Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

VIGS-vermittelte Stürmer Genetics Screening zur Identifizierung von Genen in Nichtwirtresistenz Beteiligte

doi: 10.3791/51033 Published: August 23, 2013

Summary

Virus-induzierte Gen-Silencing ist ein nützliches Instrument zur Identifizierung von Genen in Nichtwirtresistenz von Pflanzen beteiligt. Wir demonstrieren die Verwendung von bakteriellen Erregern exprimieren GFPuv identifizieren Gen stumm Pflanzen anfällig Nichtwirt Krankheitserreger. Dieser Ansatz ist einfach, schnell und erleichtert groß angelegte Screening und ähnliches Protokoll zu studieren verschiedene andere Pflanzen-Mikroben-Interaktionen angewendet werden kann.

Abstract

Nichtwirt Krankheitsresistenz von Pflanzen gegen bakterielle Erreger wird durch komplexe Verteidigung Bahnen gesteuert. Das Verständnis dieses Mechanismus ist für die Entwicklung von dauerhaften Krankheit-resistente Pflanzen gegen breites Spektrum von Krankheitserregern wichtig. Virus-induzierte Gen-Silencing (VIGS)-basierte Screening vorwärts Genetik ist ein sinnvoller Ansatz zur Identifizierung von pflanzlichen Abwehr Gene verleihen Nichtwirtresistenz. Tobacco Rattle Virus (TRV)-basierte VIGS Vektor ist die effizienteste VIGS Vektor aktuell und wurde effizient genutzt auf endogene Zielgene in Nicotiana benthamiana Schweigen zu bringen.

In diesem Manuskript, zeigen wir eine vorausschauende Genetik Screening-Ansatz zum Schweigen einzelner Klone aus einer cDNA-Bibliothek in N. benthamiana und Bewertung der Reaktion Gen zum Schweigen Pflanzen für kompromittiert Nichtwirtresistenz gegen Nichtwirt Krankheitserreger Pseudomonas syringae pv. tomato T1, P. syringae pv. glycinea und X. campestris pv. vesicatoria. Diese bakterielle Pathogene sind ausdrücklich GFPuv Protein entwickelt und ihre grün fluoreszierende Kolonien können mit bloßem Auge unter UV-Licht in den Nichtwirt Pathogen inokulierten Pflanzen gesehen werden, wenn das Schweigen Zielgens in der Vermittlung Nichtwirtresistenz beteiligt ist. Dies erleichtert zuverlässigere und schnellere Identifizierung von Gen-Pflanzen anfällig für Schweigen Nichtwirt Krankheitserreger. Ferner kann aussichtsreicher Kandidat Gen-Informationen durch Sequenzierung der Anlage Geninsert in TRV Vektor bekannt sein. Hier zeigen wir die hohen Durchsatz Fähigkeit VIGS-vermittelte vorwärts Genetik, um Gene in Nichtwirtresistenz beteiligt sind. Etwa kann 100 cDNAs einzeln in etwa zwei bis drei Wochen und ihre Relevanz in Nichtwirtresistenz gegen mehrere bakterielle Erreger Nichtwirt zum Schweigen gebracht werden kann in einer Woche danach untersucht werden. In diesem Manuskript, aufzuzählen wir die einzelnen Schritte in diesem Screening beteiligt. VIGS-vermittelte vorwärts Genetik screening Ansatz kann nicht nur zur Identifizierung von Genen in Nichtwirtresistenz beteiligt, sondern auch auf das Studium Gene verleihen mehreren biotischen und abiotischen Stress Toleranzen in verschiedenen Pflanzenarten verlängert werden.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nichtwirtresistenz ist der Widerstand aller Pflanzenarten gegen Rassen eines bestimmten Erregers 1,2. Dies verleiht breites Spektrum und dauerhafte Resistenz gegen Krankheiten bei Pflanzen 2,3. Allerdings ist der Mechanismus, insbesondere gegen bakterielle Krankheitserreger, nicht gut 4 verstanden. Screening nach Mutanten oder Pflanzen, die zum Schweigen gebracht Kompromiss Nichtwirtresistenz und hohen Durchsatz Transkript-Profiling zur Identifizierung differentiell exprimierter Gene während Nichtwirtresistenz 5-9 zwei wichtige Ansätze zuvor zum Präparieren bakterielle Nichtwirtresistenz verwendet werden. Weil Nichtwirtresistenz durch einen komplexen Mechanismus (s) 4 mit der Beteiligung vieler Gene, einen hohen Durchsatz funktionellen Genomik für die Gen-Identifizierung gesteuert wird, ist entscheidend für ein besseres Verständnis der Nichtwirtresistenz Mechanismus (n).

Virus-induzierte Gen-Silencing (VIGS) wurde erfolgreich eingesetzt, um endogenen pflanzlichen SchweigenGene in vielen Pflanzenarten 10,11. Nicotiana benthamiana ist eines der am besten geeigneten Pflanzen für VIGS 10,12 und ihren Entwurf Genomsequenz ist jetzt 13. Tobacco Rattle Virus (TRV)-basierte VIGS wurde weithin als reverse genetics Werkzeug um Gene in Nichtwirtresistenz 2,4,14 beteiligt zu charakterisieren. Diese VIGS Vektoren und Derivate sind jetzt durch Arabidopsis Biological Resource Center (ABRC, verfügbar http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html ). VIGS auch als Vorwärts Genetik Werkzeug zur Identifizierung von Genen in Pflanzenzellen Immunität 15-17, insbesondere Nichtwirtresistenz 6,18 beteiligt verwendet. Beurteilung überempfindlich Reaktion (HR)-vermittelten Zelltod von Pflanzen gegen ein bestimmtes Pathogen Nichtwirt induziert und die Beurteilung der Krankheit induzierten Zelltod sind zwei wichtige Tests vor allem für identifyin verwendetg anfällig Gen zum Schweigen Pflanzen. Allerdings HR Zelltod werden nur gegen Typ-II Nichtwirt Erreger induziert und nicht gegen die Typ-I Nichtwirt Krankheitserreger 2. Daher können HR-Assays nicht universell verwendet werden, um Nichtwirtresistenz Strategien der Pflanzen zu identifizieren, vor allem gegen breite Palette von Typ-I Nichtwirt Krankheitserreger. Auch dann, wenn teilweisen Verlust Nichtwirtresistenz in einem Gen zum Schweigen Anlage nicht immer Krankheitssymptome 6 und damit Krankheit Scoring nicht zur Identifizierung von Pflanzen beeinträchtigen Nichtwirtresistenz verwendet werden kann führen. Im Gegenteil, der Bewertung des Wachstums von Pathogenen Nichtwirt im Gen stumm Pflanzen ein besseres Verfahren zur Untersuchung der Verlust Nichtwirtresistenz in Gen stumm Pflanzen.

Im Vergleich zu herkömmlichen Wachstumstest 6,19, eine schnellere Methode zur Beurteilung Nichtwirt Bakterienwachstum auf den Gen zum Schweigen Pflanzen können die Zeit verkürzen, für Vorwärts-Genetik Screening erforderlich. Wir bereits berichtet, ein Verfahren zur Beobachtung Bakterienl Wachstum des Pathogens auf Blättern mit dem bloßen Auge unter ultraviolettem (UV) Licht unter Verwendung von Bakterien, die grün fluoreszierendes Protein (GFP) 19. In diesem Manuskript wir demonstrieren die Nützlichkeit der GFPuv Ausdruck Nichtwirt bakteriellen Erregern für eine einfache Identifizierung von Gen-Pflanzen, die zum Schweigen gebracht für Nichtwirtresistenz gefährdet sind. Diese Methodik ist genau für die Identifizierung von anfälligen Pflanzen und zugänglich für das Hochdurchsatz-Screening.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Plant Growth and Target Gene Silencing

  1. Pflanzenwachstum Bedingungen:
    1. Sow N. benthamiana Samen auf erdlosen Blumenerde Mischung, Metro-Mix 350 und keimen die Samen in einer Klimakammer. Jede andere Boden-oder Boden-less Medium kann auch anstelle von Metro-Mix verwendet werden.
    2. Transplant drei Wochen alte Sämlinge in einzelne Töpfe und wachsen sie in einem Gewächshaus bei 21 ± 2 ° C zusammen mit anderen Wachstumsbedingungen wie in früheren Literatur 12. Zwei bis drei Tage nach dem Umpflanzen, können Pflanzen für TRV Impfung verwendet werden.
  2. Wachsende TRV2 Klone:
    TRV ist eine zweigeteilte Virus und seine Genom besteht aus RNA1 und RNA2. RNA1 kodiert für eine RNA-abhängige RNA-Polymerase und eine Bewegung Protein 20,21. RNA2 codiert für ein Hüllprotein (CP) und zwei nicht-strukturellen Proteine ​​von den subgenomischen RNAs 21. Sowohl RNA1 und RNA2 sind für die Bildung von reifen vir erforderlichuns Partikel und ihre Ausbreitung 20,21. cDNA-Bibliothek Bau in TRV2 Vektor wird in bisherigen Literatur beschrieben 22,23. Kurz gesagt, wurde VIGS Bibliothek in dieser Studie verwendet der RNA aus Blattgewebe ausgesetzt verschiedenen biotischen und abiotischen Auslöser extrahiert aufgebaut.
    1. Nehmen Sie Agrobacterium (Stamm GV2260), die die cDNA-Klone in TRV2 Vektor (a 96-Well-Platte) aus dem Gefrierschrank. Allmählich tauen sie und nach die Kulturen Raumtemperatur kommen, impfen die einzelnen Agrobacterium Kultur auf Luria-Bertani (LB)-Agar-Platte mit Rifampicin (10 ug / ml) und Kanamycin (50 ug / ml) mit einem 96-Pin-Replikator.
    2. Die Inkubation bei 28 ° C für zwei Tage. Wir wachsen in der Regel vier Kolonien Replikat für jeden Klon so dass eine ausreichende Agrobacterium Inokulum ist für Prick Impfung von zwei Pflanzen. Führen Sie alle Schritte unter sterilen Bedingungen.
  3. VIGS:
    1. WachsenAgrobacterium (GV2260) tragenden TRV1 bei 28 ° C in LB-Flüssigmedium mit Antibiotika erwähnt. Ernten Sie die Zellen durch Zentrifugation aus über Nacht gewachsenen Kulturen, in der Impfung Puffer resuspendieren (10 mM MES, pH 5,5, 200 pM Acetosyringon) und Inkubation für 3 Stunden bei Raumtemperatur auf einem Schüttler bei 50 Umdrehungen pro Minute.
    2. Ernten Sie die Zellen durch Zentrifugation und in 5 mM MES-Puffer (pH 5,5) und impfen (OD 600 = 0,3) resuspendieren in abaxial Seite 3-4 N. benthamiana Blätter mit einer Spritze ohne Nadel. Detaillierte Impfung Vorgehensweise ist in bisherigen Literatur 24 demonstriert. Später, auf dem Gelände des TRV1 Impfung impfen jeweiligen TRV2 Kolonien durch Einstechen die Blätter mit einem Zahnstocher.
    3. Pflegen Sie die Pflanzen mit einer angemessenen Ernährung als kräftiges Wachstum ist für eine effiziente VIGS 12 wichtig. Etwa zwei Wochen nach der Impfung wurden die Transkripte von gezielten Gene beginnt zu reduzieren und die Pflanzen sind bereit für Erreger inokordnung drei Wochen nach der Impfung TRV.

2. Vorbereitung der Kulturen Nichtwirt Pathogen und Pflanze Impfung

  1. Details von Pathogenen in dieser Studie verwendet:
    Pseudomonas syringae pv. Tabaci, P. syringae pv. tomato T1, P. syringae pv. glycinea und Xanthomonas campestris pv. vesicatoria werden in dieser Studie verwendet. Wachsen P. syringae Stämmen in Königs B (KB) flüssigen Medium mit Rifampicin (10 ug / ml), Kanamycin (50 ug / ml) bei 28 ° C für 12 h ergänzt. Wachsen X. campestris pv. vesicatoria in LB-Flüssigmedium für 16 Stunden. Alle Krankheitserreger beherbergen, die ein Plasmid GFPuv ausdrücken können wie in den vergangenen 19 Literatur beschrieben.
  2. Vorbereitung der Kulturen Erreger für Pflanze Impfung:
    1. Ernte Bakterienzellen durch Zentrifugation und bestätigen das Vorhandensein der grünen Fluoreszenz mit langen wavelength UV-Lampe in der Dunkelheit. Die Zellen werden zweimal mit sterilem Wasser und Resuspendieren sie auf die gewünschte Konzentration unter Verwendung von sterilem Wasser.
    2. Impfen die jeweiligen Erreger (s) auf abaxial Seite des Zielgens Schweigen Blätter (5. bis 8.) als Punkte (ca. 1,5 cm Durchmesser). Mehrere Nichtwirt Krankheitserreger können gleichzeitig für ihr Wachstum in den Ziel-Gen zum Schweigen Pflanzen getestet werden. Gleichzeitig inokulieren Wirt-Pathogen wie dies als eine positive Kontrolle für die Anzeige in planta Bakterienwachstum verwendet werden können. Auch impfen Vektor-Kontrolle (TRV :: 00) Pflanzen.

3. Beobachtung der in planta Wachstum von bakteriellen Erregern

  1. Freilegen beimpften Blättern zu einem langwelligem UV-Licht in der Dunkelheit. Bakterienkolonien können als grün fluoreszierende Punkte im abaxial Seite des Blattes in den Hintergrund der roten Fluoreszenz durch Blattoberfläche emittiert eingesehen werden.
  2. Beachten Wachstum des Pathogensab 2 Tage nach der Inokulation (dpi) bis 5 dpi. Everyday Beobachtung während dieser Zeitspanne ist notwendig.
  3. Nachdem der erste Bildschirm, kurze Liste der Klone, deren Ergebnisse in Silencing Wachstum von einem oder mehreren Nichtwirt Erreger (s).
  4. Wiederholen VIGS für die ausgewählten Klone und wieder testen Sie die Reaktion von Gen-Pflanzen zu Schweigen Nichtwirt Erreger (s). Diese zweite Ebene des Screenings wird getan, um die Fehlalarme im ersten Bildschirm erhalten zu entfernen.

4. Bestätigung der Shortlist für Pflanzen Compromised Nichtwirtresistenz

  1. Bringt das cDNA-Klone aus dem Bildschirm wie oben beschrieben gewählt. Inokulieren die gesamte Anlage mit Nichtwirt Erreger (en) durch Eintauchen der Pflanzen mit jeweiligen Erregerkulturen mit 0,01% (v / v) Silwet L-77 und Unterziehen der eingetauchten Pflanzen für 3 Vakuum - 5 min. Quantifizieren des Bakterienwachstums durch herkömmliche Wachstumsassay 6,18,19 wie unten beschrieben.
  2. Bei 0 h nach Inokulation (hpi),3 und 5 dpi dpi, sammeln zwei Blatt Proben von fünf biologischen Wiederholungen für jede Nichtwirt Erreger (s) geimpft Blätter mit einem Blatt Stempel (0,5 cm 2). Grind die Blattproben, serielle Verdünnung und Platte der Saft auf KB-Agar-Medium mit entsprechenden Antibiotika und Inkubation bei 28 ° C für 2 Tage ergänzt. Zählen Sie die Bakterienkolonien mit einer Kolonie Zähler und berechnen die das Wachstum von Bakterien in den Blättern wie in früheren Literatur 6 beschrieben.
  3. Pflanzen anfällig für Nichtwirt Erreger (s) sollten zeigen höhere Anzahl von Pathogen Wachstum im Vergleich zu Vektor-Kontrolle.

5. Die Sequenzierung der Insert und Identifizierung von Ziel-Gene

  1. Führen Kolonie-PCR für das ausgewählte Klon mit attB1 und attB2 Primer oder Verwendung der Primer flankieren die Klonierungsstelle im Vektor TRV2. Führen Sie das PCR-Produkt auf dem Gel und prüfen für die Amplifikation der einzigen Band.
  2. Pflanzengenexpression Einsatzes in der TRV2 Vektor kann sequenziert werden mit attBPrimer oder Primer flankieren Klonierungsstelle.
  3. Führen Sie mit dem BLAST-Sequenz und Identifizierung der Gen Details.
  4. Erhalten Gensequenz voller Länge zusammen mit den un-translatierten Regionen (UTRs).
  5. Wählen 300-400 bp-Fragmente aus drei verschiedenen Bereichen der Sequenz und klonen in TRV2 Vektor. Unabhängig durchführen VIGS mit allen drei VIGS Konstrukte und bestätigen den Kompromiss von Nichtwirtresistenz in allen drei Gen zum Schweigen Pflanzen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hauptziel dieser Studie ist es, ein Verfahren zur einfachen und genauen Identifizierung von Gen zum Schweigen N. demonstrieren benthamiana Pflanzen, die für Nichtwirtresistenz gefährdet sind. Es gibt vier große Schritte in diese Methodik. Erster Schritt ist einzeln Schweigen Vielzahl von Genen mit TRV-VIGS. Wir hatten Schweigen etwa 5000 Gene 6,18 über einen Zeitraum von ca. 1,5 Jahre unter Verwendung des Protokolls in Abbildung 1 dargestellt. Einige der Gen zum Schweigen Pflanzen zeigten verschiedene phänotypische Veränderungen einschließlich Wachstumsstörungen, Vergilbung und Fotobleichen Phänotypen (Abbildung 2).

Im zweiten Schritt wird die Identifizierung von Gen stumm Pflanzen mit Anfälligkeit für Nichtwirt Pathogen (e). Wir verwendeten GFPuv exprimierenden Bakterien und verfolgt ihr Wachstum in planta (3A-3C). Um den Prozess der Identifikation des Gens nachweisen Schweigen Pflanzen anfällig Nichtwirt pathogen (s), verwendeten wir drei Nichtwirt Pathogenen P. syringae pv. tomato T1, P. syringae pv. glycinea und X. campestris pv. vesicatoria. Wie erwartet, nicht zum Schweigen gebracht (vector control) N. benthamiana Pflanzen mit diesen Erregern geimpft nicht wachsen, da sie nicht überwinden konnte die Anlage Immunität. Allerdings P. syringae pv. tomato T1 gebildet grün fluoreszierenden Kolonien auf NbSGT1 Gens (ein Gen in Nichtwirtresistenz 25 impliziert) Schweigen Pflanzen (Abbildung 3D). Diese Daten zeigen den Prozess der Identifizierung von Gen-Pflanzen für Schweigen Nichtwirtresistenz kompromittiert. Dieses Protokoll kann direkt angewendet werden, um Genetik Screening zu übermitteln. Zum Beispiel zeigt die repräsentativen Ergebnisse aus einem unserer früheren vorwärts Genetik (Abbildung 4) genommen zwei unabhängige Gen zum Schweigen Pflanzen mit unterschiedlichem Grad der P. syringae pv. tomato T1 Wachstum (Abbildung 5

Dritter Schritt ist die Bestätigung des bakteriellen Wachstums in der Gen-Pflanzen Schweigen vom Bildschirm durch die Quantifizierung der bakteriellen Wachstums identifiziert. Ein Beispiel für die Abschätzung der in planta Bakterienwachstum in den NbSGT1 Gen zum Schweigen Pflanzen in 3E gezeigt. Die Ergebnisse zeigten, dass in planta Wachstum von P. syringae pv. tomato T1 war viel höher in den NbSGT1 Schweigen Pflanzen im Vergleich zu Nicht-Schweigen (TRV :: 00) Kontrollpflanzen (3E). Der Verlust der Nichtwirtresistenz aufgrund einer bestimmten Gen-Silencing könnte entweder teilweise oder vollständig. Abhängig davon, kann das Ausmaß der Nichtwirt Erreger Wachstum auf den Gen zum Schweigen Pflanzen variieren.

Vierter Schritt wird die Sequenzierung des Einsatzes in TRV2 Vektor. BLAST unter Verwendung dieser Sequenz, das Gen und seinen Einzelheiten zu identifizieren.

Abbildung 1 Abbildung 1. Cartoon zeigt die Schritte zum Schweigen eine große Anzahl von Genen mit TRV-basierte VIGS beteiligt. Drei Wochen alten N. benthamiana Pflanzen in einzelne Töpfe verpflanzt und dürfen für ein paar Tage wachsen. Agrobacterium Durchführung TRV1 Konstrukt wird in drei bis vier Blätter mit unnötigen Spritze infiltriert. Später werden 96 cDNA-Klone auf LB-Agar-Platte gewachsen einzeln aufgenommen mit einem Zahnstocher und stach auf das TRV1 geimpft Stelle des jeweiligen Pflanzen. Etwa 3 Wochen nach der Impfung tritt Ziel Gen-Silencing in den Top unbeimpft neu gewachsenen Blättern. Diese Blätter (5. bis 8.) sind für die Prüfung des Wachstums von Nichtwirt Erreger (s) verwendet.

Abbildung 2
Abbildung 2. VIGS-vermittelte vorwärts Genetik Screening inN. benthamiana zeigt verschiedene Änderungen in Anlage Phänotyp. Drei Wochen alten N. benthamiana Pflanzen unabhängig mit jeweiligen TRV geimpft Konstrukte wie in Abbildung 1 als Teil vorwärts Genetik Bildschirm erspäht werden angezeigt. Fotografien wurden 21 Tage nach der Impfung TRV gemacht.

Abbildung 3
Abbildung 3. Grüne Fluoreszenz von GFPuv Ausdruck bakterielle Erreger und seine Verwendung für die Identifizierung von Genen, die in Nichtwirtresistenz beteiligt. Pseudomonas syringae pv. Tabaci, ein Wirt-Pathogen, Durchführung GFPuv konstruieren ausgestrichen auf KB-mittlere Platte zeigt grüne Fluoreszenz unter langwelligem UV-Licht in der Dunkelheit ( A). Diese Bakterien sind auf KB-Medium und in Wasser (B) resuspendiert und geimpft auf N. benthamiana 4 KBE / ml). Nach 3 Tagen nach der Impfung (dpi) Bakterienkolonien werden als grün fluoreszierenden Flecken mit bloßem Auge aus abaxial Seite Blattepidermiszellen Zellen (C, links) angesehen. Das gleiche Blatt unter normalem Licht (sichtbar) abgebildet wird auch gezeigt, (C, rechts). GFPuv Ausdruck P. syringae pv. tabaci (Pstab, 1 x 10 4 KBE / ml) und drei Nichtwirt Krankheitserreger, P. syringae pv. tomato T1 (PstT1, 1 x 10 4 KBE / ml), P. . syringae pv glycinea (PSG, 3 x 10 5 KBE / ml) und Xanthomonas campestris pv vesicatoria (Xcv, 3 x 10 4 KBE / ml) auf der Seite des abaxial Blätter von Vektor-Kontrolle (TRV :: 00 geimpft. D, links) und NbSGT1 Gen zum Schweigen Pflanzen (D, rechts). Bakterielle Kolonien Pstab auf beiden Blätter und denen PstT1 nur auf der N gesehenbSGT1 Gen zum Schweigen Blätter. PstT1 Wachstum in NbSGT1 Gen zum Schweigen Blätter quantifiziert bei 24, 24 und 72 Stunden nach der Impfung (HPI, E) ist in der Grafik dargestellt. Klicke hier, um eine größere Abbildung anzuzeigen .

Fig. 4
Abbildung 4. Übersicht von Protokoll für VIGS-vermittelte vorwärts Genetik Screening zur Identifizierung von Genen in Nichtwirtresistenz beteiligt gefolgt. Eine cDNA-Bibliothek in TRV2 Vektor konstruiert unter Verwendung von RNA aus Nichtwirt Erreger (s) geimpft N. benthamiana Blätter können für das Screening verwendet werden. Einzelne Klone aus der cDNA-Bibliothek in N. Schweigen benthamiana durch TRV-VIGS. Entsprechende GFPuv exprimieren Nichtwirt bakteriellen Erreger (s) auf, um das Gen stumm Pflanzenblätter inokuliert. Zwischen 2 und4 dpi die beimpften Flecken beobachtet unter Verwendung einer UV-Lampe in der Dunkelheit und die Pflanzen mit Nichtwirt Pathogen Wachstum ermittelt. Nach dieser Vorauswahl werden die ausgewählten Klonen wieder zum Schweigen gebracht und die Nichtwirt Erreger Wachstum bestätigt. Diese zweite Ebene Bildschirm geschieht, um die Fehlalarme zu entfernen. Später bestätigt Klone zum dritten Mal zum Schweigen gebracht und die jeweiligen Bakterien-Wachstum wird geschätzt. Fügt der jeweiligen Klone in der TRV2 Vektors sequenziert und Gen-Informationen identifiziert. Gleichzeitig HR Test können auch auf die Gen zum Schweigen Pflanzen durchgeführt werden, um Gene zu identifizieren, einen Beitrag zur HR induziert gegen Typ-II Nichtwirt Krankheitserreger.

Abbildung 5
Abbildung 5. Nichtwirt bakterielles Pathogen Wachstum in Gen zum Schweigen Pflanzen, die als Teil einer vorausschauenden Genetik Bildschirm identifiziert wurden. Bilder aus einem forward Genetik Screening identifizierten Gene, dass in Nichtwirtresistenz von N. beteiligt benthamiana Pflanzen gegen PstT1, PSG und Xcv. Offizielle Homepage für zwei repräsentative Gen zum Schweigen Pflanzen bei 3 dpi genommen nach der Impfung werden hier gezeigt. Bakterielle Konzentrationen für die Impfung verwendet werden, sind in 3 beschrieben. 43D4 oder 94C1 gibt die 96-Well-Platte durch die Anzahl und Nummer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Pflanze Immunität begrenzt das Wachstum von Krankheitserregern Nichtwirt und daher wenig oder gar keine grüne Fluoreszenz von Vektor-Kontrolle Anlage emittiert verlässt geimpft mit Nichtwirt Erreger unter langwelligen UV-Licht (3D). Allerdings, wenn ein Gen in Nichtwirtresistenz beteiligt Schweigen gebracht wird, bevorzugen die Gen-Pflanzen Schweigen das Wachstum der Erreger Nichtwirt und grüne Fluoreszenz zu sehen ist (Abbildung 3E). Dies ist das Grundprinzip des Verfahrens in diesem Manuskript beschrieben beteiligt. Diese Methode hat zwei große Vorteile gegenüber dem HF-basierte Assays. Eine, die Identifizierung von Schweigen Pflanzen anfällig Nichtwirt Erregers GFPuv-Assay wird die Genauigkeit in planta Wachstum betrachtet werden kann. Zweitens ermöglicht diese Methode Identifizierung von Genen, sowohl Typ-I Nichtwirtresistenz 2,26 (nicht im sichtbaren Zelltod führen) und Typ-II Nichtwirtresistenz 2,26 (Ergebnisse in überempfindlich Reaktion Zelltod) beteiligt.Zum Beispiel haben wir zuvor identifizierten einen Klon namens 6C8 und die zum Schweigen gebracht Pflanzen waren anfällig für sowohl Typ-1 und Typ-2-Erreger 18.

Auch ist es möglich, dass zwei oder mehr unabhängige Klone VIGS verwendet Gen stumm Pflanzen mit ähnlichen Phänotypen, wie sie ein bestimmtes Gen stumm passieren geführt. Diese Redundanz ist nützlich, da es die Silencing Phänotyp bestätigt. Das Auftreten von solchen Wiederholungen hängt von der Bibliothek für Screening und die Art der Gen (wie einige Gene hoch exprimiert werden und deshalb immer wieder auftreten in einer Bibliothek) verwendet. Ferner Klonen fast alle Gene von N. codiert benthamiana Genoms in einer cDNA-Bibliothek und zum Schweigen VIGS sie unabhängig ist möglich.

Um eine wirksame Umsetzung der vorwärts Genetik Screening zur Identifizierung von Genen in Nichtwirtresistenz mit VIGS durch GFPuv Fluoreszenzassay gefolgt beteiligt, sind die folgenden Tipps nützlich.

Umfür eine erfolgreiche VIGS, (1) verwenden 3 - 4-Blatt-Stadium Pflanzen für TRV Impfung, (2) eine optimale TRV1 und TRV2 Titer ist wichtig. Da TRV2 Titer ein limitierender Faktor für die Einleitung VIGS sein können, zu inokulieren mindestens 4 voll gewachsen Bakterienkolonien von Agrobacterium TRV2 und (3) zu halten optimalen Umgebungsbedingungen 12. Umgebungstemperatur spielt eine wichtige Rolle bei der Induktion optimale VIGS.

Kritische Schritte für eine effiziente Erkennung der grünen Fluoreszenz von Krankheitserregern gehören: (1) immer frisches Erreger Kulturen bei exponentiellen Wachstumsphase geerntet und speichern sie nicht vor der Impfung, und (2) HR Zelltod sollte vermieden werden, wie sie können auto werden fluoreszieren unter UV- Licht und negativ beeinflussen die Beobachtungen. Dies ist besonders wichtig, wenn Typ-II Nichtwirt Erreger (zB P. syringae pv. Tomato T1) für die Studie verwendet wird. Verwenden Sie niedrigere Konzentration des Erregers Nichtwirt wenn mikroskopische HR vermutet wird oder evidenced.

Fehlerbehebung:

(1) Inkonsistenz beim Gen-Silencing und das Auftreten von variablen Silencing Phänotyp unter den Wiederholungen:

Wechseln Sie die Handschuhe für jeden Klon während des TRV Impfung. Stellen Sie außerdem sicher, dass die TRV2 Agrobacterium Kolonie nicht enthalten mehrere Klone durch Kolonie-PCR. Wenn Kolonie PCR offenbart mehr als einem Band, ist es möglich, dass mehr als ein Klon in der Kolonie ist. Um die Klone zu trennen, sie in Serie auf der LB-Agar-Platte und Bildschirm die Klone durch Kolonie-PCR. Nach Identifizierung der einzelnen Klone, führen VIGS unabhängig für jeden von ihnen und identifizieren das Gen zum Schweigen Anlage beeinträchtigen Nichtwirtresistenz.

(2) Schwere Wachstum Mängel an den Anlagen zum Schweigen gebracht:

Wenn das Schweigen Zielgen (e) in Grundumsatz von Pflanzen beteiligt ist, werden Wachstumsstörungen erwartet. Doch einige Schweigen des Gens Plants können höhere Multiplikation des TRV Vergleich zu Vektor-Kontrolle Pflanzen zeigen und dies kann additiven Effekt auf die Schwere der Phänotyp führen. Lokale Läsion Assay 12 auf Chenopodium amaranticolor Pflanzen durchgeführt werden, um herauszufinden, ob die zum Schweigen gebracht Pflanzen höhere TRV Titer haben im Vergleich zu Vektor-Kontrolle Pflanzen werden. Unter diesen Umständen können die Pflanzen etwa 4 Wochen alt für VIGS verwendet werden, um die Schwere des Phänotyps zu reduzieren.

(2) Off-Target-Gen-Silencing:

Nicht-spezifische Gen-Silencing, die oft als Off-Target-Silencing bezeichnet werden während VIGS auftreten. Dies geschieht, wenn eine partielle Sequenzhomologie ermöglicht siRNA bei beabsichtigter Zielgen mRNA der Gene, die nicht die beabsichtigten Ziele Silencing 27 verschlechtern erzeugt. Verwenden UTR Sequenzen als Insert in der TRV2 Vektor. Studieren Sie das endogene Gen downregulation aller erwarteten Off-Target-Gene und stellen Sie sicher das Konstrukt Schweigen ein einzelnes Gen von Interesse. To erleichtern Identifizierung von Gen-Fragmente mit minimalen oder gar keinen Off-Target kann Bioinformatik-Tools verwendet (z. B. werden http://plantgrn.noble.org/pssRNAit/ ).

(3) Keine grüne Fluoreszenz von Bakterienkolonien in planta:

Dies geschieht wahrscheinlich durch die Verwendung von über-Kulturen. Eine weitere Ursache könnte geringerer Bakterieninokulum sein. Obwohl bakterielle Konzentrationen können indirekt durch Messung der optischen Dichte OD 600 gemessen werden, können tote Bakterienzellen bilden höhere OD. Es ist ratsam, um eine optimale Konzentration der Bakterien in koloniebildenden Einheiten (cfu) durch Zählen lebender Zellen auf der KB Agarmedium zu berechnen. OD-Werte auf der Basis des cfu eingestellt werden. Auch Streifen der Erreger so oft wie möglich aus dem Glycerin Lager, wachsen sie auf der KB-Agar-Platte und impfen einzelne frische Kolonie zur Herstellung von Kulturen für die Impfung.

Ein häufig vorkommende Ursache für Schwierigkeiten bei der Sequenzierung der Insert in TRV2 Vektor (durch Kolonie-PCR) ist die Anwesenheit von mehreren Kolonien. Um dies zu überwinden, sollten Klone, individuelle TRV2 Konstrukt isoliert wie oben erwähnt (# 1).

Einschränkungen der GFPuv Verfahren und Wege zu überwinden:

Krankheitserreger können die GFPuv tragendes Plasmid während Multiplikation und damit zu verlieren, negativ beeinflussen die Beobachtungen. Auch zeigt einige der Gen-Pflanzen Schweigen Vergilbung und Fotobleichen Blätter und diese Blätter emittieren verschiedenen Fluoreszenz (als rot). Dies macht die grüne Fluoreszenz schwer zu erkennen. Einer der Wege, um die Wirkung der automatischen Fluoreszenz von den gelben oder weißen Blätter zu reduzieren, ist um Bilder von den grün fluoreszierenden Bakterien mit Hilfe einer Kamera mit Filtern, die Beseitigung oder Verringerung der Hintergrund effe montiert erfassenct. Bilder können verwendet werden, um zu schließen, ob die Bakterien gewachsen sind oder nicht. Bestimmte Software (zB Adobe Photoshop) kann verwendet werden, um die Hintergrund-Effekt während der Analyse solcher Bilder verringern.

Biosafety Vorsichtsmaßnahmen wie die fachgerechte Entsorgung von transgenen bakterielle Krankheitserreger müssen während der Experimente folgen. Außerdem sollten geeignete Haut-und Augenschutz Schilde verwendet beim Umgang mit der UV-Lampe werden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Wir haben nichts zu offenbaren.

Acknowledgments

Dieses Projekt wurde von der Samuel Roberts Edle Foundation finanziert. Autoren danken Mss. Janie Gallaway und Colleen Elles für exzellente Pflanzenpflege und Frau Katie Brown für das Artwork. Wir würden auch gerne Mss danken. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda und Mr. Isaac Greenhut für technische Hilfe bei der Einrichtung dieses Protokoll.

Materials

Name Company Catalog Number Comments
96-well U-bottom plates Becton Dickinson Labware (Franklin Lakes, NJ, USA) 35-3077
96-pin replicator stainless steel Nalge Nunc International (Naperville, IL, USA) 250520
High Intensity UV Inspection Lamps, Model B-100ap Thomas scientific (Swedesboro, NJ, USA) 6283K50 Manufacturer ID 95-0127-01
Stuart SC6 colony counter Bibby Scientific Limited, Staffordshire, UK SC6PLUS
Soil-less potting mixture, Metro-Mix 350 SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers:
attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)
attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)
Integrated DNA Technologies, Inc (Coralville, IA, USA) Custom synthesized
MES, Monohydrate VWR international (Radnor, PA, USA) CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4’-hydroxyacetophenone) Sigma Aldrich (St. Louis, MO, USA) D134406
Vac-In-Stuff (Silwet L-77) Lehle Seeds (Round Rock, TX, USA) VIS-30

DOWNLOAD MATERIALS LIST

References

  1. Heath, M. C. Nonhost resistance and nonspecific plant defenses. Currrent Opinion in Plant Biology. 3, 315-319 (2000).
  2. Mysore, K. S., Ryu, C. -M. Nonhost resistance: how much do we know. Trends in Plant Science. 9, 97-104 (2004).
  3. Ellis, J. Insights into nonhost disease resistance: can they assist disease control in agriculture. The Plant Cell. 18, 523-528 (2006).
  4. Senthil-Kumar, M., Mysore, K. S. Nonhost resistance against bacterial pathogens: retrospects and prospects. Annual Review of Phytopathology. 51, (2013).
  5. Lu, M., Tang, X., Zhou, J. -M. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. The Plant Cell. 13, 437-447 (2001).
  6. Rojas, C. M., et al. Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways. The Plant Cell. 24, 336-352 (2012).
  7. Daurelio, L. D., et al. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. Journal of Plant Physiology. 168, 382-391 (2011).
  8. Moreau, M., et al. EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora. Molecular Plant-Microbe Interactions. 25, 421-430 (2012).
  9. Senthil-Kumar, M., Mysore, K. S. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant, Cell & Environment. 35, 1329-1343 (2012).
  10. Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal. 39, 734-746 (2004).
  11. Senthil-Kumar, M., Mysore, K. S. New dimensions for VIGS in plant functional genomics. Trends in Plant Science. 16, 656-665 (2011).
  12. Senthil-Kumar, M., Mysore, K. S. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9, 797-806 (2011).
  13. Bombarely, A., et al. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).
  14. Sharma, P. C., et al. Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol Gen Genomics. 269, 583-591 (2003).
  15. Baulcombe, D. C. Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology. 2, 109-113 (1999).
  16. Lu, R., et al. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO Journal. 22, 5690-5699 (2003).
  17. Pozo, O., Pedley, K. F., Martin, G. B. MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23, 3072-3082 (2004).
  18. Wang, K., Senthil-Kumar, M., Ryu, C. -M., Kang, L., Mysore, K. S. Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast. Plant Physiology. 158, 1789-1802 (2012).
  19. Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytologist. 174, 212-223 (2007).
  20. Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal. 25, 237-245 (2001).
  21. MacFarlane, S. A. Molecular biology of the tobraviruses. Journal of General Virology. 80, 2799-2807 (1999).
  22. Anand, A., et al. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions. 20, 41-52 (2007).
  23. Liu, E., Page, J. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods. 4, 5 (2008).
  24. Velásquez, A. C., Chakravarthy, S., Martin, G. B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. (28), e1292 (2009).
  25. Peart, J. R., et al. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences. 99. 99-10869 (2002).
  26. Oh, S. -K., et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta. 223, 1101-1107 (2006).
  27. Senthil-Kumar, M., Mysore, K. RNAi and Plant Gene Function Analysis. Methods in Molecular Biology. Kodama, H., Komamine, A. 744, Humana Press. 13-25 (2011).
VIGS-vermittelte Stürmer Genetics Screening zur Identifizierung von Genen in Nichtwirtresistenz Beteiligte
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).More

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter