Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

La stimolazione dei citoplasmatici DNA Sensing Pathways doi: 10.3791/51593 Published: September 18, 2014

Summary

L'obiettivo del protocollo è quello di utilizzare metodi ottimali per stimolare i percorsi citoplasmatici rilevamento del DNA in cellule e in vivo. Questo risultato è ottenuto migliorando la generazione di lunga, il DNA a doppio filamento durante blunt-end legatura. Le cellule o topi sono poi transfettate con un reagente di trasfezione lipidico.

Abstract

Al fine di stimolare efficacemente una risposta immunitaria innata, il DNA deve essere di lunghezza e purezza sufficiente. Vi presentiamo un metodo in cui DNA a doppia elica (dsDNA), che ha le caratteristiche necessarie per stimolare il DNA citoplasmatico percorsi di rilevamento possono essere generati a basso costo e con facilità. Con la concatemerization di brevi oligonucleotidi sintetici (che manca motivi CpG), dsDNA possono essere generati per essere di lunghezza sufficiente per attivare il rilevamento del DNA citosolico percorso. Questo protocollo prevede la legatura punta smussata degli oligonucleotidi in presenza di polietilene glicole (PEG), che fornisce un ambiente per la legatura efficiente a verificarsi. Le concatemers dsDNA possono essere utilizzati, a seguito purificazione per estrazione con fenolo / cloroformio, per simulare la risposta immunitaria innata in vitro da protocolli di trasfezione standard. Questo DNA può anche essere utilizzato per stimolare l'immunità innata in vivo mediante iniezione intradermica nel padiglione auricolare di un mouse, per esempio. Dastandardizzare il processo concatemerization e protocolli di stimolazione successivi, l'attivazione affidabile e riproducibile del sistema immunitario innato può essere prodotta.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il DNA è una componente vitale di tutti gli organismi e le cellule eucarioti, che mantengono in compartimenti specifici. Una funzione del sistema immunitario innato è quello di individuare quando tale compartimentazione si rompe o quando il materiale estraneo viene introdotto nell'organismo attraverso una violazione delle barriere fisiche, esterni. Nel corpo umano ci sono una serie di proteine ​​che esistono per aiutare a degradare piccole quantità di DNA che possono sfuggire alla compartimentazione corretta; DNAsi I, II, e III abbattere DNA nel plasma, endosome, e citosol, rispettivamente. Tuttavia, è stato dimostrato che i topi privi DNAse II muoiono da grave anemia causata da eccessiva produzione di interferoni 1 suggeriscono che il sistema immunitario innato risponde a DNA extra-nucleare. Questa risposta si verifica anche nei topi, che sono del tutto carenti di capacità di segnalazione dei recettori toll-like. Numerosi studi hanno ormai dimostrato che stimolatore dei geni interferone (STING) 2 e-TANK vincolante chinasi 1 (TBK1) 3 sono coinvolti nella rilevazione del DNA nel citoplasma e che questa via di segnalazione attiva interferon fattore di regolazione (IRF) -3 4. La successiva trascrizione IRF3-dipendente di citochine, chemochine, e geni interferone è caratteristico di una risposta immunitaria innata, o un agente patogeno o di pericolo associato modello molecolare (PAMP o umido) 5.

Il desiderio di studiare intracellulari nucleici percorsi di rilevamento acido ha portato alla necessità di sviluppare metodi affidabili e riproducibili per stimolare le cellule con l'introduzione di DNA o RNA nelle cellule senza attivare altre risposte immunitarie innate. Un metodo con cui il STING / TBK1 / IRF3 percorso possono essere stimolati sia utilizzando cationici reagenti di trasfezione lipidico per fornire acido nucleico nel citoplasma, dove si può accedere da sensori di DNA come il DNA-PK, IFI16, e CGAs 6-8.

Le caratteristiche del DNA che sono attualmente compresi per consentire effl'attivazione icient della risposta immunitaria innata citoplasmatica senza stimolazione di altre vie sono la sua lunghezza, massa, la purezza, e la mancanza di CpG motivi 4,7,9. Oligonucleotidi sintetici sono altamente adatti allo scopo di generare una risposta immunitaria innata quanto permettono la sequenza di DNA di ottimizzare e preparato come una specie chimica pura. Un immuno-stimolante DNA (ISD) sequenza di 45 coppie di basi è stato identificato da Stetson et al. 4 come un adeguato, sequenza CpG-libero per questo scopo. Questa sequenza dsDNA è altrimenti casuale e non ha caratteristiche specifiche di là della sua mancanza di motivi CpG. Abbiamo trovato che concatemerizing l'oligonucleotide DSI in fili significativamente più lunghi aumenta l'ampiezza della stimolazione 7. Generazione di ISD concatemerized è quindi utile per stimolare una risposta immunitaria innata citoplasmatica. Qui vi presentiamo i protocolli per la preparazione di questo reagente e come può essere utilizzato per attivare il percorso di rilevamento del DNA invitro e in vivo.

NOTA: Tutti gli studi sugli animali vengono eseguiti secondo protocolli istituzionali approvate e linee guida per la cura degli animali.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1 Concatemerization

  1. Risospendere primer Fw e Rv (vedere Tabella dei materiali per le sequenze dei primer) ad una concentrazione di 10 mg / mL in biologia molecolare di grado H 2 O. Poi, mescolare 5 ml di Fw e 5 ml di Rv innesco in una provetta da 1,5 ml microcentrifuga.
  2. Miscela di primer Anneal mediante riscaldamento alla temperatura di ricottura corretta (75 ° C per i primers descritti) per 15 min. Lasciare in panchina per raffreddare a temperatura ambiente (RT). Preparare la PEG8000 del 60% durante questo incubazione sciogliendo in DDH 2 O.
  3. Aggiungere 50 ml di 60% PEG8000 (per ottenere una concentrazione finale del 30%), 10 ml di 10x polinucleotide chinasi (PNK) di buffer, 27 ml di H 2 O, e 3 ml di PNK alla miscela di primer. Incubare a 37 ° C per 2 ore.
  4. Raffreddare a temperatura ambiente e aggiungere 11 ml di tampone di DNA ligasi. Quindi aggiungere 3 U di DNA ligasi e incubare a 37 ° C durante la notte.

2. DNA Purificatione analisi

  1. Aggiungere 300 ml di H 2 O per aumentare il volume del mix legatura. Nota: Procedere in una cappa aspirante a causa della tossicità del fenolo: vapori di cloroformio.
  2. Aggiungere 1 volume (400 ml) di fenolo: cloroformio e mescolare agitando energicamente.
  3. Centrifugare alla massima velocità per 1 minuto in una microcentrifuga da tavolo. Gli strati acquosi e solventi separerà con lo strato acquoso sulla parte superiore e uno strato bianco di proteina precipitata tra i due strati.
  4. Trasferimento strato superiore in una nuova provetta da un'attenta pipettaggio (evitare di trasferire centrale, strato bianco)
  5. Ripetere i punti 2.2 e 2.3 almeno due volte o fino a quando non vi è alcuna proteina precipitata dopo la centrifugazione.
  6. Aggiungere 1 volume (400 ml) di cloroformio e ripetere i passaggi 2,3-2,4.
  7. Aggiungere 2 volumi (800 microlitri) di etanolo al 100% prechilled e incubare a -20 ° C per almeno 1 ora o durante la notte. NOTA: questo passaggio precipita le concatemers DNA.
  8. Spin down alla massima velocità e aspirare supernatant. Lavare una volta con l'aggiunta di 1 ml di etanolo al 70% e lasciare asciugare in cappa.
  9. DNA Risospendere in 50 ml di endotossina DDH 2 O. libero Nota: L'uso di reagenti endotossina libera è fondamentale per generare una risposta immunitaria innata specifica-DNA in cellule e in vivo.
  10. Rimuovere un'aliquota 2 microlitri di DNA concatemerized in una nuova provetta e aggiungere 1 ml di tampone del gel del DNA di carico.
  11. Sciogliere 1% agarosio in tampone TAE mediante riscaldamento alla massima potenza in un forno a microonde per 2 min (o tempo adeguato alla potenza del forno e volume).
  12. Versare il gel in Impianto di colata, aggiungere 4 ml di colorante fluorescente chelante DNA, inserire un pettine, e lasciare a temperatura ambiente per circa 20 minuti per il gel per impostare.
  13. Una volta impostato, rimuovere il gel pettine e posto nel serbatoio elettroforesi contenente tampone TAE. Carico 3 ml di campione di DNA o di dimensioni marcatori nei pozzetti.
  14. Eseguire l'elettroforesi su gel per 30-40 min a 90 V con corrente costante. Visualize il DNA sotto luce ultravioletta per osservare concatemerization (Figura 1A).
  15. Misurare la concentrazione di DNA nel resto del campione mediante spettroscopia assorbanza UV. Blank lo spettrometro con la stessa DDH 2 O che è stato utilizzato per risospendere il DNA e misurare lo spettro di assorbanza 200-300 nm. NOTA: la concentrazione di DNA può essere calcolata utilizzando la legge di Beer-Lambert, A = e * c * l, dove A è l'assorbanza, via e il coefficiente di estinzione, e l la distanza del percorso della luce. Per misurare le concentrazioni di DNA l'assorbanza a 260 nm dovrebbe essere misurato e un coefficiente di estinzione di 0,027 (mg / ml) -1 cm -1 utilizzato. La luce distanza percorso, l, varierà a seconda dello spettrofotometro. Durante la misurazione della concentrazione, prendere nota del rapporto di assorbanza 260/280 nm come un'indicazione di purezza del DNA; è raccomandato un valore per questo rapporto di cui sopra 2.00.

3. trasfezione di dsDNA Concatemers in vitro

  1. Cellule seme in un piatto di coltura di tessuti o piastra per essere il 70% confluenti al momento della stimolazione.
  2. Calcolare la massa di DNA necessario per la stimolazione delle cellule utilizzando una concentrazione finale di 1-10 mg / ml. La massa necessaria di DNA noterà come X sotto. Per esempio se stimolando le cellule in un singolo pozzetto di una piastra da 6 pozzetti con 2 ml di terreno ad una concentrazione di DNA su 5 mcg / ml poi una massa di 2 * 5 = 10 mg di DNA è necessaria.
  3. Aggiungere 50 * X ml di mezzo privo di siero in una provetta sterile di dimensioni adatte. Pipettare accuratamente nel centro del mezzo, senza toccare il lato del tubo, 2 * X microlitri di lipidi cationici reagente di trasfezione e lasciar riposare per 5 min.
  4. Aggiungere X mg di DNA brevemente tubo e vortex. Lasciare a temperatura ambiente per almeno 20 min. Per la trasfezione in vitro aggiungere questa miscela direttamente alle cellule per stimolare citoplasmatici percorsi di rilevamento del DNA.

4 trasfezione di dsDNA Concatemers In Vivo

  1. Preparare la miscela di trasfezione come descritto nella 3,1-3,5 con 1 mg di DNA, 2 ml di reagente di trasfezione lipidico, e 18 microlitri di siero medio gratuito per orecchio mouse per essere stimolato. Preparare una sterile 20 ml siringa Hamilton, tappo con una sterile 30 G aghi, e caricare con la miscela di trasfezione del DNA.
  2. Anestetizzare un C57BL / 6 del mouse utilizzando 1-2% isoflurano. Confermare l'anestesia da perdita di movimento e frequenza respiratoria costante e da un pizzico reflex test, se necessario. Monitorare gli occhi dell'animale durante l'anestesia e utilizzare unguento come richiesto per evitare eccessiva secchezza.
  3. Usando una tecnica sterile, iniettare con cura nel padiglione auricolare 10 ml di miscela di trasfezione in modo che un singolo 'bolla' di liquido è formato tra gli strati dermici dell'orecchio. Nota: Utilizzare un ditale in gomma sul pollice o indice, tendere l'orecchio su di esso, e iniettare ad angolo acuto al fine di garantire l'ago penetra solo il primo strato di pelle del padiglione auricolare.
  4. Reindurre il mouse indietro nella gabbia e monitorare regolarmente recupero post-anestetico. Utilizzare una lampada di riscaldamento per evitare un eccessivo raffreddamento dei topi anestetizzati. Non lasciare incustoditi i topi prima di aver ripreso conoscenza sufficiente per mantenere decubito sternale.
  5. Flash congelare l'intero padiglione auricolare in una provetta da microcentrifuga da immersione in azoto liquido per 2 min.

5. Trattamento delle stimolato DNA campioni e analisi mediante PCR quantitativa (qPCR)

  1. Dalla coltura cellulare: medio aspirato con una pipetta e scartare rifiuti.
  2. Aggiungere 1 ml di PBS sterile. Ripetere 5.1 e 5.2 due volte e passare al punto 5.3
  3. Dal tessuto orecchio: macinare il tessuto sotto azoto liquido utilizzando pestello in ceramica sterili e malta, il trasferimento di tessuto a terra in una provetta con una spatola sterile, e passare al punto 5.4
  4. Aggiungere 350 microlitri tampone di lisi e procedere con l'RNA commerciale protocollo kit di estrazione. Eluire RNA dall'estrazione kit di purificazionecolonna 40 microlitri DDH 2 O. Nota: il kit di estrazione di RNA commerciale (vedi materiali / attrezzature da tavola) funziona molto bene; altre tecniche sono state testate con risultati scadente.
  5. Quantificare RNA mediante spettroscopia UV come descritto per il DNA in precedenza (punto 2.13). Nota: il coefficiente di estinzione per l'RNA è 0,025 (mg / ml) -1 cm -1.
  6. Aggiungere a una sterile PCR tubo 1 ml di oligo (dT) primer, 1 ul di dNTP 10 mM mix, e 250 mg di RNA. Portare al volume di 11 microlitri con DDH 2 O. sterile
  7. Incubare per 5 minuti a 65 ° C. Quindi aggiungere 4 ml First Strand Buffer, 1 ml 0.1 M ditiotreitolo, 0,25 ml trascrittasi inversa e 1,75 ml DDH 2 O al tubo. Incubare a 50 ° C per 1 ora seguito da 72 ° C per 15 min. In alternativa, diluire il cDNA prodotto 1: 5 con DDH 2 O.
  8. Per la PCR quantitativa uso 2 microlitri di cDNA, 2 ml DDH 2 O, 5 microlitri qPCR master mix, e 1ml ciascuna di 10 uM avanti e indietro le scorte di primer per amplificare gene (s) di scelta. Mescolare in una piastra a 96 pozzetti e analizzare utilizzando una macchina di PCR quantitativa (Figure 1B e 1C).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I risultati seguenti indicano che il DNA concatemerized può essere generato con relativa facilità ed è in grado di stimolare una risposta immunitaria innata robusta nelle cellule e nei topi. Con l'uso di PEG8000, si vede chiaramente che la lunghezza del DNA generato è significativamente più lungo e ugualmente in grado di indurre la trascrizione di CXCL10. Come si vede dalle analisi su gel di agarosio, il concatemerization standard ha lunghezze di DNA di 800 paia di basi (bp), mentre per il campione con PEG8000, la lunghezza del DNA comprende fili eccedenti 10.000 bp (Figura 1A). Trasfezione di questi DNA in fibroblasti murini embrionali (MEF) o topi induce una robusta trascrizione di citochine e chemochine, che può essere misurata con qPCR indicando la stimolazione del sistema immunitario innato DNA rilevamento macchinari (Figure 1B e 1C).

annuncio / 51593 / 51593fig1highres.jpg "/>
Figura 1. dati rappresentativi indicano la produzione di DNA ISD concatemerized (conDNA) e la stimolazione dei fibroblasti e topi. (A) Un campione di DNA concatemerized prodotte con o senza PEG8000 analizzati mediante elettroforesi su gel di agarosio. (B) MEF sono state stimolate con diversi DNA a 10 mcg / ml e livelli di CXCL10 e IL-6 mRNA misurati mediante qPCR 6 ore più tardi. (C) I topi sono stati iniettati nella padiglioni auricolari con conDNA ei livelli di CXCL10 e IL-6 mRNA misurato da qPCR 12 ore più tardi. I dati viene mostrato come volte superiore rispetto al livello di HPRT (RQ) e barre di errore sono +/- SEM (n = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I protocolli qui descritti sono utilizzati per generare dsDNA per stimolare la risposta immunitaria innata citosolico con risultati riproducibili in una vasta gamma di tipi cellulari che in vivo. Poiché il principale reagente substrato utilizzato è un oligonucleotide sintetico, vi è la flessibilità in questo sistema per l'utilizzo di sequenze di DNA alternative o modificazioni chimiche. E 'possibile, per esempio, per sostituire l'oligonucleotide filo avanti descritto in questo protocollo con uno che contiene un'etichetta fluorescente o un residuo biotina per monitorare la localizzazione o valutare le interazioni con altre biomolecole.

Uno dei principali vantaggi di concatemerization DNA è la produzione di lunghi filamenti di dsDNA in modo che la sequenza può essere controllato. Vi è una limitazione che qui è che la lunghezza del DNA non può essere controllata con precisione in modo che il prodotto di questa reazione è sempre una miscela di DNA di lunghezza diversa (simile al commerciale poli RNA analogico (I: C)). Un altro vantaggio di questa tecnica è che permette la produzione di grandi quantità di massa di immuno-stimolante DNA (fino a mg importi). Il passo concatemerization può essere scalato facilmente come richiesto, anche se va notato che le successive fasi di purificazione devono poi essere effettuate in aliquote della scala delineata nel protocollo.

Rispetto ad altri metodi di concatemerizing DNA, l'aggiunta principale è l'uso di PEG8000 al mix legatura per migliorare l'efficienza legatura. Si noti che PEG8000 può essere difficile da sciogliere per fare un 60% (w / v) stock ma può essere vortexate e delicatamente riscaldato per aiutare solubilizzazione. La legatura può essere lasciata ad incubare per periodi più lunghi di quanto indicato, ma questo non sembra influenzare la lunghezza del DNA generato. Alcuni bisogni assistenziali anche essere osservati durante la manipolazione fenolo e cloroformio in quanto questi possono essere cancerogeni e corrosivo. Nelle nostre mani i geni sovraregolati da altri DNA sintetici (come il poli commerciali (dA: DT)) sono diversi da quelli sovraregolata da ISD concatemerized. Tuttavia, altri non hanno trovato tali differenze 10, che possono riflettere differenze tra i tipi di cellule in fase di analisi. Nonostante tali conflitti, la DSI concatemerized è molto più economico di generare rispetto ai poli di acquisto (dA: dT) da una fonte commerciale e consente una maggiore flessibilità attraverso la scelta di sequenza e modifiche.

Un aspetto di rilevamento del DNA che è sotto-studiato è la risposta alla stimolazione in vivo. Abbiamo dimostrato che questo protocollo può essere utilizzato per generare il DNA adatto per esperimenti in vivo 7. Il prodotto dsDNA è pura e di concentrazione abbastanza elevata da permettere l'iniezione in topi e successiva misurazione dei processi innati di segnalazione del sistema immunitario. Nel protocollo qui descritto, è necessario prestare attenzione al fine di garantire l'acqua utilizzata per dissolvere il pellet di DNA finale è endotossine, RNasi e DNasi gratuito. L'iniezione di DNA libero o DNAcomplessi lipidici sono risultati in una risposta interferone come previsto dei processi di rilevamento del DNA e, come tale, il DNA concatemerized possono essere usate per sondare diversi aspetti di DNA rilevamento in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Gli autori non hanno riconoscimenti.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
La stimolazione dei citoplasmatici DNA Sensing Pathways<em&gt; In Vitro</em&gt; E<em&gt; In Vivo</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter