Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Genler belirlenmesi için VIGS-aracılığı ile İleri Genetik Tarama konakçı olmayan Direnç ilgilendim

doi: 10.3791/51033 Published: August 23, 2013

Abstract

Bakteriyel patojenlere karşı bitkilerin konakçı olmayan hastalık direnci karmaşık bir savunma yollar ile kontrol edilir. Bu mekanizmanın anlaşılması patojenlerin geniş bir karşı dayanıklı hastalığa dirençli bitkilerin geliştirilmesi için önemlidir. Virüs kaynaklı gen susturulması (VIGS) tabanlı ileri genetik tarama konakçı olmayan direnç aktarmanın bitki savunma genlerin belirlenmesi için yararlı bir yaklaşımdır. Tütün çıngırak virüsü (TRV) tabanlı VIGS vektör bugüne kadar en verimli VIGS vektör ve verimli bir şekilde kullanılmaktadır Nicotiana benthamiana endojen hedef genlerin susturmak için.

Bu yazıda, N. bir cDNA kütüphanesi tek tek klonların susturmak için bir ileri genetik tarama yaklaşımı göstermek benthamiana ve konakçı olmayan patojenlere karşı tehlikeye konakçı olmayan direnç için gen susturulması bitkilerin yanıt değerlendirilmesi, Pseudomonas syringae pv. domates T1, P. syringae pv. glycInea ve X campestris pv. vesicatoria. Bu bakteriyel patojenler ifade GFPuv proteine ​​tasarlanmıştır ve susturuldu hedef gen konakçı olmayan direnç aktarmanın söz konusu ise kendi yeşil Florasanl koloniler konakçı olmayan patojen aşılanmış bitkilerde UV ışık altında çıplak gözle görülebilir. Bu konakçı olmayan patojenlere duyarlı gen susturulması bitkilerin güvenilir ve daha hızlı kimlik kolaylaştırır. Bundan başka, umut verici bir aday gen bilgi TRV vektör bitki geni uç sıralanmasıyla bilinebilir. Burada konakçı olmayan direnç ile ilgili genleri tanımlamak için VIGS-aracılı ileri genetik yüksek verimlilik yeteneği göstermektedir. Yaklaşık, 100 cDNAs ayrı ayrı sonra bir hafta içinde incelenebilir yaklaşık iki üç hafta ve birkaç konakçı olmayan bakteriyel patojenler karşı konakçı olmayan direnç önemleri de susturulabilir. Bu yazıda, bu tarama ile ilgili ayrıntılı adımlar numaralandırmak. VIGS-aracılı ileri genetik Screening yaklaşım, konakçı olmayan direnç katılan genlerin belirlenmesi için değil, aynı zamanda, çeşitli bitki türlerinde çeşitli biyotik ve abiyotik stres tolerans kazandıran genler incelemek için sadece uzatılabilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Konakçı olmayan direnç belirli bir patojen 1,2 yarışları karşı tüm bitki türlerinin direncidir. Bu geniş spektrum ve bitkiler 2,3 dayanıklı hastalık direnci verir. Bununla birlikte, özellikle de bakteriyel patojenlere karşı mekanizması, iyi 4 anlaşılmış değildir. Uzlaşma konakçı olmayan direnç ve konakçı olmayan direnç 5-9 sırasında farklı şekilde ifade genlerin tanımlanması için yüksek verimlilik transkript profil daha önce bakteriyel konakçı olmayan direnç diseksiyon için kullanılan iki ana yaklaşım olduğunu mutantlar veya susturulması bitkiler için tarama. Konakçı olmayan direnç birçok gen, gen tanımlama için bir yüksek verimlilik fonksiyonel genomik yaklaşım katılımı ile karmaşık bir mekanizma (lar) 4 tarafından kontrol edildiği için konakçı olmayan direnç mekanizması (ler) daha iyi anlamasını önemlidir.

Virüs kaynaklı gen susturulması (VIGS) başarıyla endojen bitki susturmak için kullanılmıştırBirçok bitki türünün 10,11 genlerin. Nicotiana benthamiana VIGS 10,12 ve taslak genom dizisi için en uygun tesislerinden biri şimdi 13 kullanılabilir. Tütün çıngırak virüsü (TRV) tabanlı VIGS yaygın olarak ters genetik aracı olarak kullanılmıştır konakçı olmayan direnç 2,4,14 ilgili genler karakterize etmek. Bu VIGS vektörler ve türevleri Arabidopsis Biyolojik Kaynak Merkezi (ABRC aracılığıyla mevcuttur http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html ). VIGS da bitki bağışıklık 15-17, özellikle konakçı olmayan direnç 6,18 katılan genlerin belirlenmesi için ileri genetik aracı olarak kullanılmıştır. Hiperduyarlı cevap (İK)-aracılık ettiği özel bir konakçı olmayan patojene karşı bitkileri kaynaklı hücre ölümü değerlendirilmesi ve hastalığa bağlı hücre ölümü değerlendirmek özellikle TANIMLAMA için kullanılan iki ana tahlillerdirg duyarlı gen bitkiler susturuldu. Ancak, İK hücre ölümü tek tip-II konakçı olmayan patojenlere karşı indüklenir değil, tip I konakçı olmayan patojenler 2 karşı. Bu nedenle, İK deneyleri evrensel özellikle tip-I konakçı olmayan patojenlerin geniş bir karşı, bitkiler tarafından kullanılan konakçı olmayan direnç stratejilerini belirlemek için kullanılamaz. Ayrıca, bir genin susturulması bitki konakçı olmayan direnç kısmi kaybı her zaman hastalık belirtileri 6 ve dolayısıyla hastalık puanlama konakçı olmayan direnç ödün bitkilerin belirlenmesi için kullanılamaz yol açmaz. Aksine, genin susturulması konakçı olmayan bitkilerde patojen büyüme değerlendirilmesi genin susturulması konakçı olmayan bitkilerde direnç kaybı eğitim için daha iyi bir yöntemdir.

Geleneksel büyüme deneyi 6,19, genin susturulması konakçı olmayan bitkilerde bakteri üremesi değerlendirmek için hızlı bir yöntem ile karşılaştırıldığında, ileri genetik taraması için gereken zamanı kısaltır. Daha önce bakteri gözlemlemek için bir yöntem raporultraviyole altında çıplak gözle yapraklarda l patojen büyüme (UV) açık yeşil floresan proteininin (GFP) 19 ifade bakteri kullanarak. Bu yazıda biz konakçı olmayan direnci için tehlikeye gen susturulması bitki kolay tanımlama için konakçı olmayan bakteriyel patojenler ifade GFPuv yararlılığını göstermektedir. Bu metodoloji duyarlı bitkilerin belirlenmesi için doğru ve yüksek verimli görüntüleme için müsait.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
96-well U-bottom plates Becton Dickinson Labware (Franklin Lakes, NJ, USA) 35-3077
96-pin replicator stainless steel Nalge Nunc International (Naperville, IL, USA) 250520
High Intensity UV Inspection Lamps, Model B-100ap Thomas scientific (Swedesboro, NJ, USA) 6283K50 Manufacturer ID 95-0127-01
Stuart SC6 colony counter Bibby Scientific Limited, Staffordshire, UK SC6PLUS
Soil-less potting mixture, Metro-Mix 350 SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)
Primers:
attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT)
attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)
Integrated DNA Technologies, Inc (Coralville, IA, USA) Custom synthesized
MES, Monohydrate VWR international (Radnor, PA, USA) CAS No. 145224-94-8
Acetosyringone (Dimethoxy-4’-hydroxyacetophenone) Sigma Aldrich (St. Louis, MO, USA) D134406
Vac-In-Stuff (Silwet L-77) Lehle Seeds (Round Rock, TX, USA) VIS-30

DOWNLOAD MATERIALS LIST

References

  1. Heath, M. C. Nonhost resistance and nonspecific plant defenses. Currrent Opinion in Plant Biology. 3, 315-319 (2000).
  2. Mysore, K. S., Ryu, C. -M. Nonhost resistance: how much do we know. Trends in Plant Science. 9, 97-104 (2004).
  3. Ellis, J. Insights into nonhost disease resistance: can they assist disease control in agriculture. The Plant Cell. 18, 523-528 (2006).
  4. Senthil-Kumar, M., Mysore, K. S. Nonhost resistance against bacterial pathogens: retrospects and prospects. Annual Review of Phytopathology. 51, (2013).
  5. Lu, M., Tang, X., Zhou, J. -M. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. The Plant Cell. 13, 437-447 (2001).
  6. Rojas, C. M., et al. Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways. The Plant Cell. 24, 336-352 (2012).
  7. Daurelio, L. D., et al. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. Journal of Plant Physiology. 168, 382-391 (2011).
  8. Moreau, M., et al. EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora. Molecular Plant-Microbe Interactions. 25, 421-430 (2012).
  9. Senthil-Kumar, M., Mysore, K. S. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant, Cell & Environment. 35, 1329-1343 (2012).
  10. Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal. 39, 734-746 (2004).
  11. Senthil-Kumar, M., Mysore, K. S. New dimensions for VIGS in plant functional genomics. Trends in Plant Science. 16, 656-665 (2011).
  12. Senthil-Kumar, M., Mysore, K. S. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9, 797-806 (2011).
  13. Bombarely, A., et al. A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research. Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).
  14. Sharma, P. C., et al. Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana. Mol Gen Genomics. 269, 583-591 (2003).
  15. Baulcombe, D. C. Fast forward genetics based on virus-induced gene silencing. Current Opinion in Plant Biology. 2, 109-113 (1999).
  16. Lu, R., et al. High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO Journal. 22, 5690-5699 (2003).
  17. Pozo, O., Pedley, K. F., Martin, G. B. MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease. EMBO Journal. 23, 3072-3082 (2004).
  18. Wang, K., Senthil-Kumar, M., Ryu, C. -M., Kang, L., Mysore, K. S. Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast. Plant Physiology. 158, 1789-1802 (2012).
  19. Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytologist. 174, 212-223 (2007).
  20. Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal. 25, 237-245 (2001).
  21. MacFarlane, S. A. Molecular biology of the tobraviruses. Journal of General Virology. 80, 2799-2807 (1999).
  22. Anand, A., et al. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions. 20, 41-52 (2007).
  23. Liu, E., Page, J. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods. 4, 5 (2008).
  24. Velásquez, A. C., Chakravarthy, S., Martin, G. B. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J. Vis. Exp. (28), e1292 (2009).
  25. Peart, J. R., et al. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants. Proceedings of the National Academy of Sciences. 99. 99-10869 (2002).
  26. Oh, S. -K., et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta. 223, 1101-1107 (2006).
  27. Senthil-Kumar, M., Mysore, K. RNAi and Plant Gene Function Analysis. Methods in Molecular Biology. Kodama, H., Komamine, A. 744, Humana Press. 13-25 (2011).
Genler belirlenmesi için VIGS-aracılığı ile İleri Genetik Tarama konakçı olmayan Direnç ilgilendim
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).More

Senthil-Kumar, M., Lee, H. K., Mysore, K. S. VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance. J. Vis. Exp. (78), e51033, doi:10.3791/51033 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter