Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

VIGS Mediada frente Triagem Genética para identificação de genes envolvidos na resistência não hospedeiras

doi: 10.3791/51033 Published: August 23, 2013

Summary

Induzida por vírus silenciamento de genes é uma ferramenta útil para a identificação de genes envolvidos na resistência de plantas não hospedeiras. Nós demonstramos o uso de bactérias patogênicas que expressam GFPuv em identificar plantas silenciados genes suscetíveis a agentes patogênicos não hospedeiras. Esta abordagem é simples, rápido e facilita a triagem em grande escala e protocolo semelhante pode ser aplicado ao estudo de várias outras interacções planta-microorganismo.

Abstract

Resistência à doença de plantas não hospedeiras contra agentes patogénicos bacterianos é controlada por caminhos de defesa complexos. Compreendendo este mecanismo é importante para o desenvolvimento de plantas resistentes a doenças duráveis ​​contra vasta gama de agentes patogénicos. Induzida por vírus silenciamento gênico (VIGS) baseado frente triagem genética é uma abordagem útil para a identificação de genes de defesa da planta transmitindo resistência não hospedeiras. Tobacco rattle virus (TRV) baseado VIGS VIGS vetor é o vetor mais eficiente até o momento e tem sido utilizado de forma eficiente para silenciar genes alvo endógenos em Nicotiana benthamiana.

Neste artigo, demonstramos uma abordagem de triagem genética para a frente para o silenciamento de clones individuais a partir de uma biblioteca de cDNA em N. benthamiana e avaliar a resposta das plantas silenciados genes de resistência não hospedeiras comprometida contra patógenos não hospedeiras, Pseudomonas syringae pv. tomate T1, P. syringae pv. GlycINEA e X. campestris pv. vesicatoria. Estes patógenos bacterianos são manipuladas para expressar a proteína e as suas colónias GFPuv fluorescente verde pode ser visto a olho nu sob luz UV nas plantas não hospedeiras patogénicos inoculados se o gene alvo silenciada está envolvida na transmissão de resistência não hospedeiras. Isso facilita a identificação mais rápida e confiável de plantas silenciadas genes suscetíveis a agentes patogênicos não hospedeiras. Além disso, informações gene candidato promissor pode ser conhecido por seqüenciamento a inserção de genes de plantas em TRV vetor. Aqui demonstramos a elevada capacidade de transferência genética de frente VIGS mediadas para identificar genes envolvidos na resistência não hospedeiras. Aproximadamente, 100 cDNAs pode ser silenciado individualmente em cerca de duas a três semanas, e a sua relevância não hospedeiras na resistência contra vários agentes patogénicos bacterianos não hospedeiras pode ser estudado em uma semana depois. Neste artigo, vamos enumerar os passos detalhados envolvidos neste rastreio. Frente VIGS mediada genética screening abordagem pode ser estendido, não só para identificação de genes envolvidos na resistência não hospedeiras, mas também para estudar os genes comunicando várias tolerâncias de stress bióticos e abióticos em várias espécies de plantas.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Resistência não hospedeiras é a resistência de todas as espécies de plantas contra as corridas de 1,2 patógeno particular. Isto dá amplo espectro e resistência a doenças em plantas durável 2,3. No entanto, o seu mecanismo, em particular contra patógenos bacterianos, não é bem compreendido 4. Triagem para mutantes ou plantas silenciadas que a resistência não hospedeiras compromisso, e alta taxa de transferência de perfis transcrição para a identificação de genes diferencialmente expressos durante a resistência não hospedeiras 5-9 são duas abordagens principais usadas anteriormente para dissecar a resistência bacteriana não hospedeiras. Como a resistência não hospedeiras é controlada por um mecanismo complexo (s) 4 com o envolvimento de vários genes, uma abordagem funcional genómico de alto rendimento para a identificação de genes é essencial para uma melhor compreensão do mecanismo de resistência não hospedeiras (s).

Induzida por vírus silenciamento do gene (VIGS) tem sido utilizada com sucesso para silenciar planta endógenogenes em muitas espécies de plantas 10,11. Nicotiana benthamiana é uma das melhores plantas adequadas para VIGS 10,12 e seu projecto de seqüência do genoma já está disponível 13. vírus chocalho do Tabaco (TRV) baseados VIGS tem sido amplamente utilizado como ferramenta genética reversa para caracterizar genes envolvidos na resistência não hospedeiras 2,4,14. Este VIGS vetores e derivados estão agora disponíveis através Arabidopsis Biological Resource Center (ABRC, http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html ). VIGS também tem sido usada como ferramenta genética para a frente para a identificação de genes envolvidos na imunidade 15-17 planta, especialmente resistência não hospedeiras 6,18. Avaliação da resposta de hipersensibilidade (HR) mediada por morte celular induzida por plantas não hospedeiras contra um agente patogénico específico e avaliando a morte celular induzida pela doença são dois importantes ensaios utilizados principalmente para IDENTIFICARgene silenciado plantas susceptíveis g. No entanto, a morte celular HR é induzida apenas contra tipo II patógenos não hospedeiras e não contra os do tipo I não hospedeiras patógenos 2. Assim, ensaios de RH não pode ser universalmente utilizado para identificar estratégias de resistência não hospedeiras utilizadas pelas plantas, especialmente contra ampla gama de tipo I não hospedeiras patógenos. Além disso, a perda parcial da resistência não hospedeiras em um gene da planta silenciada nem sempre conduz a sintomas da doença e, consequentemente, 6 marcar a doença não pode ser utilizado para a identificação de plantas não hospedeiras comprometer a resistência. Em contrário, a avaliação do crescimento de agentes patogénicos em plantas não hospedeiras silenciados genes é um método melhor para estudar a perda de resistência nas plantas não hospedeiras de genes silenciados.

Comparado ao ensaio de crescimento convencional 6,19, um método mais rápido para avaliar o crescimento bacteriano nas plantas não hospedeiras de genes silenciados pode encurtar o tempo necessário para a frente de triagem genética. Nós relatamos anteriormente um método para observar bactériasl crescimento do patógeno em folhas por olho nu sob luz ultravioleta (UV) utilizando bactérias expressando a proteína fluorescente verde (GFP) 19. Neste artigo, procuramos demonstrar a utilidade de GFPuv expressar patógenos bacterianos não hospedeiras para facilitar a identificação de plantas silenciadas genéticas que são comprometidos pela resistência não hospedeiras. Esta metodologia é preciso para identificação de plantas suscetíveis e passíveis de triagem em alta velocidade.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Crescimento da planta e Target Gene Silenciando

  1. Condições de crescimento da planta:
    1. Semear N. sementes benthamiana em solo-less mistura envasamento, Metro-Mix 350 e germinar as sementes em uma câmara de crescimento. Qualquer outro solo ou o solo menos meio também pode ser usado em vez de Metro-Mix.
    2. Transplante de três semanas de idade plântulas em vasos individuais e elas crescem numa estufa mantida a 21 ± 2 ° C, juntamente com outras condições de crescimento, conforme detalhado na literatura anterior 12. Dois a três dias após o transplante, as plantas podem ser usadas para TRV inoculação.
  2. Crescer TRV2 clones:
    TRV é um vírus bipartido e o seu genoma consiste em RNA1 e RNA2. RNA1 codifica para uma RNA polimerase dependente de RNA e de uma proteína de movimento 20,21. RNA2 codifica uma proteína capsidial (CP) e duas proteínas não estruturais dos RNAs subgenômico 21. Ambos RNA1 e RNA2 são necessários para a formação de vir amadurecidonós, partículas e sua propagação 20,21. Construção da biblioteca de cDNA em TRV2 vector é descrito na literatura anterior, 22,23. Resumidamente, a biblioteca VIGS utilizada neste estudo foi construído a partir do RNA extraído de tecidos de folhas expostas a vários eliciadores bióticos e abióticos.
    1. Retire Agrobacterium (estirpe GV2260) contendo os clones de cDNA no vector TRV2 (uma placa de 96 poços) a partir do congelador. Gradualmente o descongelamento e depois das culturas atingirem a temperatura ambiente, inocular a cultura de Agrobacterium indivíduo em Luria-Bertani (LB) em placa de ágar com rifampicina (10 ug / ml) e canamicina (50 ug / ml), utilizando um replicador de 96 pinos.
    2. Incubar as placas a 28 ° C durante dois dias. Nós geralmente crescem quatro colônias idênticas para cada clone para que inóculo Agrobacterium adequada está disponível para inoculação picada de duas plantas. Executar todas as etapas sob condições estéreis.
  3. VIGS:
    1. CrescerAgrobacterium (GV2260) transportando TRV1 a 28 ° C em meio líquido LB com os antibióticos acima mencionados. Células colheita por centrifugação, a partir de culturas crescidas durante a noite, re-suspensão no tampão de inoculação (MES 10 mM, pH 5,5, 200 mM acetosiringona), e incubar durante 3 horas a temperatura ambiente num agitador a 50 rpm.
    2. Colher as células por centrifugação e re-suspensão em 5 mM de tampão MES (pH 5,5) e inocula (DO600 = 0,3) para o lado abaxial 3-4 N. benthamiana folhas, utilizando uma seringa sem agulha. Procedimento de inoculação pormenorizadas demonstrado na literatura anterior 24. Mais tarde, no local da inoculação TRV1, inocular respectivos TRV2 colônias por picar as folhas com um palito.
    3. Manter as plantas com nutrição adequada como o crescimento vigoroso é importante para VIGS eficientes 12. Cerca de duas semanas após a inoculação, as transcrições de genes-alvo vai começar a reduzir e as plantas estão prontas para INOC patógenomento de três semanas após a inoculação de TRV.

2. Preparação das culturas não hospedeiras de patógenos e plantas de inoculação

  1. Detalhes de patógenos utilizados neste estudo:
    Pseudomonas syringae pv. Tabaci, P. syringae pv. tomate T1, P. syringae pv. glycinea e Xanthomonas campestris pv. vesicatória são usadas neste estudo. Crescer P. estirpes syringae em King B (KB) meio líquido suplementado com rifampicina (10 ug / ml), canamicina (50 ug / ml) a 28 ° C durante 12 horas. Crescer X. campestris pv. vesicatoria em meio líquido LB por 16 horas. Todos os agentes patogénicos abrigar um plasmídeo que pode expressar GFPuv conforme descrito na literatura anterior 19.
  2. Preparação das culturas de patógenos para inoculação em plantas:
    1. Colher as células bacterianas por centrifugação e confirmar a presença de fluorescência verde usando longo walâmpada UV velength no escuro. Lave as células duas vezes com água esterilizada e re-suspender-los para a concentração desejada com água estéril.
    2. Inocular o respectivo patógeno (s) sobre a face abaxial de folhas de genes silenciados alvo (5 ª a 8 ª) como pontos (cerca de 1,5 cm de diâmetro). Vários patogénios não hospedeiras podem ser testadas simultaneamente para o seu crescimento em plantas do gene alvo silenciada. Simultaneamente inocular o patógeno hospedeiro como este pode ser usado como um controlo positivo para a visualização do crescimento bacteriano planta. Também inocular o controle de vetores (TRV :: 00) plantas.

3. Observação da planta em crescimento de patógenos bacterianos

  1. Expor as folhas inoculadas com uma luz UV de comprimento de onda longo no escuro. Colônias bacterianas podem ser vistos como pontos verdes fluorescentes no lado abaxial da folha no fundo de fluorescência vermelha emitida pela superfície da folha.
  2. Observar o crescimento do patógenode dois dias após a inoculação (dpi) para 5 dpi. Observação de todos os dias, durante este intervalo de tempo é necessário.
  3. Depois da primeira tela, a lista curta dos clones cuja silenciamento resulta em crescimento de um ou mais agentes patogénicos não hospedeiras (s).
  4. Repita VIGS para os clones seleccionados e novamente testar a resposta das plantas de genes silenciados para patógeno não hospedeiras (s). Este segundo nível de triagem é feito para remover os falsos positivos obtidos durante a primeira tela.

4. Confirmação de plantas pré-seleccionados para a Resistência não hospedeiras comprometida

  1. Silenciem os clones de ADNc seleccionados a partir do ecrã, como descrito acima. Inocular com a planta inteira patógeno não hospedeiras (s), submergindo as plantas com as respectivas culturas de organismos patogénicos, com 0,01% (v / v), Silwet L-77 e sujeitando as plantas submersas a vácuo durante 3 - 5 min. Quantificar o crescimento bacteriano pelo ensaio de crescimento de 6,18,19 convencional tal como descrito abaixo.
  2. Em 0 horas após a inoculação (hpi),3 dpi e 5 dpi, coletar duas amostras de folhas de cinco repetições biológicas para cada patógeno não hospedeiras (s) folhas inoculadas utilizando um soco folha (0,5 centímetros 2). Moer as amostras de folhas, diluído em série e a placa de seiva KB em meio de agar suplementado com antibióticos adequados e incubar a 28 ° C durante 2 dias. Contar as colónias de bactérias, utilizando um contador de colónias e calcular o crescimento de bactérias nas folhas, como descrito na literatura anterior 6.
  3. As plantas não hospedeiras suscetíveis ao patógeno (s) deve mostrar maior número de crescimento do patógeno em relação ao controle de vetores.

5. Seqüenciamento do Insert e Identificação de gene alvo

  1. Realizar PCR de colónias para o clone seleccionado utilizando attB1 e attB2 iniciadores ou utilizando iniciadores que flanqueiam o local de clonagem no vector TRV2. Executar o produto de PCR em gel e vá para a amplificação de uma única banda.
  2. Inserção de genes de plantas no vetor TRV2 podem ser seqüenciados usando attBiniciadores ou primers flanqueando o sítio de clonagem.
  3. Realize BLAST usando a seqüência e identificar os detalhes do gene.
  4. Obter seqüência de gene de corpo inteiro junto com as regiões não-traduzidas (UTRs).
  5. Selecione 300-400 bp fragmentos de três regiões diferentes da seqüência e cloná-los em TRV2 vetor. Independentemente realizar VIGS usando todos os três VIGS construções e confirmar o compromisso da resistência não hospedeiras em todas as três plantas de genes silenciados.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Principal objetivo deste estudo é demonstrar um método para a identificação fácil e precisa de gene silenciado N. benthamiana plantas que estão comprometidos para a resistência não hospedeiras. Existem quatro principais etapas desta metodologia. O primeiro passo é o silêncio individualmente grande número de genes usando TRV-VIGS. Nós tínhamos cerca de 5000 genes silenciados 6,18 ao longo de um período de cerca de 1,5 anos, usando o protocolo ilustrado na Figura 1. Algumas das plantas silenciadas gene mostrou várias alterações fenotípicas, incluindo a atrofia do crescimento, amarelecimento e foto-branqueamento fenótipos (Figura 2).

O segundo passo é a identificação de genes de plantas silenciadas mostram susceptibilidade ao patógeno não hospedeiras (s). Usamos GFPuv bactérias expressando e rastreado seu crescimento na planta (Figuras 3A-3C). A fim de demonstrar o processo de identificação do gene silenciado plantas não hospedeiras susceptíveis de pathogen (s), usamos três patógenos não hospedeiras, P. syringae pv. tomate T1, P. syringae pv. glycinea e X. campestris pv. vesicatoria. Como esperado, não silenciou (controle de vetores) N. plantas benthamiana inoculadas com esses patógenos não crescer como eles não poderiam superar a imunidade da planta. No entanto, P. syringae pv. tomate T1 formaram colônias verde fluorescente sobre NbSGT1 gene (um gene implicado na resistência não hospedeiras 25) plantas silenciadas (Figura 3D). Estes dados demonstram o processo de identificação de plantas de genes silenciados comprometido por resistência não hospedeiras. Este protocolo pode ser aplicada directamente para transmitir a triagem genética. Por exemplo, os resultados representativos feita a partir de uma página para a frente da tela genética anterior (Figura 4) mostra duas plantas silenciadas genes independentes, com vários graus de P. syringae pv. tomate crescimento T1 (figura 5

A terceira etapa é a confirmação de crescimento bacteriano nas plantas genes silenciados identificados a partir da tela por quantificar o crescimento bacteriano. Um exemplo para a estimativa da planta em crescimento bacteriano nos genes silenciados NbSGT1 plantas é mostrado na Figura 3E. Os resultados mostraram que, em planta de crescimento de P. syringae pv. tomate T1 era muito maior nas NbSGT1 plantas silenciadas em comparação com plantas controle não-silenciadas (TRV :: 00) (Figura 3E). A perda de resistência não hospedeiras, devido a um silenciamento do gene particular pode ser parcial ou total. Dependendo disso, a extensão do crescimento de patógenos em plantas não hospedeiras de genes silenciados pode variar.

Quarto passo é sequenciar o inserto em TRV2 vetor. BLAST é realizada usando esta sequência para identificar o gene e os seus pormenores.

Figura 1 Figura 1. Dos desenhos que mostra os passos envolvidos no silenciamento de um grande número de genes utilizando VIGS baseados TRV. Três semanas de idade N. benthamiana plantas são transplantadas para vasos individuais e deixou-se crescer durante alguns dias. Agrobacterium transportando TRV1 construto é infiltrada em três a quatro folhas, utilizando uma seringa desnecessária. Mais tarde, 96 clones de cDNA cultivadas em placa de agar LB são tomadas individualmente utilizando um palito espetado e para a mancha inoculada TRV1 das respectivas plantas. Cerca de 3 semanas após a inoculação, o silenciamento do gene alvo ocorre no topo não inoculados folhas recém-crescidos. Estas folhas (5 ª a 8 ª) são usados ​​para testar o crescimento do patógeno não hospedeiras (s).

Figura 2
Figura 2. Frente VIGS genética mediada por triagem emN. benthamiana mostra várias alterações no fenótipo da planta. Três semanas de idade N. benthamiana plantas inoculadas de forma independente com a respectiva TRV como construções de divisar na Figura 1 como uma parte da frente da tela genética são mostrados. Foram tiradas aos 21 dias após a inoculação de TRV.

Figura 3
Figura 3. Fluorescência verde de GFPuv expressar patógenos bacterianos e sua utilização para a identificação de genes envolvidos na resistência não hospedeiras. Pseudomonas syringae pv. Tabaci, um patógeno hospedeiro, levando construir GFPuv semeado em placa KB-médio mostra fluorescência verde sob luz ultravioleta de onda longa no escuro ( A). Estas bactérias são cultivadas em meio KB e re-suspenso em água (B) e inoculadas em a N. benthamiana 4 UFC / ml). Às três dias após a inoculação (dpi) colônias bacterianas são vistos como manchas verdes fluorescentes a olho nu do lado abaxial das células epidérmicas de folha (C, à esquerda). A mesma folha retratado sob luz normal (faixa visível) também é mostrado (C, à direita). GFPuv expressar P. syringae pv. tabaci (Pstab, 1 x 10 4 cfu / ml) e três agentes patogénicos não hospedeiras, P. syringae pv. tomate T1 (PstT1, 1 x 10 4 cfu / ml), P. . syringae pv glycinea (PSG, 3 x 10 5 ufc / mL) e Xanthomonas campestris pv vesicatória (Xcv, 3 x 10 4 cfu / ml) são inoculados sobre o lado abaxial das folhas de controlo do vector (TRV :: 00.; D, à esquerda) e NbSGT1 plantas genes silenciados (D, à direita). As colónias bacterianas da Pstab são vistas em ambas as folhas e os de PstT1 são observados apenas na NbSGT1 gene silenciado folhas. PstT1 crescimento no gene silenciado NbSGT1 folhas quantificadas em 24, 24 e 72 horas após a inoculação (hpi, E) é mostrada no gráfico. Clique aqui para ver a figura maior .

Figura 4
Figura 4. Visão geral do protocolo seguido para a frente VIGS genética mediada por rastreio para a identificação de genes envolvidos na resistência não hospedeiras. Uma biblioteca de cDNA no vector TRV2 construído usando o RNA do patogénio não hospedeiras (s) N. inoculadas benthamiana folhas podem ser usadas para o rastreio. Os clones individuais a partir da biblioteca de cDNA são silenciados em N. benthamiana por TRV-VIGS. GFPuv Respectivas expressam agente patogénico bacteriano não hospedeiras (s) é inoculado com as folhas das plantas de genes silenciados. Entre 2 e4 dpi as manchas inoculadas são observadas utilizando uma lâmpada de UV, no escuro e as plantas que mostram o crescimento do patógeno não hospedeiras são identificados. Após esta triagem preliminar, os clones selecionados são silenciados novamente eo crescimento do patógeno não hospedeiras é reconfirmado. Esta tela segundo nível é feito para remover os falsos positivos. Mais tarde, os clones confirmados são silenciados pela terceira vez e respectivo crescimento bacteriano é avaliado. Inserções dos respectivos clones no vector TRV2 são sequenciados e a informação genética é identificado. Simultaneamente ensaio RH também podem ser realizadas sobre as plantas de genes silenciados para identificar genes que contribuem para HR induzido contra agentes patogénicos do tipo II não hospedeiras.

Figura 5
Figura 5. Não hospedeiras crescimento de patógenos bacterianos em plantas silenciados genes que foram identificados como parte de uma tela de genética para a frente. Fotografias de uma forward genética rastreio que os genes envolvidos na resistência identificados não hospedeiras de N. plantas benthamiana contra PstT1, o PSG e Xcv. As fotografias tiradas por dois genes silenciados plantas representativas de três dpi após a inoculação são mostrados aqui. As concentrações de bactérias utilizadas na inoculação são descritos na Figura 3. 43D4 ou 94C1 indica o número de placas de 96 poços, seguido do número bem.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Imunidade da planta limita o crescimento de patógenos não hospedeiras e, portanto, pouca ou nenhuma fluorescência verde é emitido a partir de plantas controle do vetor folhas inoculadas com patógeno não hospedeiras sob luz UV de comprimento de onda longo (Figura 3D). No entanto, quando um gene envolvido na resistência não hospedeiras é silenciada, as plantas de genes silenciados favorecer o crescimento do patógeno e fluorescência verde é visto não hospedeiras (Figura 3E). Este é o princípio básico envolvido no método descrito neste manuscrito. Esta metodologia tem duas grandes vantagens sobre o ensaio baseado em RH. Uma, a identificação de plantas silenciadas sensíveis ao patógeno não hospedeiras através de ensaio baseado em GFPuv aumenta a precisão de medição do crescimento da planta pode ser visualizado. Em segundo lugar, este método permite a identificação de genes envolvidos em ambos os tipos I a resistência não hospedeiras 2,26 (não resulta na morte celular visível) e tipo II, a resistência não hospedeiras 2,26 (morte celular resulta em resposta de hipersensibilidade).Por exemplo, identificou-se um clone previamente chamado 6C8 e as plantas foram silenciadas susceptíveis a ambos os tipo-1 e tipo-2, 18 agentes patogénicos.

Além disso, é possível que dois ou mais clones independentes utilizadas para VIGS resultou em plantas com genes silenciados fenótipos semelhantes como acontecem para silenciar um gene em particular. Esta redundância é útil, pois confirma o fenótipo de silenciamento. A ocorrência de tais repetições depende da biblioteca e utilizados para o rastreio do gene do tipo (como alguns genes são altamente expressos e, portanto, ocorrem repetidamente numa biblioteca). Além disso, a clonagem de quase todos os genes codificados por N. benthamiana genoma para uma biblioteca de cDNA e VIGS silenciando-os é possível de forma independente.

A fim de implementar eficazmente a triagem genética para a frente para a identificação de genes envolvidos na resistência não hospedeiras usando VIGS seguidos de ensaio de fluorescência GFPuv, as seguintes dicas são úteis.

Em ordempara VIGS bem-sucedidos, (1) usar 3-4 plantas estágio folha para TRV inoculação, (2) o melhor TRV1 e TRV2 título é importante. Desde TRV2 título pode ser um fator limitante para o início da VIGS, inocular pelo menos quatro colônias bacterianas totalmente crescidas de Agrobacterium abrigar TRV2, e (3) manter as condições ambientais ideais 12. A temperatura ambiente tem um papel importante na indução óptimas VIGS.

Passos críticos para a detecção eficaz de fluorescência verde de patógenos incluem: (1) usar sempre culturas patógeno frescas colhidas na fase de crescimento exponencial e não armazená-los antes da inoculação, e (2) a morte das células de RH deve ser evitados, pois podem auto fluorescência sob UV luz e influenciar negativamente as observações. Isto é especialmente importante quando tipo II patógeno não hospedeiras (por exemplo, P. syringae pv. Tomate T1) é usado para o estudo. Use menor concentração do patógeno não hospedeiras se houver suspeita de RH microscópico ou evidenced.

Solução de problemas:

(1) Inconsistência no silenciamento do gene ea ocorrência de silenciamento fenótipo variável entre as repetições:

Mudar de luvas para cada clone durante a inoculação TRV. Além disso, certifique-se de que a colônia TRV2 Agrobacterium não contém vários clones por colônia PCR. Se colónia PCR revela mais do que uma banda, é possível que mais do que um clone está presente na colónia. A fim de separar os clones, raia-los na placa de agar LB e ecrã os clones por PCR, de colónias. Após a identificação de clones individuais, executar VIGS independentemente para cada um deles e identificar o gene silenciado planta comprometer a resistência não hospedeiras.

(2) defeitos de crescimento graves nas plantas silenciadas:

Se o gene alvo silenciada (s) está envolvido no metabolismo basal de plantas, defeitos de crescimento são esperados. No entanto, alguns dos genes silenciados planots pode mostrar maior multiplicação de TRV em comparação com as plantas de controlo do vector, o que pode causar um efeito aditivo sobre a gravidade do fenótipo. Ensaio lesão local 12 em plantas de Chenopodium amaranticolor podem ser realizados para descobrir se as plantas silenciadas têm maior título TRV em comparação com plantas de controle de vetores. Sob estas circunstâncias, as plantas de cerca de 4 semanas de idade, pode ser usado para VIGS para reduzir a gravidade do fenótipo.

(2) silenciamento gênico Off-alvo:

Silenciamento do gene não-específica, muitas vezes referida como o silenciamento fora do alvo pode ocorrer durante VIGS. Isso ocorre quando a homologia parcial permite siRNA gerado para o gene alvo pretendido para degradar mRNA de genes que não são os alvos pretendidos silenciamento 27. Utilize sequências UTR como inserção no vetor TRV2. Estudar a regulação baixa gene endógeno de todos os genes off-alvo previsíveis e certificar-se de silêncios a construção de um único gene de interesse. To Facilitar a identificação de fragmentos de genes com o mínimo ou nenhum off-alvo, ferramentas de bioinformática pode ser utilizado (por exemplo, http://plantgrn.noble.org/pssRNAit/ ).

(3) Não fluorescência verde de colônias bacterianas em planta:

Isto ocorre provavelmente através da utilização de mais de culturas cultivadas. Outra causa pode ser menor inoculo bacteriano. Embora as concentrações de bactérias pode ser medida indiretamente através da medição da densidade óptica OD 600, células bacterianas mortas pode tornar-se maior OD. É aconselhável para calcular a concentração bacteriana ideal com base em unidades formadoras de colônia (UFC) por meio da contagem de células vivas no agar plate médio KB. Os valores de DO podem ser ajustados com base na ufc. Além disso, raia o agente patogénico mais frequentemente possível a partir do estoque de glicerol, crescer na placa de ágar KB e inocular única colônia fresco para preparar culturas para a inoculação.

Uma das causas que comumente ocorrem por dificuldades com o seqüenciamento do inserto em TRV2 vetor (por colônia PCR) é a presença de várias colônias. A fim de superar isto, os clones albergando construto TRV2 individual deve ser isolado como acima mencionado (1).

Limitações do método GFPuv e maneiras de superar:

Patógenos podem perder a GFPuv levando plasmídeo durante a multiplicação e, portanto, influenciar negativamente as observações. Além disso, algumas das plantas de genes silenciados mostra amarelecimento e foto-branqueamento de folhas e estas folhas emitem fluorescência diferente (de vermelho). Isso faz com que a fluorescência verde difícil de ver. Uma das maneiras de reduzir o efeito de auto fluorescência das folhas amarelas ou brancas é capturar imagens das bactérias fluorescentes verdes utilizando uma câmara equipada com filtros que pode remover ou reduzir o fundo effect. As imagens podem ser utilizadas para se inferir que as bactérias foram cultivadas ou não. Certos programas (por exemplo, o Adobe Photoshop) pode ser usada para reduzir o efeito de fundo, durante a análise de tais imagens.

Biossegurança como destinação adequada dos patógenos bacterianos transgênicos devem ser seguidas durante a experimentação. Além disso, a pele apropriado e escudo de proteção dos olhos deve ser usado quando manusear a lâmpada UV.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Não temos nada a divulgar.

Acknowledgments

Este projeto foi financiado pela Fundação Samuel Roberts Noble. Os autores agradecem Mss. Janie Gallaway e Colleen Elles excelente para cuidados com as plantas, e Ms. Katie Brown para obras de arte. Também gostaria de agradecer a Mss. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda e Mr. Isaac Greenhut para assistência técnica durante o estabelecimento deste protocolo.

Materials

Name Company Catalog Number Comments
96-well U-bottom plates Becton Dickinson Labware (Franklin Lakes, NJ, USA) 35-3077
96-pin replicator stainless steel Nalge Nunc International (Naperville, IL, USA) 250520
High Intensity UV Inspection Lamps, Model B-100ap Thomas scientific (Swedesboro, NJ, USA) 6283K50 Manufacturer ID 95-0127-01
Stuart SC6 colony counter Bibby Scientific Limited, Staffordshire, UK SC6PLUS
Soil-less potting mixture, Metro-Mix 350 SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers:
attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)
attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)
Integrated DNA Technologies, Inc (Coralville, IA, USA) Custom synthesized
MES, Monohydrate VWR international (Radnor, PA, USA) CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4’-hydroxyacetophenone) Sigma Aldrich (St. Louis, MO, USA) D134406
Vac-In-Stuff (Silwet L-77) Lehle Seeds (Round Rock, TX, USA) VIS-30

DOWNLOAD MATERIALS LIST

References

  1. Heath, M. C. Nonhost resistance and nonspecific plant defenses. Currrent Opinion in Plant Biology. 3, 315-319 (2000).
  2. Mysore, K. S., Ryu, C. -M. Nonhost resistance: how much do we know. Trends in Plant Science. 9, 97-104 (2004).
  3. Ellis, J. Insights into nonhost disease resistance: can they assist disease control in agriculture. The Plant Cell. 18, 523-528 (2006).
  4. Senthil-Kumar, M., Mysore, K. S. Nonhost resistance against bacterial pathogens: retrospects and prospects. Annual Review of Phytopathology. 51, (2013).
  5. Lu, M., Tang, X., Zhou, J. -M. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. The Plant Cell. 13, 437-447 (2001).
  6. Rojas, C. M., et al. Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways. The Plant Cell. 24, 336-352 (2012).
  7. Daurelio, L. D., et al. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. Journal of Plant Physiology. 168, 382-391 (2011).
  8. Moreau, M., et al. EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora. Molecular Plant-Microbe Interactions. 25, 421-430 (2012).
  9. Senthil-Kumar, M., Mysore, K. S. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant, Cell & Environment. 35, 1329-1343 (2012).
  10. Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal. 39, 734-746 (2004).
  11. Senthil-Kumar, M., Mysore, K. S. New dimensions for VIGS in plant functional genomics. Trends in Plant Science. 16, 656-665 (2011).
  12. Senthil-Kumar, M., Mysore, K. S. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9, 797-806 (2011).
  13. Bombarely, A., et al. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).
  14. Sharma, P. C., et al. Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol Gen Genomics. 269, 583-591 (2003).
  15. Baulcombe, D. C. Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology. 2, 109-113 (1999).
  16. Lu, R., et al. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO Journal. 22, 5690-5699 (2003).
  17. Pozo, O., Pedley, K. F., Martin, G. B. MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23, 3072-3082 (2004).
  18. Wang, K., Senthil-Kumar, M., Ryu, C. -M., Kang, L., Mysore, K. S. Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast. Plant Physiology. 158, 1789-1802 (2012).
  19. Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytologist. 174, 212-223 (2007).
  20. Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal. 25, 237-245 (2001).
  21. MacFarlane, S. A. Molecular biology of the tobraviruses. Journal of General Virology. 80, 2799-2807 (1999).
  22. Anand, A., et al. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions. 20, 41-52 (2007).
  23. Liu, E., Page, J. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods. 4, 5 (2008).
  24. Velásquez, A. C., Chakravarthy, S., Martin, G. B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. (28), e1292 (2009).
  25. Peart, J. R., et al. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences. 99. 99-10869 (2002).
  26. Oh, S. -K., et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta. 223, 1101-1107 (2006).
  27. Senthil-Kumar, M., Mysore, K. RNAi and Plant Gene Function Analysis. Methods in Molecular Biology. Kodama, H., Komamine, A. 744, Humana Press. 13-25 (2011).
VIGS Mediada frente Triagem Genética para identificação de genes envolvidos na resistência não hospedeiras
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).More

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter