifique, souvent désigné comme silencing hors cible peut se produire pendant VIGS. Cela se produit quand une homologie de séquence partielle permet siRNA généré pour le gène cible destinées à dégrader les ARNm des gènes qui ne sont pas les objectifs escomptés de silencieux 27. Utilisez séquences UTR comme insert dans le vecteur TRV2. Étude de la régulation négative du gène endogène de tous les gènes hors-cible attendus et assurez-vous que le silence de construire un seul gène d'intérêt. To faciliter l'identification des fragments de gènes avec un minimum ou pas hors cible, outils bioinformatiques peuvent être utilisées (par exemple, http://plantgrn.noble.org/pssRNAit/ ).

(3) Aucune fluorescence verte à partir de colonies bactériennes dans la plante:

Cela se produit le plus probable par l'utilisation de plus de cultures cultivées. Une autre cause pourrait être inoculum bactérien moindre. Bien que les concentrations bactériennes peuvent être mesurés indirectement en mesurant la densité optique DO 600, les cellules bactériennes mortes peuvent faire monter plus haut OD. Il est recommandé de calculer la concentration bactérienne optimale basée sur des unités formant colonie (ufc) par comptage des cellules vivantes sur la plaque de gélose KB. Valeurs de DO peuvent être ajustés en fonction de la CFU. Aussi, strie l'agent pathogène le plus souvent possible à partir du stock de glycérol, de grandir sur la plaque de gélose KB et inoculer seule colonie frais pour préparer des cultures pour l'inoculation.

Une cause survenant généralement pour des difficultés avec le séquençage de l'insert dans TRV2 vecteur (par colonie PCR) est la présence de plusieurs colonies. Pour remédier à cela, clones abritant individu construction TRV2 doivent être isolés comme mentionné ci-dessus (n ° 1).

Limites de la méthode GFPuv et moyens de surmonter:

Les agents pathogènes peuvent perdre le GFPuv portant le plasmide pendant la multiplication et, par conséquent, influencer négativement les observations. En outre, certains des gènes des plantes silencieux montre le jaunissement et la photo-blanchiment feuilles et ces feuilles émettre une fluorescence différente (de rouge). Cela rend la fluorescence verte difficile à voir. Une des façons de réduire l'effet de l'auto fluorescence à partir des feuilles jaunes ou blanches est de capturer des photos des bactéries fluorescentes vertes à partir d'un appareil photo équipé de filtres qui peuvent éliminer ou réduire les effe de fondct. Les photos peuvent être utilisées pour déduire si les bactéries ont développé ou non. Certains logiciels (par exemple, Adobe Photoshop) peut être utilisé pour réduire l'effet de fond lors de l'analyse de ces images.

Biosécurité précautions comme l'élimination appropriée des agents pathogènes bactériens transgéniques doivent être suivies lors de l'expérimentation. En outre, la peau appropriée et boucliers de protection des yeux doivent être utilisés lors de la manipulation de la lampe UV.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Nous n'avons rien à révéler.

Acknowledgments

Ce projet a été financé par la Fondation Samuel Roberts Noble. Les auteurs remercient Mss. Janie Gallaway et Colleen Elles excellente pour l'entretien des plantes, et Mme Katie Brown pour les illustrations. Nous tenons également à remercier Mss. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda et M. Isaac Greenhut de l'aide technique lors de l'établissement de ce protocole.

Materials

Name Company Catalog Number Comments
96-well U-bottom plates Becton Dickinson Labware (Franklin Lakes, NJ, USA) 35-3077
96-pin replicator stainless steel Nalge Nunc International (Naperville, IL, USA) 250520
High Intensity UV Inspection Lamps, Model B-100ap Thomas scientific (Swedesboro, NJ, USA) 6283K50 Manufacturer ID 95-0127-01
Stuart SC6 colony counter Bibby Scientific Limited, Staffordshire, UK SC6PLUS
Soil-less potting mixture, Metro-Mix 350 SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers:
attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)
attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)
Integrated DNA Technologies, Inc (Coralville, IA, USA) Custom synthesized
MES, Monohydrate VWR international (Radnor, PA, USA) CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4’-hydroxyacetophenone) Sigma Aldrich (St. Louis, MO, USA) D134406
Vac-In-Stuff (Silwet L-77) Lehle Seeds (Round Rock, TX, USA) VIS-30

DOWNLOAD MATERIALS LIST

References

  1. Heath, M. C. Nonhost resistance and nonspecific plant defenses. Currrent Opinion in Plant Biology. 3, 315-319 (2000).
  2. Mysore, K. S., Ryu, C. -M. Nonhost resistance: how much do we know. Trends in Plant Science. 9, 97-104 (2004).
  3. Ellis, J. Insights into nonhost disease resistance: can they assist disease control in agriculture. The Plant Cell. 18, 523-528 (2006).
  4. Senthil-Kumar, M., Mysore, K. S. Nonhost resistance against bacterial pathogens: retrospects and prospects. Annual Review of Phytopathology. 51, (2013).
  5. Lu, M., Tang, X., Zhou, J. -M. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. The Plant Cell. 13, 437-447 (2001).
  6. Rojas, C. M., et al. Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways. The Plant Cell. 24, 336-352 (2012).
  7. Daurelio, L. D., et al. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. Journal of Plant Physiology. 168, 382-391 (2011).
  8. Moreau, M., et al. EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora. Molecular Plant-Microbe Interactions. 25, 421-430 (2012).
  9. Senthil-Kumar, M., Mysore, K. S. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant, Cell & Environment. 35, 1329-1343 (2012).
  10. Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal. 39, 734-746 (2004).
  11. Senthil-Kumar, M., Mysore, K. S. New dimensions for VIGS in plant functional genomics. Trends in Plant Science. 16, 656-665 (2011).
  12. Senthil-Kumar, M., Mysore, K. S. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9, 797-806 (2011).
  13. Bombarely, A., et al. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).
  14. Sharma, P. C., et al. Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol Gen Genomics. 269, 583-591 (2003).
  15. Baulcombe, D. C. Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology. 2, 109-113 (1999).
  16. Lu, R., et al. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO Journal. 22, 5690-5699 (2003).
  17. Pozo, O., Pedley, K. F., Martin, G. B. MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23, 3072-3082 (2004).
  18. Wang, K., Senthil-Kumar, M., Ryu, C. -M., Kang, L., Mysore, K. S. Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast. Plant Physiology. 158, 1789-1802 (2012).
  19. Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytologist. 174, 212-223 (2007).
  20. Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal. 25, 237-245 (2001).
  21. MacFarlane, S. A. Molecular biology of the tobraviruses. Journal of General Virology. 80, 2799-2807 (1999).
  22. Anand, A., et al. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions. 20, 41-52 (2007).
  23. Liu, E., Page, J. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods. 4, 5 (2008).
  24. Velásquez, A. C., Chakravarthy, S., Martin, G. B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. (28), e1292 (2009).
  25. Peart, J. R., et al. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences. 99. 99-10869 (2002).
  26. Oh, S. -K., et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta. 223, 1101-1107 (2006).
  27. Senthil-Kumar, M., Mysore, K. RNAi and Plant Gene Function Analysis. Methods in Molecular Biology. Kodama, H., Komamine, A. 744, Humana Press. 13-25 (2011).
VIGS-Mediated dépistage génétique avant pour l'identification des gènes impliqués dans la résistance non hôte
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).More

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter