Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Stimulatie van Cytoplasmatische DNA Sensing Pathways doi: 10.3791/51593 Published: September 18, 2014

Summary

Het doel van het protocol optimale methoden voor het stimuleren van het cytoplasmatische DNA sensing trajecten in cellen en in vivo. Dit wordt verwezenlijkt door het genereren van lange, dubbelstrengs DNA tijdens blunt-end ligatie. Cellen of muizen worden vervolgens getransfecteerd met een lipide transfectie reagens.

Abstract

Om efficiënt te stimuleren van een aangeboren immuunrespons, moet het DNA van voldoende lengte en zuiverheid zijn. We presenteren een werkwijze waarbij dubbelstrengs DNA (dsDNA) de benodigde eigenschappen moet het cytoplasmatische DNA sensing pathways kan goedkoop en gemakkelijk worden gegenereerd stimuleren. Door de concatemerization van korte, synthetische oligonucleotiden (die CpG motieven ontbreekt), kan dsDNA worden gegenereerd te zijn van voldoende lengte om de cytosol DNA sensing pathway activeren. Dit protocol betreft ligatie van stompe uiteinden van de oligonucleotiden in de aanwezigheid van polyethyleenglycol (PEG), die een omgeving voor efficiënte ligatie optreden bepaalt. De dsDNA concatemeren kan worden gebruikt na zuivering door middel van fenol / chloroform extractie, voor de aangeboren immuunrespons in vitro door standaard transfectie protocollen simuleren. Het DNA kan ook worden gebruikt om aangeboren immuniteit in vivo door intradermale injectie aangemoedigd de oor oorschelp van een muis, bijvoorbeeld. Doorstandaardiseren het concatemerization proces en de daaropvolgende stimulatie protocollen kan een betrouwbare en reproduceerbare activering van het aangeboren immuunsysteem worden geproduceerd.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

DNA is een essentieel onderdeel van alle organismen en cellen, die eukaryoten specifieke compartimenten houden. Een functie van het aangeboren immuunsysteem is bepaald wanneer dergelijke compartimentering afbreekt of wanneer vreemd materiaal wordt geïntroduceerd in het organisme via een schending van fysieke, externe barrières. In het menselijk lichaam zijn er een aantal eiwitten die bestaan ​​om degraderen kleine hoeveelheden DNA die de juiste compartimentalisatie ontsnappen; DNAse I, II en III breken DNA in het plasma, endosoom en cytosol, respectievelijk. Echter is aangetoond dat muizen die DNAse II sterven aan ernstige anemie veroorzaakt door overmatige productie van interferonen 1, suggereert dat het aangeboren immuunsysteem reageert op extra-nucleair DNA. Deze reactie gebeurt zelfs bij muizen die volledig tekort aan toll-like receptor signalering capaciteit zijn. Talrijke studies hebben nu aangetoond dat de stimulator van interferon genen (STING) 2 en-TANK bindend kinase 1 (TBK1) 3 zijn betrokken bij de detectie van DNA in het cytoplasma en dat deze signaaltransductieweg activeert interferon regulerende factor (IRF) -3 4. De daaropvolgende IRF3-afhankelijke transcriptie van cytokine, chemokine, en interferon genen is kenmerkend voor een aangeboren immuunrespons op ofwel een pathogeen of gevaar in verband moleculaire patroon (PAMP of vochtig) 5.

De wens om intracellulaire nucleïnezuur sensing pathways onderzoeken heeft geleid tot de behoefte aan robuuste en reproduceerbare werkwijzen voor het stimuleren van cellen door het introduceren van DNA of RNA in cellen zonder activering andere aangeboren immuunresponsen te ontwikkelen. Een methode waardoor de STING / TBK1 / IRF3 route kan worden gestimuleerd is door kationische lipiden transfectie reagentia nucleïnezuur leveren in de cytoplasma waar het toegankelijk is door DNA sensoren zoals DNA-PK, IFI16 en cgas 6-8.

De kenmerken van DNA die momenteel verstaan ​​eff toestaanicient activatie van de cytoplasmatische aangeboren immuunrespons zonder stimulatie van andere routes zijn de lengte, massa, zuiverheid, en ontbreken van CpG motieven 4,7,9. Synthetische oligonucleotiden zijn zeer geschikt voor het opwekken van een aangeboren immuunrespons toelaten DNA-sequentie te optimaliseren en bereid als zuivere chemische species. Een 45 base paar immuno-stimulerende DNA (ISD) sequentie werd geïdentificeerd door Stetson et al. 4 als een geschikt CpG-free sequentie voor dit doel. Dit dsDNA sequentie is anders willekeurige en geen specifieke kenmerken buiten het ontbreken van CpG motieven. Wij hebben gevonden dat door concatemerizing de ISD oligonucleotide in aanzienlijk langere strengen verhoogt de grootte van de stimulatie 7. Generatie concatemerized ISD is daarom nuttig voor het stimuleren van een cytoplasmatisch aangeboren immuunrespons. Hier presenteren we protocollen voor de voorbereiding van dit reagens en hoe het kan worden gebruikt om de DNA sensing route in activerenalsmede vitro in vivo.

OPMERKING: Alle dierproeven worden uitgevoerd op basis van goedgekeurde institutionele protocollen en verzorging van dieren richtlijnen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1 Concatemerization

  1. Resuspendeer primers Fw en Rv (zie Tabel Materialen primer sequenties) tot een concentratie van 10 ug / ul in moleculaire biologie rang H2O Vervolgens Meng 5 gl Fw en 5 gl Rv primer in een 1,5 ml microcentrifugebuis.
  2. Gloei primer mix door verhitting tot de juiste hybridisatietemperatuur (75 ° C voor de hier beschreven primers) gedurende 15 minuten. Laat op de bank te laten afkoelen bij kamertemperatuur (RT). Bereid de 60% ​​PEG8000 tijdens deze incubatie door het oplossen in DDH 2 O.
  3. Voeg 50 ul van 60% PEG8000, 10 gl 10x polynucleotide kinase (PNK) buffer, 27 ui H2O en 3 ui PNK van de primer mix (tot een eindconcentratie van 30%). Incubeer bij 37 ° C gedurende 2 uur.
  4. Afkoelen op kamertemperatuur en voeg 11 ul van DNA-ligase buffer. Voeg dan 3 U DNA ligase en incubeer bij 37 ° C overnacht.

2 DNA Purificationen Analyse

  1. Voeg 300 ul H2O volume van het ligatiemengsel verhogen. Opmerking: Ga in een zuurkast door toxiciteit van fenol: chloroform damp.
  2. Voeg 1 volume (400 pl) van fenol: chloroform en meng door schudden.
  3. Centrifuge bij maximale snelheid gedurende 1 minuut in een tabletop microcentrifuge. De waterige en oplosmiddel lagen scheiden de waterige laag boven en een witte laag neergeslagen eiwit tussen de twee lagen.
  4. Transfer toplaag naar een nieuwe buis door zorgvuldig pipetteren (vermijd overdracht middelste, witte laag)
  5. Herhaal de stappen 2.2 en 2.3 ten minste tweemaal of tot er geen neergeslagen proteïne na centrifugatie.
  6. Voeg 1 volume (400 pl) van chloroform en herhaal de stappen 2.3-2.4.
  7. Voeg 2 volumes (800 ui) of 100% voorgekoelde ethanol en incuberen bij -20 ° C gedurende ten minste 1 uur of overnacht. OPMERKING: deze stap neerslaat het DNA concatemeren.
  8. Spin down op max snelheid en zuig supernatant. Was eenmaal door toevoeging van 1 ml 70% ethanol en aan de lucht drogen in zuurkast.
  9. Resuspendeer DNA in 50 ui endotoxinevrij DDH 2 O. Opmerking: Het gebruik van endotoxine vrije reagentia is cruciaal voor het genereren van een DNA-specifieke aangeboren immuunrespons in cellen en in vivo.
  10. Verwijder een 2 ui aliquot van de concatemerized DNA in een nieuwe buis en voeg 1 ml DNA gelbeladingsbuffer.
  11. Los 1% agarose in TAE buffer door verwarming op vol vermogen in de magnetron gedurende 2 minuten (of de tijd die passen bij de kracht van de oven en het volume is).
  12. Giet gel in gietinrichting, voeg 4 pi fluorescente DNA chelerende kleurstof, plaatst een kam en reactie bij kamertemperatuur gedurende ongeveer 20 minuten om de gel te stellen.
  13. Eenmaal ingesteld, verwijdert de kam en plaats gel in elektroforese tank met TAE buffer. Load 3 pi van DNA-monster of grootte markers in putten.
  14. Run gelelektroforese 30-40 min bij 90 V met een constante stroom. VisualiZE het DNA onder ultraviolet licht concatemerization (figuur 1A) zien.
  15. Meet de DNA-concentratie in het restant van het monster door UV-absorptie spectroscopie. Lege de spectrometer met dezelfde DDH 2 O die werd gebruikt om het DNA opnieuw te suspenderen en meet de absorptie spectrum 200-300 nm. OPMERKING: DNA-concentratie kan worden berekend met behulp van de Beer-Lambert wet, A = e * c * l, waarbij A de absorptie, e de extinctiecoëfficiënt en l de afstand van het lichtpad. Voor het meten van DNA concentraties van de absorptie bij 260 nm worden gemeten en een extinctiecoëfficiënt van 0.027 (ug / ml) -1 cm -1 gebruikt. De lichtweg afstand, l, is afhankelijk van de spectrofotometer. Tijdens het meten van de concentratie, kennis te nemen van de 260/280 nm absorptie verhouding als een indicatie van DNA zuiverheid; een waarde voor deze verhouding boven 2,00 wordt aanbevolen.

3 Transfectie van dsDNA concatemeren In Vitro

  1. Zaad cellen in een weefselkweekplaat of plaat 70% confluente moment van stimulatie.
  2. Bereken de massa van DNA die voor stimulatie van cellen met een uiteindelijke concentratie van 1-10 ug / ml. De vereiste massa van DNA wordt genoteerd als X hieronder. Bijvoorbeeld als stimulerende cellen in een enkel putje van een 6-wells plaat met 2 ml medium in een concentratie van DNA van 5 ug / ml dan een massa van 2 * 5 = 10 ug DNA nodig.
  3. Voeg 50 * X ul serumvrij medium pasta in een geschikte steriele buis. Pipetteer voorzichtig in het midden van het medium, zonder het van de buis, 2 * X pl kationisch lipide transfectie reagens en laat gedurende 5 minuten.
  4. Voeg X ug van DNA aan de buis en vortex kort. Laat bij kamertemperatuur gedurende ten minste 20 minuten. Voor in vitro transfectie voeg dit mengsel rechtstreeks voor cellen cytoplasmatisch DNA detectie pathways stimuleren.

4 Transfectie van dsDNA concatemeren In Vivo

  1. Bereid transfectie mix zoals beschreven in 3.1-3.5 met 1 ug DNA, 2 pl lipide transfectie reagens en 18 ul serumvrij medium per muis oor te stimuleren. Bereid een steriele 20 pi Hamilton spuit, pet met een steriele 30 G naald, en laden met de DNA-transfectie mix.
  2. Verdoven een C57BL / 6 muis met behulp van 1-2% isofluraan. Bevestig anesthesie door het verlies van beweging en constante ademhaling en door pinch reflex testen, indien nodig. Monitor ogen dier tijdens anesthesie en gebruik zalf zoals vereist om overmatige droogheid voorkomen.
  3. Met steriele techniek injecteren voorzichtig in het oor oorschelp 10 ul van de transfectie mix zodat een "bubbel" vloeistof wordt gevormd tussen de huidlagen van het oor. Opmerking: Gebruik een rubber huls op de duim of wijsvinger, strekken de oor over, en injecteer onder een scherpe hoek te waarborgen de naald dringt alleen de eerste laag van de huid van het oor oorschelp.
  4. Reintroduce muis terug in de kooi en regelmatig toezicht op de post-anesthesie recovery. Gebruik een warmtelamp te sterke afkoeling van de verdoofde muizen voorkomen. Niet muizen onbeheerd totdat ze voldoende bewustzijn hebben herwonnen om borstligging behouden.
  5. Flash bevriezen de hele oor oorschelp in een microcentrifugebuisje door onderdompeling in vloeibare stikstof gedurende 2 minuten.

5 Verwerking van DNA gestimuleerde monsters en analyse met kwantitatieve PCR (qPCR)

  1. Van celcultuur: aspireren medium met een pipet en gooi afval.
  2. Voeg 1 ml steriel PBS. Herhaal 5.1 en 5.2 twee keer en ga verder met stap 5.3
  3. Van oor weefsel: grind weefsel onder vloeibare stikstof met steriele keramische vijzel en stamper, over te dragen grond weefsel naar een microcentrifugebuis met een steriele spatel, en ga verder met stap 5.4
  4. Voeg 350 ul lysis buffer en door te gaan met commerciële RNA-extractie kit protocol. Elute RNA uit extractie kit zuiveringkolom in 40 pl DDH 2 O. Opmerking: De commerciële RNA-extractie kit (zie materialen / apparatuur tabel) werkt erg goed; andere technieken zijn getest met onvoldoende resultaten.
  5. Kwantificeren RNA door UV-spectroscopie, zoals beschreven voor DNA hierboven (paragraaf 2.13). Opmerking: de extinctiecoëfficiënt voor RNA 0,025 (ug / ml) -1 cm -1.
  6. In een steriele PCR buis 1 ui oligo (dT) primer, 1 pi 10 mM dNTP mix en 250 ug RNA. Vul met water aan tot 11 pl met steriele DDH 2 O.
  7. Incubeer 5 minuten bij 65 ° C. Voeg dan 4 ui First Strand Buffer, 1 ui 0,1 M dithiothreitol, 0,25 pl reverse transcriptase en 1,75 pl DDH 2 O aan de buis. Incubeer bij 50 ° C gedurende 1 uur gevolgd door 72 ° C gedurende 15 minuten. Eventueel verdunnen cDNA product 1: 5 met behulp van DDH 2 O.
  8. Voor kwantitatieve PCR gebruik 2 pi cDNA, 2 pl DDH 2 O, 5 pl qPCR master mix, en 1gl van elk 10 uM voorwaartse en omgekeerde primer voorraden gen (en) naar keuze amplificeren. Meng in een 96-well plaat en geanalyseerd met kwantitatieve PCR machine (figuren 1B en 1C).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De onderstaande resultaten geven aan dat concatemerized DNA kan worden gemaakt met relatief gemak en kan stimuleren een robuuste aangeboren immuunrespons in cellen en in muizen. Met het gebruik van PEG8000, is duidelijk te zien dat de lengte van DNA worden gegenereerd aanzienlijk langere en even geschikt induceren transcriptie van CXCL10. Zoals gezien door agarosegel-analyse, standaard concatemerization heeft een lengte van DNA van 800 baseparen (bp), terwijl het monster met PEG8000, de lengte van DNA strengen omvat dan 10.000 bp (figuur 1A). Transfectie van deze DNA in muriene embryonale fibroblasten (MEF) of muizen induceert een sterke transcriptie van cytokines en chemokines die kan worden gemeten door qPCR vermelding stimuleren van de aangeboren immuunrespons DNA sensor proteïnes (figuren 1B en 1C).

ad / 51593 / 51593fig1highres.jpg "/>
Figuur 1 Representatieve gegevens waarin de productie van concatemerized ISD DNA (conDNA) en stimulatie van fibroblasten en muizen. (A) Een monster van concatemerized DNA dat niet met PEG8000 met agarosegelelektroforese geanalyseerd. (B) MEFs werden gestimuleerd met verschillende DNA bij 10 ug / ml en de niveaus van CXCL10 en IL-6 mRNA gemeten door qPCR 6 uur later. (C) Muizen werden geïnjecteerd in de oorpinnae met conDNA en de niveaus van CXCL10 en IL-6 mRNA 12 uur later gemeten door qPCR. Gegevens worden weergegeven als voudige toename ten opzichte van het niveau van HPRT (RQ) en foutbalkjes +/- SEM (n = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De hier beschreven protocollen gebruikt om dsDNA genereren om de cytosolische aangeboren immuunrespons reproduceerbare resultaten in diverse celtypes en in vivo stimuleren. Aangezien het belangrijkste substraat reagens is een synthetisch oligonucleotide, flexibel wordt dit systeem gebruik van alternatieve DNA-sequenties of chemische modificaties. Het is bijvoorbeeld mogelijk om de voorwaartse streng oligonucleotide in dit protocol beschreven die een fluorescent label of een biotinegroep localisatie volgen of beoordelen interacties met andere biomoleculen bevat vervangen.

Een van de belangrijkste voordelen van DNA concatemerization is de productie van lange strengen van dsDNA op een wijze die de sequentie kan worden. Er is een beperking hier namelijk dat de DNA lengte niet nauwkeurig kan worden gevolgd om het product van deze reactie is altijd een mengsel van DNA van verschillende lengtes (vergelijkbaar met de commerciële RNA analogon poly (I: C)). Een ander voordeel van deze techniek is dat het de productie van grote massa hoeveelheden immuno-stimulerende DNA (tot bedragen mg). De concatemerization stap kan worden opgeschaald gemakkelijk als nodig, hoewel moet worden opgemerkt dat verdere zuiveringsstappen moeten vervolgens in porties van de schaal die in het protocol uitgevoerd.

In vergelijking met andere methoden concatemerizing DNA, de belangrijkste toevoeging is het gebruik van PEG8000 het ligatiemengsel ligatie efficiëntie. Merk op dat PEG8000 moeilijk zijn op te lossen tot een 60% maken (w / v) voorraad maar kunnen worden gewerveld en zachtjes verwarmd tot oplossen te helpen. De ligatie kan worden overgelaten incuberen langer dan genoemd, maar dit blijkt geen invloed op de lengte van DNA worden gegenereerd. Sommige zorgbehoeften ook in acht worden genomen bij de omgang met fenol en chloroform als deze kunnen kankerverwekkend en corrosief zijn. In onze handen de genen opgereguleerd andere synthetische DNA's (zoals commerciële poly (dA: DT)) verschillen van die gereguleerd door concatemerized ISD. Echter, andere niet gevonden dergelijke verschillen 10, die kunnen weerspiegelen verschillen tussen celtypen geanalyseerd. Niettegenstaande deze conflicten, de concatemerized ISD is aanzienlijk goedkoper te genereren in vergelijking met de aankoop van poly (dA: dT) van een commerciële bron en maakt een grotere flexibiliteit via de keuze van volgorde en modificaties.

Een aspect van DNA sensing dat volgens bestudeerde de in vivo respons op stimulatie. We hebben aangetoond dat dit protocol kan worden gebruikt om DNA geschikt voor in vivo experimenten 7 genereren. Het dsDNA product is zuiver en van hoge genoeg concentratie injectie in muizen gevolgd door meting van het aangeboren immuunsysteem signalering processen mogelijk te maken. In de hier beschreven protocol, moet erop worden gelet dat het water gebruikt om de uiteindelijke DNA pellet opgelost is endotoxine, RNase en DNase vrij waarborgen. Injectie van vrij DNA of DNA-lipide-complexen resulteert in een interferon respons zoals verwacht DNA sensing processen en als zodanig kan het concatemerized DNA worden gebruikt om meerdere aspecten van DNA detectie in vivo probe.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

De auteurs hebben geen erkenningen.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
Stimulatie van Cytoplasmatische DNA Sensing Pathways<em&gt; In Vitro</em&gt; En<em&gt; In Vivo</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter