Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Стимуляция цитоплазматической ДНК зондирования Пути doi: 10.3791/51593 Published: September 18, 2014

Summary

Целью протокола является использование оптимальные способы стимулирования цитоплазматические пути зондирования ДНК в клетках и в естественных условиях. Это достигается за счет улучшения поколение долгого, двухцепочечной ДНК во тупым концом перевязки. Клетки или мышей затем трансфицируют с использованием реагента для трансфекции липидов.

Abstract

Для того чтобы эффективно стимулировать врожденную иммунную реакцию, ДНК должна быть достаточной длины и чистоты. Мы представляем метод, где двухцепочечной ДНК (дц), который имеет все необходимые характеристики, чтобы стимулировать цитоплазматический ДНК пути зондирования могут быть сгенерированы дешево и с легкостью. К concatemerization коротких синтетических олигонуклеотидов, которые не имеют (CpG мотивы), дцДНК могут быть получены, чтобы иметь достаточную длину, чтобы активировать цитозольного зондирования ДНК пути. Этот протокол включает в себя тупым концом лигирование олигонуклеотидов в присутствии полиэтиленгликоля (ПЭГ), который обеспечивает среду для эффективного лигирования произойти. В concatemers дцДНК могут быть использованы, следующие очистки экстракцией фенолом / хлороформом, чтобы имитировать врожденного иммунного ответа в пробирке с помощью стандартных протоколов трансфекции. Эта ДНК может быть также использован для стимуляции врожденного иммунитета в естественных условиях внутрикожной инъекцией в ушной раковины мыши, например. Постандартизации процесса concatemerization и последующие протоколы стимуляции, надежным и воспроизводимым активации иммунной системы могут быть получены.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ДНК является жизненно важным компонентом всех организмов и клеток, которые эукариоты держать в определенных отсеков. Одна из функций иммунной системы, чтобы определить, когда такое компартментализация ломается или когда инородный материал вводится в организм через нарушение физических, внешних барьеров. В человеческом организме существует целый ряд белков, которые существуют, чтобы помочь ухудшить небольших количеств ДНК, которые могут избежать правильный дробления; ДНКазы I, II и III, сломать ДНК в плазме, эндосомы и цитозоле, соответственно. Тем не менее, было показано, что мыши, лишенные ДНКазу II умирает от тяжелой анемии, вызванной чрезмерным продукции интерферонов 1, предполагая, что врожденная иммунная система реагирует на экстра-ядерная ДНК. Этот ответ имеет место даже у мышей, которые полностью дефицит платной, как мощности передачи сигнала рецептором. Многочисленные исследования показали, что в настоящее время стимулятор генов интерферона (жало) 2 и БАК-связывания киназы 1 (ТБК1) 3 участвуют в обнаружении ДНК в цитоплазму и что этот сигнальный путь включает интерферон регуляторного фактора (МАФ) -3 4. Последующее IRF3-зависимой транскрипции цитокина, хемокина, и генов интерферона характерна для врожденного иммунного ответа к любой патогена или опасности, связанной молекулярной картины (ПАМП или влажные) 5.

Желание изучать внутриклеточные пути нуклеиновые кислоты зондирования привело к требованию, чтобы разработать надежные и воспроизводимые способы стимулирования клеток путем введения ДНК или РНК в клетки без активации другие врожденные иммунные ответы. Один из способов, с помощью которых жало / TBK1 / IRF3 путь может быть стимулировано путем использование катионных липидов реагентов трансфекции для доставки нуклеиновой кислоты в цитоплазму, где он может получить доступ с помощью датчиков, таких как ДНК, ДНК-ПК, IFI16, и CGAS 6-8.

Характеристики ДНК, которая в настоящее время поняты, чтобы позволить эффАктивация циент цитоплазматической врожденного иммунного ответа без стимуляции других путей являются его длина, масса, чистота, и отсутствие CpG мотивы 4,7,9. Синтетические олигонуклеотиды хорошо подходит для цели получения врожденной иммунной реакции, поскольку они позволяют последовательность ДНК, чтобы быть оптимизированы и получают в виде чистых химических соединений. 45 пар оснований иммуно-стимулирующий ДНК (ИСД) последовательность была определена Стетсоном и соавт. 4 как подходит, CpG-последовательности, свободной для этой цели. Эта последовательность двухцепочечной ДНК является в противном случае случайный и не имеет особенностей вне его отсутствия CpG мотивов. Мы обнаружили, что по concatemerizing ИСД олигонуклеотида в значительно более нитей увеличивает величину стимуляции 7. Генерация concatemerized ИСД Поэтому полезно для стимулирования цитоплазматический врожденный иммунный ответ. Здесь мы представляем протоколы за подготовку этого реагента и как он может быть использован для активации зондирования ДНК путь впробирке, а также в естественных условиях.

ПРИМЕЧАНИЕ: Все исследования на животных проводятся по утвержденным институциональных протоколов и руководств по уходу за животными.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1 Concatemerization

  1. Ресуспендируйте праймеры Fw и Rv (см таблицу материалов для последовательностей праймеров) до концентрации 10 мкг / мкл в биологически очищенной H 2 O. Тогда, смешайте 5 мкл Fw и 5 мкл Rv грунтовки в 1,5 мл микроцентрифужных трубки.
  2. Отжиг смесь праймер путем нагрева до нужной температуры отжига (75 ° С в течение праймеров, описанных здесь) в течение 15 мин. Оставьте на скамейке, чтобы остыть при комнатной температуре (RT). Подготовьте 60% PEG8000 течение этого инкубации путем растворения в DDh 2 O.
  3. Добавить 50 мкл 60% PEG8000 (для достижения конечной концентрации 30%), 10 мкл 10Х полинуклеотидкиназы (ПНК) буфера, 27 мкл H 2 O, и 3 мкл PNK к смеси грунтовки. Инкубируют при 37 ° С в течение 2 часов.
  4. Охладить при комнатной температуре и добавить 11 мкл ДНК-лигазы буфера. Затем добавляют 3 U из ДНК-лигазы и инкубируют при 37 ° С в течение ночи.

2 ДНК Очисткаи анализ

  1. Добавить 300 мкл H 2 O увеличить объем лигирования смеси. Примечание: производится в вытяжном шкафу в результате токсичности фенола: хлороформа паров.
  2. Добавить 1 объем (400 мкл) фенола: хлороформа и перемешать энергичным встряхиванием.
  3. Центрифуга на максимальной скорости в течение 1 мин в настольной микроцентрифуге. Водные слои и растворитель будет отделить с водным слоем на верхней и белого слоя осажденного белка между двумя слоями.
  4. Передача верхний слой в новую пробирку с помощью тщательного пипетки (во избежание передачи посередине, белый слой)
  5. Повторите этапы 2.2 и 2.3, по крайней мере в два раза или до нет Осажденный белок после центрифугирования.
  6. Добавить 1 объем (400 мкл) хлороформа и повторите шаги 2.3-2.4.
  7. Добавить 2 тома (800 мкл) 100% prechilled этанола и инкубировать при температуре -20 ° С в течение не менее 1 часа или на ночь. ПРИМЕЧАНИЕ: этот шаг осаждает concatemers ДНК.
  8. Спин вниз на максимальной скорости и аспирации супермаркеrnatant. Вымойте раз, добавляя 1 мл 70% этанола и дайте высохнуть на воздухе в вытяжном шкафу.
  9. Ресуспендируют ДНК в 50 мкл эндотоксина свободной DDH 2 O. Примечание: Использование эндотоксинов реагентов имеет решающее значение для формирования ДНК специфических врожденной иммунной реакции в клетках и в естественных условиях.
  10. Удаление 2 мкл аликвоты concatemerized ДНК в чистую пробирку и добавить 1 мл геля ДНК загрузочного буфера.
  11. Растворите 1% агарозы в буфере ТАЕ при нагревании на полной мощности в микроволновой печи в течение 2 минут (или время, которое подходит к власти печи и объема).
  12. Налейте гель в литейной машины, добавить 4 мкл флуоресцентного красителя хелатирующего ДНК, вставить гребень, и оставить при комнатной температуре в течение примерно 20 мин для гель для установки.
  13. После установки, снимите гребень и место гель в электрофореза бак, содержащий TAE буфер. Нагрузка 3 мкл образца ДНК или размера маркеров в скважины.
  14. Запустите гель-электрофореза в течение 30-40 минут при температуре 90 V с постоянным током. Visualiге ДНК в ультрафиолетовом свете наблюдать concatemerization (рисунок 1А).
  15. Измерение концентрации ДНК в остальной части образца по УФ-поглощению спектроскопии. Бланк спектрометр с той же DDh 2 O, который был использован ресуспендировать ДНК и измерить спектр поглощения от 200-300 нм. ПРИМЕЧАНИЕ: концентрация ДНК можно рассчитать, используя закон Ламберта-, = е * с * л, где А поглощение, е коэффициент поглощения, и л расстояние пути света. Для измерения концентраций ДНК оптическую плотность при 260 нм должно быть измерено и коэффициента экстинкции 0,027 (мкг / мл) -1 см -1, используемый. Расстояние пробега света, L, будет варьироваться в зависимости от спектрофотометра. В то время как измерения концентрации, принять к сведению соотношении 260/280 нм поглощения как показатель чистоты ДНК; значение этого соотношения выше 2,00 рекомендуется.

3 Трансфекцию дцДНК Concatemers В VIтро

  1. Семенной клеток в культуре ткани блюдо или тарелку, чтобы быть 70% сливной во время стимуляции.
  2. Вычислить массу ДНК, необходимую для стимуляции клеток с использованием конечной концентрации 1-10 мкг / мл. Требуемое масса ДНК будут отмечены как X ниже. Например, если стимуляции клеток в одном лунку 6-луночного планшета с 2 мл среды при концентрации ДНК 5 мкг / мл, затем массой 2 * 5 = 10 мкг ДНК требуется.
  3. Добавить 50 * X мкл бессывороточной среде в подходящих размеров стерильную пробирку. Пипетка тщательно в центр среды, не прикасаясь к стороне трубки, 2 * X мкл катионного липида реагента для трансфекции и оставьте на 5 минут.
  4. Добавить X мкг ДНК в кратко трубки и вихревой. Оставьте при комнатной температуре в течение по крайней мере 20 мин. Для трансфекции в пробирке добавить эту смесь непосредственно к клеткам, чтобы стимулировать цитоплазматические пути зондирования ДНК.

4 Трансфекцию днДНК Concatemers Iн Vivo

  1. Подготовьте смесь для трансфекции, как описано в 3,1-3,5 использованием 1 мкг ДНК, 2 мкл липидного реагента для трансфекции, и 18 мкл сыворотки среду без за уха мыши, чтобы стимулировать. Подготовьте стерильную 20 мкл Hamilton шприц, колпачок со стерильным 30 G иглы, и загрузить с трансфекции ДНК смеси.
  2. Обезболить в C57BL / 6 мышь, используя 1-2% изофлуран. Подтвердите анестезии потерей движения и постоянной скоростью дыхания и с помощью теста рефлекторной пинч при необходимости. Монитор глаза животного во время наркоза и использовать мазь, как требуется, чтобы избежать чрезмерной сухости.
  3. Использование стерильных, придать с осторожностью в ушной раковины 10 мкл трансфекции смеси так, чтобы один «пузырь» из жидкости образуется в между кожных слоев уха. Примечание: С помощью резиновой наперсток на палец или указательный палец, растянуть ухо над ним, и ввести под острым углом, чтобы обеспечить игла проникает только первый слой кожи ушной раковины.
  4. Reinполагается вводить мышь обратно в клетку и регулярно контролировать после обезболивающий восстановление. Используйте нагревательную лампу, чтобы избежать чрезмерного охлаждения наркотизированных мышей. Не оставляйте без присмотра мышей, пока они не обрели достаточную сознание поддерживать грудины лежачее положение.
  5. Флэш заморозить весь ушной раковины в микроцентрифужных трубки путем погружения в жидком азоте в течение 2 мин.

5 Обработка ДНК стимулированных образцов и анализа количественной ПЦР (КПЦР)

  1. От клеточной культуре: аспирации среды с помощью пипетки и выбросить отходы.
  2. Добавить 1 мл стерильного PBS. Повторите 5,1 и 5,2 раза и перейдите к шагу 5.3
  3. От уха ткани: измельчить ткань под жидким азотом с использованием стерильных керамические ступки и пестика, передать землю ткани микроцентрифужных трубки с помощью стерильного шпателя, и перейдите к шагу 5,4
  4. Добавить 350 мкл буфера для лизиса и заполните коммерческий РНК протокола набора для экстракции. Elute РНК из экстракционной очистки комплектеколонка в 40 мкл DDH 2 O. Примечание: В комплект промышленная добыча РНК (см материалы / стол оборудование) работает очень хорошо; другие методы были протестированы с нерегулярности результатов.
  5. Количественная РНК УФ-спектроскопии, как описано для ДНК выше (в разделе 2.13). Примечание: коэффициент экстинкции РНК составляет 0,025 (мкг / мл) -1 см -1.
  6. Добавить в стерильную ПЦР трубки 1 мкл олиго (дТ) грунтовки, 1 мкл 10 мМ дНТФ смешать, и 250 мкг РНК. Макияж громкости 11 мкл стерильной DDH 2 O.
  7. Инкубировать в течение 5 мин при 65 ° С. Затем добавить 4 мкл первой цепи буфера, 1 мкл 0,1 М дитиотреитол, 0,25 мкл обратной транскриптазы и 1,75 мкл DDH 2 O в трубке. Инкубируют при 50 ° С в течение 1 ч, затем 72 ° С в течение 15 мин. При желании, разбавить кДНК продукт 1: 5, используя DDh 2 О.
  8. Для количественной ПЦР использование 2 мкл кДНК, 2 мкл DDH 2 O, 5 мкл КПЦР мастер микс, и 1мкл каждого из 10 мкМ прямого и обратного праймеров для амплификации запасы ген (ы) выбора. Соединение в 96-луночный планшет с и анализировать с помощью количественной ПЦР машины (фиг.1В и 1C).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Приведенные ниже результаты показывают, что concatemerized ДНК могут быть получены с относительной легкостью и способен стимулировать надежную врожденной иммунной реакции в клетках, и у мышей. При использовании PEG8000, это хорошо видно, что длина ДНК генерируется значительно больше и в равной степени способны индуцировать транскрипцию CXCL10. Как видно с помощью анализа на агарозном геле, стандарт concatemerization имеет длину ДНК до 800 пар оснований (п.о.), в то время как для образца с PEG8000, длина нити ДНК включает свыше 10000 п.н. (фиг.1А). Трансфекция этих ДНК в мышиных эмбриональных фибробластов (MEFs) или мышей индуцирует транскрипцию надежную цитокинов и хемокинов, которые могут быть измерены с помощью количественной ПЦР с указанием стимуляции иммунной ДНК чувствительного механизма (фиг.1В и 1С).

объявление / 51593 / 51593fig1highres.jpg "/>
Рисунок 1. Представительства данные, указывающие на производство concatemerized ISD ДНК (conDNA) и стимуляции фибробластов и мышей. (A) Образец concatemerized ДНК производится с или без PEG8000 анализируют с помощью электрофореза в агарозном геле. (B) MEFs стимулировали различными ДНК в количестве 10 мкг / мл и уровни CXCL10 и IL-6 мРНК измеряли с помощью количественной ПЦР 6 ч позже. (С) Мышам вводили в ухо перьев с conDNA и уровней CXCL10 и IL-6 мРНК, измеренной с помощью количественной ПЦР 12 ч позже. Данные показаны в виде кратного увеличения относительно уровня HPRT (RQ) и ошибками являются +/- SEM (п = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Протоколы, описанные здесь, используются для создания двухцепочечной ДНК, чтобы стимулировать цитозольного врожденной иммунной реакции с воспроизводимые результаты в широком диапазоне типов клеток и в естественных условиях. Так как основной реагент субстрат используется синтетический олигонуклеотид, существует гибкость в этой системе для использования альтернативных последовательностей ДНК или химические модификации. Это возможно, например, для замены прямой цепи олигонуклеотида, описанные в данном протоколе с одним, который содержит флуоресцентную метку или биотин фрагмент отслеживать локализацию или оценки взаимодействия с другими биомолекул.

Одним из основных преимуществ concatemerization ДНК является производство длинных нитей двухцепочечной ДНК таким образом, что последовательность можно контролировать. Существует одно ограничение здесь, который является то, что длина ДНК не может быть точно контролироваться таким образом, продукт этой реакции всегда смесь ДНК различной длины (по аналогии с коммерческой РНК аналогового поли (I: C)). Еще одно преимущество этого метода в том, что она позволяет производство больших массовых количествах иммуно-стимулирующий ДНК (до мг суммы). Стадию concatemerization могут быть легко расширены в случае необходимости, хотя следует отметить, что последующие стадии очистки, то должны быть проведены в аликвот шкале, описанной в протоколе.

По сравнению с другими методами concatemerizing ДНК, главным дополнением является использование PEG8000 к лигирования смеси для повышения эффективности лигирования. Следует отметить, что PEG8000 может быть трудно растворить, чтобы сделать 60% (вес / об) маточного, но может быть и осторожно встряхивали нагревали, чтобы помочь солюбилизации. Перевязки можно оставить для инкубации в течение более длительных периодов времени, чем указано, но это, кажется, не влияет длина ДНК генерируется. Некоторые потребности в уходе также необходимо соблюдать при обращении фенол и хлороформ, поскольку они могут быть канцерогенными и коррозию. В наших руках гены активируется другими синтетическими ДНК (например, коммерческой поли (дА: DT)) отличаются от тех, активируется по concatemerized ИСД. Тем не менее, другие не нашли такие различия 10, которые могут отражать различия между типами клеток анализируются. Несмотря на такие конфликты, concatemerized ISD значительно дешевле для генерации по сравнению с покупкой поли (DA: DT) из коммерческого источника и обеспечивает большую гибкость через выборе последовательности и модификаций.

Одним из аспектов зондирования ДНК, которая находится под изученный является ответом в естественных условиях к стимуляции. Мы показали, что этот протокол может быть использован для создания ДНК, подходящую для экспериментов в естественных условиях 7. Продукт дц чисто и достаточно высокой концентрации, чтобы инъекцию мышам и последующее измерение врожденных процессов иммунной сигнализации. В методике, описанной здесь, необходимо позаботиться, чтобы обеспечить воду, используемую для растворения конечный осадок ДНК эндотоксина, РНКазы, и ДНКазы. Инъекция свободной ДНК или ДНК-липидных комплексов приводит к реакции интерферона, как и ожидалось процессов зондирования ДНК и, таким образом, concatemerized ДНК может быть использована, чтобы исследовать различные аспекты ДНК зондирования в естественных условиях.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Авторы не имеют подтверждения.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
Стимуляция цитоплазматической ДНК зондирования Пути<em&gt; In Vitro</em&gt; И<em&gt; В Vivo</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter