Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Stimulering af Cytoplasmatiske DNA Sensing Pathways doi: 10.3791/51593 Published: September 18, 2014

Summary

Formålet med protokollen er at anvende optimale metoder til stimulering af de cytoplasmatiske DNA sensing veje i celler og in vivo. Dette opnås ved at forbedre dannelsen af ​​lange, dobbeltstrenget DNA under stumpendeligering. Celler eller mus transficeres derefter ved hjælp af et lipid transfektionsreagens.

Abstract

For effektivt at stimulere en respons medfødte immunforsvar, skal DNA være af tilstrækkelig længde og renhed. Vi præsenterer en metode, hvor dobbeltstrenget DNA (dsDNA), som har de fornødne egenskaber til at stimulere den cytoplasmatiske DNA-sensing veje kan genereres billigt og med lethed. Ved concatemerization af korte, syntetiske oligonukleotider (som mangler CpG-motiver), kan dsDNA genereres for at være tilstrækkelig lang til at aktivere cytosoliske DNA-sensing vej. Denne protokol omfatter stumpendeligering af oligonucleotiderne i nærværelse af polyethylenglycol (PEG), der skaber et miljø til effektiv ligering at forekomme. De dsDNA concatemerer kan anvendes efter oprensning ved phenol / chloroform-ekstraktion, for at simulere immunresponset medfødte in vitro ved standard transfektionsprotokoller. Dette DNA kan også anvendes til at stimulere medfødte immunitet in vivo ved intradermal injektion i øret pinna af en mus, f.eks. Vedstandardisere concatemerization processen og efterfølgende stimulering protokoller kan en pålidelig og reproducerbar aktivering af det medfødte immunsystem blive produceret.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

DNA er en vital del af alle organismer og celler, der eukaryoter holder i bestemte rum. En funktion af det medfødte immunsystem er at identificere, når en sådan opdeling bryder ned, eller når udenlandsk materiale indføres i organismen via en overtrædelse af fysiske, ydre barrierer. I den menneskelige krop er der en række af proteiner, der findes til at hjælpe nedbryde små mængder af DNA, som kan undslippe korrekt opdeling; DNAse I, II og III nedbryde DNA i plasma, endosom, og cytosolen, hhv. Det har dog vist, at mus, der manglede DNAse II dør af alvorlig blodmangel forårsaget af overdreven produktion af interferoner 1 tyder på, at det medfødte immunsystem reagerer på ekstra-kerne-DNA. Denne reaktion forekommer selv i mus, som er fuldstændig mangelfuld i toll-lignende receptor signalering kapacitet. Talrige undersøgelser har nu vist, at stimulator af interferon gener (STING) 2 og tank-bindende kinase 1 (TBK1) 3 er involveret i påvisning af DNA i cytoplasmaet, og at denne signalvej aktiverer interferon regulatorisk faktor (IRF) -3 4. Den efterfølgende IRF3-afhængig transskription af cytokin, kemokin, og interferon-gener er karakteristisk for en reaktion på enten et patogen eller fare forbundet molekylær mønster (PAMP eller DAMP) 5 medfødte immunreaktion.

Ønsket om at studere intracellulære nukleinsyre sensing veje har ført til krav om at udvikle solide og reproducerbare metoder til stimulering af celler ved at indføre DNA eller RNA i celler uden at aktivere andre medfødte immunrespons. En metode, som STING / TBK1 / IRF3 vej kan stimuleres, er ved hjælp af kationiske lipid transfektionsreagenser at levere nukleinsyre i cytoplasmaet, hvor det kan tilgås af DNA-sensorer, såsom DNA-PK, IFI16 og cGAS 6-8.

Egenskaberne af DNA, som i øjeblikket forstås at tillade efficient aktivering af reaktion den cytoplasmiske medfødte immunsystem uden stimulering af andre veje er dens længde, masse, renhed og manglende CpG motifs 4,7,9. Syntetiske oligonukleotider er meget velegnet til det formål at generere en medfødte immunreaktion, da de tillader den DNA-sekvens, der skal optimeres, og fremstilles som et rent kemisk art. En 45 basepar immunstimulerende DNA (ISD) sekvens blev identificeret ved Stetson et al. 4 som værende et egnet CpG-fri sekvens til dette formål. Denne dsDNA sekvens er ellers tilfældig og har ingen særlige kendetegn ud over sin mangel på CpG-motiver. Vi har fundet, at ved concatemerizing ISD oligonukleotid i betydeligt længere tråde forøger størrelsen af stimulering 7. Generering af concatemerized ISD er derfor nyttig til at stimulere en respons cytoplasmatisk medfødte immunforsvar. Her præsenterer vi protokoller for at forberede dette reagens, og hvordan det kan bruges til at aktivere DNA sensing vej iin vitro såvel som in vivo.

BEMÆRK: Alle dyreforsøg udføres under godkendte institutionelle protokoller og retningslinjer dyreplejepraksis.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Concatemerization

  1. Resuspender primere Fw og Rv (se tabel af materialer til primersekvenser) til en koncentration på 10 ug / ul i molekylær biologi klasse H 2 O. Derefter blandes 5 pi Fw og 5 pi Rv primer i et 1,5 ml mikrocentrifugerør.
  2. Anneal primerblanding ved opvarmning til korrekt annealing temperatur (75 ° C i primerne beskrevet her) i 15 minutter. Lad på bænken til at afkøle ved stuetemperatur (RT). Forbered 60% PEG8000 i løbet af denne inkubation den ved at opløse i Hedeselskabet 2 O.
  3. Der tilsættes 50 ul af 60% PEG8000 (for at opnå en slutkoncentration på 30%), 10 pi 10x polynukleotidkinase (PNK) puffer, 27 pi H2O og 3 pi PNK til primer mix. Der inkuberes ved 37 ° C i 2 timer.
  4. Afkøl ved stuetemperatur, og der tilsættes 11 pi DNA-ligase-puffer. Derefter tilsættes 3 U DNA-ligase, og der inkuberes ved 37 ° C natten over.

2. DNA Oprensningog analyse

  1. Der tilsættes 300 pi H2O at øge volumen af ligeringsblandingen. Bemærk: Fortsæt i et stinkskab på grund af toksicitet af phenol: chloroform damp.
  2. Tilsæt 1 volumen (400 ul) phenol: chloroform og bland ved at ryste kraftigt.
  3. Der centrifugeres ved maksimal hastighed i 1 min i en bordplade mikrocentrifuge. De vandige og opløsningsmiddelbaserede lag vil adskille med det vandige lag på toppen og et hvidt lag af udfældet protein mellem de to lag.
  4. Overførsel øverste lag til et nyt rør ved omhyggelig pipettering (undgå at overføre midten, hvide lag)
  5. Gentag trin 2.2 og 2.3 i det mindste to gange, eller indtil der ikke præcipiterede protein efter centrifugering.
  6. Tilsæt 1 volumen (400 ul) af chloroform og gentag trin 2,3-2,4.
  7. Tilsæt 2 volumener (800 ul) af 100% forafkølet ethanol og inkuberes ved -20 ° C i mindst 1 time eller natten over. BEMÆRK: Dette trin udfældes DNA concatemerer.
  8. Spin ned ved max hastighed og aspirer supernatant. Vask en gang ved tilsætning af 1 ml 70% ethanol og lad dem lufttørre i stinkskab.
  9. Resuspender DNA i 50 pi endotoksin gratis Hedeselskabet 2 O. Bemærk: Brugen af endotoxin fri reagenser er afgørende for at generere et immunrespons i celler og in vivo-DNA-specifik medfødt.
  10. Fjern en 2 pi alikvot af concatemerized DNA i et frisk rør, og der tilsættes 1 ml DNA-gel-påføringsbuffer.
  11. Opløs 1% agarose i TAE-buffer ved opvarmning på fuld effekt i en mikrobølgeovn i 2 min (eller tid, som er passende til magten af ​​ovnen og volumen).
  12. Hæld gelen ind apparat støbning, tilsættes 4 ul fluorescerende DNA-chelaterende farvestof, indsætte en kam, og henstår ved stuetemperatur i ca 20 min for gelen at indstille.
  13. Når de er indstillet, skal du fjerne kam og sted gelen i elektroforese tank indeholdende TAE buffer. Belastning 3 pi DNA-prøve eller størrelse markører i boringer.
  14. Kør gelelektroforese 30-40 minutter ved 90 V med konstant strøm. Visualize DNA under ultraviolet lys for at observere concatemerization (figur 1A).
  15. Mål DNA-koncentrationen i den resterende del af prøven ved UV-absorbans-spektroskopi. Blank spektrometeret med samme Hedeselskabet 2 O, der blev brugt til at resuspendere DNA'et og måle absorbansspektrum 200-300 nm. BEMÆRK: DNA-koncentration kan beregnes ved hjælp af Lambert-Beers lov A = e * C * l, hvor A er absorbansen, e ekstinktionskoefficienten og L afstand lysbanen. Til måling af DNA-koncentrationer absorbansen ved 260 nm måles, og en ekstinktionskoefficient på 0,027 (mg / ml) -1 cm -1 anvendes. Lysvejen afstand, l, vil variere afhængigt af spektrofotometer. Mens måle koncentrationen, tage til efterretning, at 260/280 nm Absorbansforhold som en indikation af DNA renhed; anbefales en værdi for dette forhold på over 2,00.

3. Transfektion af dsDNA concatemerer i underområde VITro

  1. Seed celler i en vævskulturskål eller plade til at være 70% konfluente på tidspunktet for stimulering.
  2. Beregn massen af ​​DNA, der kræves til stimulering af celler under anvendelse af en slutkoncentration på 1-10 ug / ml. Den krævede masse af DNA vil blive bemærket som X nedenfor. For eksempel hvis stimulere celler i en enkelt brønd i en 6-brønds plade med 2 ml medium ved en koncentration af DNA af 5 ug / ml så en masse på 2 * 5 = 10 ug DNA er påkrævet.
  3. Tilsæt 50 * X ul serumfrit medium i en passende størrelse sterilt rør. Pipetteres forsigtigt ind i centrum af mediet, uden at røre den side af røret 2 * X pi kationisk lipid transfektionsreagens og henstår i 5 minutter.
  4. Tilføj X-ug DNA til glasset og vortex kortvarigt. Lad ved stuetemperatur i mindst 20 minutter. Til in vitro-transfektion denne blanding direkte til cellerne for at stimulere cytoplasmiske DNA sensing veje.

4. Transfektion af dsDNA concatemerer In Vivo

  1. Forbered transfektion blanding som beskrevet i 3,1-3,5 under anvendelse af 1 ug DNA, 2 pi lipid-transfektionsreagens og 18 pi serumfrit medium pr museøre der skal stimuleres. Forbered en steril 20 ul Hamilton-sprøjte, kasket med en steril 30 G kanyle, og læg med DNA-transfektion mix.
  2. Bedøver en C57BL / 6 mus ved hjælp af 1-2% isofluran. Bekræft anæstesi ved tab af bevægelse og konstant respirationsfrekvens og ved pinch refleks test, hvis det er nødvendigt. Overvåg dyrets øjne under anæstesi og bruge salve efter behov for at undgå overdreven tørhed.
  3. Anvendelse af steril teknik injiceres med omhu i øret pinna 10 ul af Transfektionsblandingen således at en enkelt boble af væske er dannet mellem de dermale lag af øret. Bemærk: Brug en gummi fingerbøl på din tommelfinger eller pegefinger, strække øret over det, og injicere i en spids vinkel til at sikre nålen trænger kun det første lag af huden af ​​øret pinna.
  4. Reintroducere mus tilbage i buret og regelmæssigt overvåge postanæstesisk opsving. Brug en varmelampe for at undgå overdreven køling af bedøvede mus. Lad ikke mus uden opsyn, indtil de har genvundet tilstrækkelig bevidsthed til at opretholde brystleje.
  5. Flash fryse hele øre pinna i et mikrocentrifugerør ved nedsænkning i flydende nitrogen i 2 min.

5. Behandling af DNA stimuleres prøverne og analyse ved kvantitativ PCR (qPCR)

  1. Fra cellekultur: Aspirer medium med en pipette og kassere affald.
  2. Der tilsættes 1 ml sterilt PBS. Gentag 5.1 og 5.2 gange og fortsæt til trin 5,3
  3. Fra øre væv: male væv under flydende nitrogen med sterile keramiske morter, overføre råvæv til et mikrocentrifugerør ved hjælp af en steril spatel, og fortsæt til trin 5,4
  4. Tilføj 350 pi lysisbuffer og fortsætte med kommercielt RNA ekstraktionskit protokol. Elute RNA fra ekstraktionskit oprensningkolonne i 40 ul Hedeselskabet 2 O. Bemærk: Den kommercielle RNA-ekstraktion kit (se materialer / udstyr Table) fungerer meget godt; andre teknikker er blevet testet med subpar resultater.
  5. Kvantificer RNA ved UV-spektroskopi som beskrevet for DNA ovenfor (afsnit 2.13). Bemærk: ekstinktionskoefficienten for RNA er 0,025 (pg / ml) -1 cm -1.
  6. Tilføj til et sterilt PCR-rør 1 ul oligo (dT) primer, 1 ul 10 mM dNTP mix, og 250 ug RNA. Der fyldes op til 11 pi med sterilt Hedeselskabet 2 O.
  7. Inkuber i 5 minutter ved 65 ° C. Derefter tilsættes 4 ul First Strand Buffer, 1 gl 0,1 M dithiothreitol, 0,25 ul revers transkriptase og 1,75 pi Hedeselskabet 2 O til røret. Inkuber ved 50 ° C i 1 time efterfulgt af 72 ° C i 15 min. Eventuelt fortyndes cDNA produkt 1: 5 ved hjælp af Hedeselskabet 2 O.
  8. Til kvantitativ PCR brug 2 ul cDNA, 2 pi Hedeselskabet 2 O, 5 pi qPCR Master Mix, og 1pi hver af 10 uM fremadrettet og revers primer lagre til at forstærke gen (e) valg. Bland i en 96-brønds plade og analysere ved anvendelse af en kvantitativ PCR-maskine (figur 1B og 1C).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Resultaterne nedenfor viser, at concatemerized DNA kan genereres med relativ lethed og er i stand til at stimulere en robust immunrespons medfødt i celler og i mus. Med brugen af ​​PEG8000, kan det tydeligt ses, at længden af ​​DNA, der genereres, er væsentligt længere og lige stand til at inducere transkription af CXCL10. Som det ses ved agarosegel-analyse standard concatemerization har længder af DNA på op til 800 basepar (bp), mens der for prøven med PEG8000, længden af DNA indbefatter tråde på over 10.000 bp (figur 1A). Transfektion af disse DNA'er i murine embryoniske fibroblaster (MEF) eller mus inducerer et robust transskription af cytokiner og chemokiner, som kan måles ved qPCR indikerer stimulering af medfødte immunsystem DNA-sensing maskiner (figur 1B og 1C).

annonce / 51593 / 51593fig1highres.jpg "/>
Figur 1. Repræsentative data, der indikerer produktionen af concatemerized ISD DNA (conDNA) og stimulering af fibroblaster og mus. (A) En prøve af concatemerized DNA fremstilles enten med eller uden PEG8000 analyseret ved agarosegelelektroforese. (B) MEF'er blev stimuleret med forskellige DNA'er på 10 ug / ml og indholdet af CXCL10 og IL-6-mRNA målt ved qPCR 6 timer senere. (C) Mus blev injiceret i øret pinnae med conDNA og niveauerne af CXCL10 og IL-6 mRNA målt ved qPCR 12 timer senere. Data vises som fold stigning i forhold til niveauet for HPRT (RQ) og fejlsøjler er +/- SEM (n = 3).

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
Stimulering af Cytoplasmatiske DNA Sensing Pathways<em&gt; In Vitro</em&gt; Og<em&gt; In Vivo</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter