Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

גירוי של cytoplasmic מסלולי חישה DNA doi: 10.3791/51593 Published: September 18, 2014

Summary

מטרת הפרוטוקול היא להשתמש בשיטות אופטימליות לגירוי מסלולי חישת DNA cytoplasmic בתאי in vivo. זו מושגת על ידי שיפור הדור של DNA הארוך, פעמיים תקועים בקשירה בוטה סוף. תאים או עכברים אז transfected באמצעות מגיב transfection שומנים בדם.

Abstract

כדי לעורר תגובה חיסונית מולדת ביעילות, DNA חייב להיות באורך ובטהרה מספיק. אנו מציגים שיטה בי גדילי הדנ"א כפול (dsDNA) שבו יש את המאפיינים הדרושים כדי לעורר את DNA cytoplasmic יכולים להיות שנוצר מסלולי חישה במחיר זול ובקלות. על ידי concatemerization של oligonucleotides הקצר, סינטטי (אשר חסרים מוטיבים CPG), יכול להיות שנוצר dsDNA להיות באורך מספיק כדי להפעיל את מסלול חישת DNA cytosolic. פרוטוקול זה כרוך קשירת קצה קהה של oligonucleotides בנוכחות פוליאתילן גליקול (PEG), המספקת סביבה לקשירה יעילה להתרחש. ניתן להשתמש concatemers dsDNA, הבא לטיהור על ידי מיצוי פנול / כלורופורם, כדי לדמות את התגובה החיסונית המולדת במבחנה על ידי פרוטוקולי transfection סטנדרטיים. גם DNA זה יכול לשמש כדי לעורר חסינות מולדת in vivo על ידי הזרקת intradermal לתוך אפרכסת אוזנו של עכבר, למשל. על ידיתקנון תהליך concatemerization ופרוטוקולי גירוי שלאחר מכן, הפעלה אמינה ושחזור של מערכת החיסון המולדת יכולה להיות מיוצר.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

DNA הוא מרכיב חיוני של כל היצורים והתאים, שאאוקריוטים לשמור בתאים ספציפיים. פונקציה אחת של מערכת החיסון המולדת היא לזהות כאשר מידור כזה מתקלקל או כאשר חומר זר מוחדר האורגניזם באמצעות הפרת מחסומים פיזיים, חיצוניים. בגוף האדם יש מספר החלבונים שקיימים כדי לעזור לבזות כמויות קטנות של DNA שעשויה לברוח המידור הנכון; DNAse I, II, III ולשבור DNA בפלזמה, endosome, וcytosol, בהתאמה. עם זאת, זה כבר הראה כי עכברים חסרי DNAse השני למות מאנמיה קשה שנגרמה על ידי ייצור מוגבר של האינטרפרונים 1 מצביעים על כך שמערכת החיסון המולדת מגיבה לDNA במיוחד גרעיני. תגובה זו מתרחשת גם בעכברים שהם לגמרי חסרי יכולת איתות קולט חיוג כמו. מחקרים רבים כעת מוצגים ממריץ שגני אינטרפרון (סטינג) 2 וקינאז מחייב TANK 1 (TBK1) 3 מעורבים בזיהוי של DNA בציטופלסמה ושמסלול איתות זה מפעיל גורם אינטרפרון רגולציה (IRF) -3 4. שעתוק IRF3 תלוי הבא של ציטוקין, chemokine, וגני אינטרפרון הוא אופייני לתגובה חיסונית מולדת או פתוגן או סכנה הקשורים דפוס מולקולרי (PAMP או לח) 5.

הרצון ללמוד מסלולי חישת חומצות גרעין תאיים הוביל לדרישה לפתח שיטות חזקות ושחזור לגירוי תאים על ידי החדרת דנ"א או רנ"א לתוך תאים ללא הפעלת תגובה חיסונית מולדת אחרת. שיטה אחת שבאמצעותו יכול להיות מגורה את העוקץ / TBK1 / מסלול IRF3 היא באמצעות חומרים כימיים transfection שומנים בדם קטיוני כדי לספק חומצות גרעין לתוך הציטופלסמה שבו ניתן להגיע על ידי חיישני DNA כגון DNA-PK, IFI16, וcGAS 6-8.

המאפיינים של DNA שהם הבינו כעת כדי לאפשר effהפעלת icient של תגובת החיסון המולדת cytoplasmic ללא גירוי של מסלולים אחרים שלה אורך, מסה, טוהר, וחוסר CPG מוטיבי 4,7,9. oligonucleotides סינטטי מתאים ביותר לצורך הפקת תגובה חיסונית מולדת מאחר שהם מאפשרים את רצף DNA להיות מותאמים ומוכן כמו לתרכובות כימיות טהורות. רצף חיסוני גירוי 45 זוג בסיס DNA (ISD) זוהה על ידי et al כובע רחב שולי. 4 כרצף מתאים, CPG ללא למטרה זו. רצף dsDNA זה אחרת אקראי ואין לו תכונות ספציפיות מעבר לחוסר המוטיבים CPG. מצאנו כי על ידי concatemerizing oligonucleotide ISD לגדילים ארוכים יותר מגביר באופן משמעותי את גודל הגירוי 7. דור של ISD concatemerized לכן הוא שימושי עבור גירוי תגובה חיסונית מולדת cytoplasmic. כאן אנו מציגים פרוטוקולים להכנה מגיב זה וכיצד ניתן להשתמש בו כדי להפעיל את מסלול חישת DNA במבחנה, כמו גם in vivo.

הערה: כל המחקרים בבעלי החיים מתבצעים תחת פרוטוקולים מוסדיים אושרו והנחיות טיפול בבעלי החיים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

.1 Concatemerization

  1. פריימרים Resuspend Fw וRv (ראו טבלה של חומרים לרצפי פריימר) לריכוז של 10 מיקרוגרם / μl בH הכיתה ביולוגיה מולקולרית 2 O. לאחר מכן, לערבב 5 μl של Fw ו5 μl של פריימר Rv בצינור 1.5 מ"ל microcentrifuge.
  2. תמהיל לחשל פריימר על ידי חימום לטמפרטורה הנכונה חישול (75 מעלות צלזיוס במשך פריימרים שתוארו כאן) ל15 דקות. השאר על ספסל להתקרר בטמפרטורת חדר (RT). הכן את PEG8000 60% במהלך דגירה זה על ידי ההמסה בDDH 2 O.
  3. הוסף 50 μl של 60% PEG8000 (כדי להשיג ריכוז סופי של 30%), 10 μl של 10x קינאז polynucleotide חיץ (PNK), 27 μl של H 2 O, ו3 μl של PNK לתערובת פריימר. לדגור על 37 מעלות צלזיוס למשך 2 שעות.
  4. להתקרר ב RT ולהוסיף 11 μl של חיץ האנזים DNA. לאחר מכן להוסיף 3 U של האנזים DNA ולדגור על 37 מעלות צלזיוס למשך לילה.

.2 DNA טיהורוניתוח

  1. הוסף 300 μl של H 2 O כדי להגדיל את הנפח של תערובת קשירה. הערה: המשך במנדף בשל רעילות של פנול: אדי כלורופורם.
  2. הוסף 1 נפח (400 μl) של פנול: כלורופורם ומערבבים על ידי ניעור נמרץ.
  3. צנטריפוגה במהירות מרבית דקות 1 בmicrocentrifuge שולחן. השכבות מימיות וממס יפרידו עם השכבה המימית על גבי ושכבה לבנה של חלבון זירז בין שתי השכבות.
  4. העבר את השכבה עליונה לצינור חדש על ידי pipetting זהיר (להימנע מהעברת אמצע, שכבה לבנה)
  5. חזור על שלבים 2.2 ו2.3 לפחות פעמיים או עד שאין חלבון זירז לאחר צנטריפוגה.
  6. הוסף 1 נפח (400 μl) של כלורופורם וחזור על שלבים 2.3-2.4.
  7. הוסף 2 כרכים (800 μl) של אתנול 100% prechilled ולדגור על -20 מעלות צלזיוס במשך שעה לפחות 1 או לילה. הערה: בשלב זה משקעים concatemers DNA.
  8. ספין למטה במהירות מקסימלית וSupe לשאובrnatant. לשטוף פעם אחת על ידי הוספת 1 מ"ל של אתנול 70% ולאפשר לאוויר יבש במנדף.
  9. DNA הגלול ב50 μl של רעלן הפנימי DDH החופשי 2 O. הערה: השימוש בחומרים כימי רעלן פנימי חופשי הוא קריטי ליצירת תגובה חיסונית מולדת DNA הספציפי בתאי in vivo.
  10. הסר aliquot 2 μl של DNA concatemerized לתוך צינור טרי ולהוסיף למאגר טעינת ג'ל DNA 1 מ"ל.
  11. לפזר 1% agarose במאגר טה על ידי חימום במלוא העצמה במיקרוגל למשך 2 דקות (או זמן שהוא מתאים לכוחו של התנור והנפח).
  12. יוצקים ג'ל למנגנון ליהוק, להוסיף 4 μl של צבע chelating DNA ניאון, להכניס מסרק, ומשאיר בטמפ 'החדר למשך כ 20 דקות לג'ל להגדיר.
  13. ברגע שקבוצה, להסיר את הג'ל מסרק ומקום לטנק אלקטרופורזה המכיל חיץ טה. טען 3 μl של סמני דגימת DNA או גודל לתוך בארות.
  14. הפעל ג'ל אלקטרופורזה ל30-40 דקות ב90 V עם זרם קבוע. Visualize DNA תחת אור אולטרה הסגול להתבונן concatemerization (איור 1 א).
  15. למדוד את ריכוז DNA בשאר המדגם ידי ספקטרוסקופיה ספיגת UV. בלנק ספקטרומטר עם אותו O DDH 2 ששימש לresuspend DNA ולמדוד את ספקטרום הספיגה 200-300 ננומטר. הערה: ריכוז DNA יכול להיות מחושב באמצעות חוק באר למברט, l * = e * ג, שבו הוא הספיגה, דואר מקדם הכחדה, ואני המרחק של נתיב האור. למדידת DNA ריכוזי הספיגה ב 260 ננומטר יש למדוד ומקדם הכחדה של 0.027 (מיקרוגרם / מ"ל) -1 סנטימטר -1 בשימוש. מרחק נתיב האור, l, ישתנה בהתאם לספקטרופוטומטר. תוך מדידת הריכוז, לרשום את יחס ספיגת 260/280 ננומטר כאינדיקציה לטוהר DNA; ערך עבור יחס זה של 2.00 מעל מומלץ.

.3 Transfection של dsDNA Concatemers בVitro

  1. תאי זרע בצלחת תרבית רקמה או צלחת להיות מחוברות 70% בשעת הגירוי.
  2. לחשב את המסה של DNA דרושה לגירוי של תאים באמצעות ריכוז סופי של 1-10 מיקרוגרם / מ"ל. המסה הנדרשת של DNA תצוין כX להלן. לדוגמא, אם מגרה תאים בבאר אחד של צלחת 6 היטב עם 2 מ"ל של מדיום בריכוז של DNA של 5 מיקרוגרם / מ"ל ​​אז מסה של 2 * 5 = 10 מיקרוגרם של DNA נדרש.
  3. הוסף 50 μl * X של מדיום סרום ללא לתוך צינור סטרילי בגודל מתאים. פיפטה בזהירות למרכז של המדיום, בלי לגעת בצד של הצינור, 2 * X μl של מגיב transfection שומנים בדם קטיוני ולהשאיר למשך 5 דקות.
  4. הוספת מיקרוגרם X של DNA לזמן קצר צינור ומערבולת. השאר בRT לפחות 20 דקות. עבור transfection במבחנה להוסיף את התערובת ישירות לתאים כדי לעורר מסלולי חישת DNA cytoplasmic.

.4 Transfection של dsDNA Concatemers אניn Vivo

  1. הכן תערובת transfection כמתואר ב3.1-3.5 באמצעות DNA 1 מיקרוגרם, מגיב transfection השומנים 2 μl, ו18 סרום μl מדיום חופשי לאוזן עכבר כדי להיות מגורה. הכן מזרק סטרילי 20 μl המילטון, כובע עם מחט G 30 סטרילי, ולטעון עם תערובת transfection DNA.
  2. הרדימי C57BL / 6 עכבר באמצעות 1-2 isoflurane%. לאשר הרדמה על ידי אובדן של תנועה וקצב נשימה קבועה ועל ידי בדיקת רפלקס קמצוץ במידת צורך. לפקח את עיניו של בעל החיים במהלך ההרדמה ולהשתמש במשחה כנדרש כדי למנוע יובש מוגזם.
  3. באמצעות טכניקה סטרילית, להזריק בזהירות לתוך אפרכסת האוזן 10 μl של תמהיל transfection כך ש'בועה 'אחת של נוזל נוצר בין שכבות העור של האוזן. הערה: השתמש באצבעון גומי באצבע האגודל או מדד שלך, למתוח את האוזן על זה, ולהזריק בזווית חדה, כדי להבטיח את המחט חודרת את השכבה הראשונה בלבד של עור של אפרכסת האוזן.
  4. רייןtroduce עכבר חזרה לכלוב ובאופן קבוע לפקח על התאוששות לאחר הרדמה. השתמש במנורת חימום, כדי למנוע קירור יתר של העכברים המורדמים. אל תשאירו עכברים ללא השגחה עד שהם חזרו להכרה מספיק כדי לשמור על כיבה sternal.
  5. פלאש להקפיא את כל אפרכסת האוזן בצינור microcentrifuge על ידי טבילה בחנקן נוזלי למשך 2 דקות.

.5 עיבוד דגימת DNA מאולצת וניתוח על ידי PCR (qPCR)

  1. מתרבית תאים: בינוני לשאוב עם טפטפת וזורקי פסולת.
  2. הוסף 1 מ"ל של PBS סטרילית. חזור על 5.1 ו5.2 פעמיים והמשיכו לשלב 5.3
  3. מרקמת אוזן: לטחון רקמה תחת חנקן נוזלי באמצעות העלי הקרמיקה סטרילי ומרגמה, להעביר רקמת קרקע לצינור microcentrifuge בעזרת מרית סטרילי, והמשך לשלב 5.4
  4. הוסף חוצץ תמוגה 350 μl ולהמשיך עם פרוטוקול ערכת חילוץ RNA המסחרי. Elute RNA מטיהור ערכת חילוץטור ב40 μl DDH 2 O. הערה: ערכת חילוץ RNA המסחרית (ראה חומרים / שולחן ציוד) עובד טוב מאוד; טכניקות אחרות נבדקו עם תוצאות subpar.
  5. לכמת RNA על ידי ספקטרוסקופיה UV כפי שתואר עבור DNA לעיל (סעיף 2.13). הערה: מקדם ההכחדה לRNA הוא 0.025 (מיקרוגרם / מ"ל) -1 -1 סנטימטר.
  6. הוסף לμl PCR צינור 1 סטרילי של אוליגו פריימר (DT), ul 1 של 10 מ"מ dNTP לערבב, ו250 RNA מיקרוגרם. הפוך את הווליום ל11 μl עם DDH סטרילי 2 O.
  7. דגירה של 5 דקות על 65 מעלות צלזיוס. ואז להוסיף 4 μl הראשונה סטרנד הצפת, 1 μl 0.1 M dithiothreitol, 0.25 μl הפוך transcriptase ו1.75 μl DDH 2 O לצינור. לדגור על 50 מעלות צלזיוס במשך שעה 1 ואחריו 72 מעלות צלזיוס במשך 15 דקות. לחלופין, לדלל מוצר cDNA 1: 5 באמצעות DDH 2 O.
  8. לPCR כמו cDNA שימוש 2 μl, DDH 2 O, תערובת אב qPCR 5 μl 2 μl, ו1μl כל אחד מ10 אום קדימה לאחור מניות פריימר כדי להגביר גן (ים) על פי בחירה. מערבבים בצלחת 96 היטב ולנתח באמצעות מכונה PCR (1B דמויות ו1C).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

התוצאות להלן מצביעות על כך שDNA concatemerized יכול להיות שנוצר בקלות יחסית, והוא מסוגל גירוי תגובה חיסונית מולדת חזקה בתאים ובעכברים. עם השימוש בPEG8000, זה ניתן לראות בבירור כי אורך DNA שנוצר הוא באופן משמעותי יותר ומסוגל גרימת שעתוק של Cxcl10 באותה מידה. כפי שניתן לראות על ידי ניתוח agarose ג'ל, יש concatemerization הסטנדרטי אורכים של DNA של עד 800 זוגות בסיסים (bp), ואילו עבור המדגם עם PEG8000, האורך של DNA כולל גדילים בעודף של 10,000 נ"ב (איור 1 א). Transfection של DNAs אלה לפיברובלסטים עכבריים עובריים (MEFs) או עכברים גורם שעתוק חזק של ציטוקינים וכמוקינים שניתן למדוד על ידי qPCR המציין גירוי של מכונות חישת DNA החיסון המולדת (1B דמויות ו1C).

מודעה / 51,593 / 51593fig1highres.jpg "/>
.1 נתוני איור נציג המציינים את הייצור של DNA concatemerized ISD (conDNA) וגירוי של פיברובלסטים ועכברים. () מדגם של DNA concatemerized מיוצרים עם או בלי PEG8000 נותח על ידי ג'ל אלקטרופורזה agarose. MEFs (ב) היה מגורה עם DNAs השונים ב10 מיקרוגרם / מ"ל והרמות של CXCL10 וIL-6 mRNAs שנמדדו על ידי qPCR 6 שעות מאוחר יותר. עכברים (C) הוזרקו בנוצות שהאוזן עם conDNA והרמות של CXCL10 וIL-6 mRNAs שנמדדו על ידי qPCR 12 שעות מאוחר יותר. הנתונים מוצגים כפי עלייה ביחס לרמה של HPRT (RQ) וסורגי שגיאה +/- SEM (n = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הפרוטוקולים המתוארים כאן משמשים ליצירת dsDNA כדי לעורר את התגובה החיסונית המולדת cytosolic עם תוצאות לשחזור במגוון רחב של סוגי התאים וin vivo. מאז מגיב המצע העיקרי המשמשים הוא oligonucleotide סינטטי, יש גמישות במערכת זו לשימוש ברצפי DNA חלופיים או שינויים כימיים. זה אפשרי, למשל, להחליף את oligonucleotide הגדיל קדימה תואר בפרוטוקול זה עם אחד המכיל תווית ניאון או מחצית ביוטין כדי לעקוב אחר לוקליזציה או להעריך אינטראקציות עם מולקולות ביולוגיות אחרות.

אחד היתרונות העיקריים של concatemerization DNA הוא הייצור של גדילים הארוכים של dsDNA באופן שהרצף יכול להיות נשלט. יש מגבלה אחת כאן שהיא שאורך DNA לא יכול להיות במעקב בדיוק כך המוצר של התגובה הזו היא תמיד תערובת של דנ"א באורכים שונים (בדומה לפולי האנלוגיים RNA המסחריים (אני: C)). יתרון נוסף של שיטה זו הוא שהיא מאפשרת הייצור של כמויות מסה גדולות של DNA חיסוני גירוי (עד מ"ג כמויות). צעד concatemerization וניתן לשנותם בקלות כפי שנדרש, אם כי יש לציין שלאחר מכן צריכה להתבצע שלבים לטיהור שלאחר מכן בaliquots של הסולם המפורטים בפרוטוקול.

בהשוואה לשיטות אחרות של concatemerizing DNA, בנוסף העיקריים הוא השימוש בPEG8000 לתערובת קשירה כדי לשפר את יעילות קשירה. שימו לב שPEG8000 עלול להיות קשה לפזר לעשות 60% (w / v) במלאי אבל ניתן vortexed ועדינות מחוממת כדי לעזור solubilization. קשירה ניתן להשאיר לדגירה לתקופות ארוכות יותר מכפי שצוין, אבל זה לא נראה להשפיע על האורך של DNA שנוצר. זקוקים לטיפול מסוים להיות גם ציין בעת ​​טיפול פנול וכלורופורם כמו אלה יכולים להיות מסרטן ומאכל. בידיים שלנו גנים שהוגברו על ידי DNAs הסינתטי אחר (כגון פולי המסחריים (DA: DT)) שונה מאלה שהוגברו על ידי ISD concatemerized. עם זאת, אחרים לא מצאו הבדלים כאלה 10, אשר עשויים לשקף וריאציה בין סוגי התאים להיות מנותחת. על אף קונפליקטים כאלה, ISD concatemerized הוא זול יותר באופן משמעותי ליצירה בהשוואה לפולי רכישה (DA: DT) ממקור מסחרי ומאפשר גמישות רבה יותר באמצעות בחירה של רצף ושינויים.

היבט אחד של חישת DNA שנמצא תחת נלמד הוא תגובת in vivo לגירוי. אנחנו הראינו כי פרוטוקול זה יכול לשמש כדי ליצור DNA המתאים בניסויי vivo 7. מוצר dsDNA הוא טהור ושל מספיק ריכוז גבוה כדי לאפשר הזרקה לעכברים ומדידה עוקבת של תהליכי איתות חיסון מולדים. בפרוטוקול המתואר כאן, יש להקפיד על מנת להבטיח את המים המשמשים להמסת גלולה DNA הסופית הוא רעלן הפנימי, RNase, וDNase חופשי. הזרקה של DNA או דנ"א החופשיתוצאות מתחמי שומנים בתגובת אינטרפרון כצפוי של תהליכי חישת DNA ו, בתור שכזה, DNA concatemerized יכול לשמש כדי לחקור היבטים רבים של DNA חישת in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

אי לנו תודות.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
גירוי של cytoplasmic מסלולי חישה DNA<em&gt; במבחנה</em&gt; ו<em&gt; בVivo</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter