Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Sitoplazmik DNA Algılama Pathways uyarılması doi: 10.3791/51593 Published: September 18, 2014

Summary

Protokolün amacı hücrelerin in vivo ve in sitoplazmik DNA algılama yolları uyarılması için uygun yöntemler kullanılmasıdır. Bu uç ligasyonu içinde uzun bir çift şeritli DNA oluşumunu geliştirerek elde edilir. Hücreler daha sonra ya da farenin bir lipit transfeksiyon ayıracı kullanılarak transfekte edilir.

Abstract

Etkili bir doğuştan gelen bağışıklık tepkisini uyarmak için, DNA, yeterli uzunluk ve saflıkta olmalıdır. Biz, gerekli özelliklere sahip çift sarmallı DNA (dsDNA) algılama yolları ucuz ve kolaylıkla oluşturulabilir sitoplazmik DNA teşvik etmek için bir yöntem sunulmaktadır. Kısa sentetik oligonükleotidlerin (CpG motifleri eksik olan) en concatemerization ile, dsDNA sitosolik DNA algılama yolunu aktive etmek için yeterli bir uzunluğa sahip olması elde edilebilir. Bu protokol, etkili bir ligasyon meydana gelmesi için bir ortam sağlar polietilen glikol varlığında (PEG) içinde oligonükleotidlerin kör uç ligasyonu içerir. DsDNA karakterlerini, standart transfeksiyon protokolleri ile, in vitro olarak doğuştan gelen bağışıklık tepkisini için, fenol / kloroform ekstraksiyonu ile saflaştırma işleminden sonra, kullanılabilir. Bu DNA, aynı zamanda, örneğin, bir fare kulak kepçesine intradermal enjeksiyon yolu ile, in vivo doğal bağışıklığı uyarmak için kullanılabilir. Tarafındanconcatemerization işlemi ve daha sonraki stimülasyon protokolleri standartlaştırılması, doğuştan gelen bağışıklık sistemi, güvenilir ve yeniden üretilebilir bir aktivasyona üretilebilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

DNA ökaryotlarda özel bölmelere tutmak tüm organizmalar ve hücrelerin, önemli bir bileşenidir. Bu bölmelere ayırır ya da zaman doğuştan gelen bağışıklık sistemi arasında bir fonksiyonu, tanımlanması için bir yabancı madde, fiziksel, dış engelleri ihlal ile organizma içine sokulduğunda. İnsan vücudunda doğru compartmentalization kaçabilir DNA'nın küçük miktarlarda düşmesine yardımcı olmak için vardır proteinlerin bir dizi vardır; DNAz I, II ve III, plazma, endozoma ve sitozol içinde DNA break down. Ancak, doğuştan gelen bağışıklık sistemi ekstra nükleer DNA tepki verdiğini DNAz II eksik farenin düşündüren interferonlar 1 aşırı üretimine yol açtığı şiddetli anemi ölmektedir olduğu gösterilmiştir. Bu yanıt, daha da Toll-benzeri reseptör sinyal kapasitesi tamamen eksik olan farelerde görülür. Çeşitli çalışmalar şimdi interferon genleri (STING) 2 ve TANK-bağlayıcı kinaz 1 (TB olduğunu uyarıcı göstermiştirK1) 3 sitoplazmada DNA'nın saptanması ve bu sinyal yolunun, interferon ayarlayıcı faktör (IRF) -3 4 aktive katılmaktadırlar. Sitokin, kemokin, ve interferon gen daha sonra IRF3 bağımlı transkripsiyon, bir patojen ya da tehlike ilişkili moleküler model (PAMP ya da ıslak) 5 ya da doğuştan gelen bağışıklık tepkisinin özelliğidir.

Hücre içi nükleik asit algılama yollan araştırmak için arzu diğer doğal immün yanıtları aktive olmayan hücrelere DNA ya da RNA'nın hücrelere verilmesi ile teşvik etmek için sağlam ve tekrarlanabilir yöntemler geliştirmeye ihtiyacına yol açmıştır. / Sokması TBK1 / IRF3 yolu uyarılabilir hangi bir yöntemi, bu, DNA-PK, IFI16 ve CGAS 6-8 gibi DNA sensörleri tarafından erişilebilir sitoplazmaya nükleik asit sağlamak üzere katyonik lipit transfeksiyon reaktifleri kullanılarak gereğidir.

Şu anda eff izin vermek için anlaşılır DNA özellikleriDiğer yolların uyarımı olmaksızın sitoplazmik tabii immun cevabın aktivasyonu icient CpG uzunluğu, kütle, saflık ve eksik 4,7,9 motifleridir. Sentetik oligonükleotidlerin, optimize edilmiş DNA dizisi ve saf kimyasal türler gibi hazırlanabilir izin olarak doğuştan gelen bağışıklık tepkisi üretmek amacı için oldukça uygundurlar. Bir 45 baz çift immüno-uyarıcı DNA (ISD) dizisi, bu amaç için uygun bir CpG içermeyen sekans olarak şapkalı ve ark. 4 ile teşhis edildi. Bu dsDNA dizi aksi takdirde rastgele ve CpG motifleri onun eksikliği dışında hiçbir özel özellikleri vardır. Bu önemli ölçüde daha uzun şeritler haline ISD oligonükleotid concatemerizing tarafından uyarılması 7 büyüklüğünü arttırdığını bulduk. Concatemerized ISD Üretimi sitoplazmik bir doğuştan gelen bağışıklık tepkisinin uyarılması için faydalıdır. Burada bu reaktifinin hazırlanması için protokoller sunulmuş ve bu DNA algılama yolunu aktive etmek için kullanılabilir nasılin vivo ve in vitro.

NOT: Tüm hayvan çalışmaları onaylanan kurumsal protokollere ve hayvan bakımı kurallar altında yapılmaktadır.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Concatemerization

  1. Yeniden süspanse primerler Fw ve Rv'nin Moleküler Biyoloji H2O içinde 10 mg / ml 'lik bir konsantrasyon (primer diziler Malzemesi Tablo) Daha sonra, 5 ul Fw ve 1.5 ml mikrosantrifüj tüpü içinde Rv primerin 5 ul karıştırın.
  2. 15 dakika boyunca (burada tarif edilen primerler için 75 ° C) doğru tavlama sıcaklığına kadar ısıtılarak Tavlama primer karışımını içerir. Oda sıcaklığında (RT) soğumasını bankta bırakın. GKD 2 O. içinde çözülerek inkübasyon sırasında% 60 PEG8000 hazırlayın
  3. % 60 PEG8000, 50 ul 10x polinükleotid kinaz (PNK) tamponu, H2O 27 ul, ve primer karışımı PNK 3 ul 10 ul (% 30 arasında bir nihai konsantrasyon elde etmek için). 2 saat boyunca 37 ° C'de inkübe edilir.
  4. Oda sıcaklığında soğumaya ve DNA ligaz tamponu 11 ul ekleyin. Daha sonra DNA ligazı 3 U ekleyin ve gece boyunca 37 ° C'de inkübe edin.

2. DNA Saflaştırmave Analizi

  1. Ligasyon karışımı hacmini artırmak için H2O 300 ul ilave edin. Not: kloroform buharı: nedeniyle fenol toksisitesi bir davlumbaz devam edin.
  2. 1 hacim fenol (400 ul) ilave: kloroform ve kuvvetlice çalkalayarak karıştırın.
  3. Bir masa mikrosantrifüjde 1 dakika boyunca maksimum hızda santrifüj. Sulu ve solvent tabakalar üzerine, sulu tabaka ve bu iki katman arasında çöken protein, beyaz bir tabaka ile ayrılacaktır.
  4. Dikkatli pipetle tarafından yeni bir tüp üst tabakasını aktarın (orta aktarılmasını önlemek, beyaz tabaka)
  5. Tekrar 2.2 ve 2.3 en az iki kez ya da hiç Çöken protein santrifüj sonra oraya kadar adım.
  6. 1 hacim kloroform (400 ul) ekleyin ve tekrar 2,3-2,4 adımları.
  7. % 100 önceden soğutulmuş etanol 2 hacim (800 ul) ilave edilir ve en az 1 saat veya gece boyunca -20 ° C'de inkübe edin. NOT: Bu adımı DNA konkatemerler çöker.
  8. Maksimum hız ve aspire Süpermarket aşağı Spinrnatant. % 70 etanol içinde 1 ml ilave etmek suretiyle bir kez yıkayın ve duman başlığı içinde havayla kurumaya bırakın.
  9. Endotoksin ücretsiz GKD 2 O. 50 ul yeniden süspanse DNA Not: endotoksin içermeyen reaktiflerin kullanımı, hücreler ve in vivo olarak bir DNA spesifik olmayan bağışıklık tepkisini oluşturmak için çok önemlidir.
  10. Yeni bir tüp içine concatemerized DNA, 2 ul numuneyi çıkarın ve 1 ml DNA jel yükleme tamponu ilave edin.
  11. (Fırın ve ses gücü uygun olan ya da zaman) 2 dakika boyunca bir mikrodalga fırın içinde tam güçte ısıtılarak, TAE tamponu içindeki% 1 agaroz eritilir.
  12. , Döküm aparatı içine jel dökün floresan bir DNA kenetleme boya 4 ul, tarak eklemek ve jel ayarlamak için yaklaşık 20 dakika için oda sıcaklığında bırakın.
  13. Ayarlandıktan sonra, TAE tamponu içeren elektroforez tankına tarak ve yer jel kaldırmak. Yük kuyularına DNA örneği veya büyüklüğü belirteçlerin 3 ul.
  14. Sabit akım ile 90 V 30-40 dakika boyunca jel elektroforezi çalıştırın. Visualize ultra-viyole ışığı altında DNA concatemerization (Şekil 1A) gözlemlemek.
  15. UV emme spektroskopisi ile numunenin geri kalan DNA konsantrasyonu ölçümü. DNA tekrar süspansiyon ve 200-300 nm absorbans spektrumunun ölçülmesi için kullanılan aynı GKD 2 O ile Boş spektrometresi. NOT: Bir DNA konsantrasyonu absorbanstır Beer-Lambert yasasına A = E * C * l kullanılarak hesaplanabilir, ışık yolu olan mesafesini sönüm katsayısı E ve L 'dir. DNA ölçümü için ölçülmelidir 260 nm'de absorbansı ve 0.027 (ug / ml) bir sönüm katsayısı -1 cm-1 konsantrasyonlar kullanılır. Işık yolu mesafesi, I, spektrofotometre bağlı olarak değişecektir. Konsantrasyonunun ölçülmesi, DNA saflıkta bir göstergesi olarak 260/280 nm emilim oranı not edin; Yukarıda 2.00 Bu oran için bir değer tavsiye edilir.

Vi yılında dsDNA konkatemerlerin 3. Transfeksiyonutro

  1. , Bir doku kültür kabı veya plakasında Tohum hücreleri stimülasyonu sırasında% 70 birleşmiş olması.
  2. 1-10 ug / ml 'lik bir nihai konsantrasyon kullanılarak hücrelerin uyarılması için gerekli DNA kütlesi hesaplanır. DNA gerekli kütlesi aşağıdaki X olarak ifade edilecektir. Örneğin, daha sonra 5 mg / ml 'lik bir konsantrasyonda DNA DNA 2 x 5 = 10 ug bir kitle de ortam 2 ml 6 yuvalı bir plaka tek bir çukuruna hücre uyarıcı gerekiyorsa.
  3. Uygun boyutlu steril bir tüpe, serum barındırmayan ortam, 50 * X, ul ekleyin. Pipet dikkatle ortamının merkezine, borunun, 2 * X, katyonik lipit transfeksiyon reaktifi ul ve 5 dakika boyunca bırakın kenarını dokunmadan.
  4. Tüp ve vorteks kısaca DNA X ug ekleyin. En az 20 dakika boyunca oda sıcaklığında bekletin. In vitro transfeksiyon için, DNA, sitoplazmik algılama yollarını uyardığı için hücrelere doğrudan bu karışımı ekleyin.

DsDNA konkatemerler I 4. transfeksiyonuin vivo koşullarda

  1. 3,1-3,5 1 mg DNA, 2 ul lipit transfeksiyon ayıracı ve 18 ul serum fare kulağı başına ücretsiz orta uyarılacak kullanarak açıklandığı gibi transfeksiyon karışımı hazırlayın. Steril bir 30 G iğne ile steril bir 20 ul Hamilton şırıngası, başlık hazırlanmakta ve DNA transfeksiyon karışımı ile yükleyin.
  2. % 1-2 izofluran kullanılarak C57BL / 6 fare anestezisi. Hareket ve sürekli solunum hızının kaybı ve gerekirse tutam refleks testi ile anestezi onaylayın. Anestezi sırasında hayvanın gözleri izlemek ve aşırı kuruluğu önlemek için gerektiği gibi merhem kullanın.
  3. Steril teknik kullanılarak, kulak kepçesine dikkatle sıvının tek bir "kabarcık" kulak dermal tabakaları arasında oluşturulur, böylece transfeksiyon karışımı 10 ul enjekte edilir. Not: iğne kulak kepçesi sadece cildin ilk katmanını nüfuz sağlamak için dar bir açıda, başparmak veya parmağı üzerinde bir lastik yüksük kullanın üzerinde kulak streç, ve enjekte.
  4. Reinğa geri fare kafesin içine ve düzenli anestezi sonrası kurtarma izlemek. Anestezi uygulanmış farelerin aşırı soğumasını ortadan kaldıracak için bir ısıtma lambası kullanın. Onlar sternum yatma korumak için yeterli bilince kavuştular kadar sahipsiz fareler bırakmayın.
  5. Flaş 2 dakika süre ile sıvı azot içinde daldırarak bir mikrosantrifüj tüpü içinde, bütün kulak kulak kepçesi dondurma.

Kantitatif PCR ile DNA Uyanlı Örnekleri ve Analizi 5. İşleme (qPCR)

  1. Aspirat bir pipet ile orta ve atık atmak: Hücre kültüründen.
  2. Steril PBS içinde 1 ml ilave edilir. 5.1 ve 5.2 iki kez tekrarlayın ve 5.3 adıma geçin
  3. Kulak dokusundan: steril seramik havan ve tokmağı kullanarak sıvı azot altında dokuyu eziyet steril bir spatula kullanarak bir mikrosantrifüj tüp zemin doku transferi, ve 5.4 adıma geçin
  4. 350 ul lizis tamponu ekleyin ve ticari RNA ekstraksiyon kiti protokolü ile devam edin. Ekstraksiyon kiti saflaştırma elute RNA'nın40 ul GKD 2 O. sütun Not: Ticari RNA ekstraksiyon kiti çok iyi çalışıyor (malzeme / ekipman tabloya bakınız); diğer teknikler subpar sonuçlar ile test edilmiştir.
  5. (Bölüm 2.13), yukarıda tarif edildiği gibi DNA için UV spektroskopi ile RNA miktarı belirlenir. Not: RNA için yok olma katsayısı 0.025 (ug / ml) 1 cm -1.
  6. Oligo (dT) primeri steril bir PCR tüpü 1 ul ekle 10 mM dNTP, 1 ul karıştırın ve 250 ug RNA. Steril GKD 2 O. ile 11 ul hacmi Makyaj
  7. 65 ° C sıcaklıkta 5 dakika boyunca inkübe edin. Daha sonra 4 ul içine First Strand Tampon, 1 ul 0.1 M ditiyotreitol eklemek, 0.25 ul tüp transkriptaz ve 1.75 ul GKD 2 O ters. 15 dakika boyunca 72 ° C, daha sonra 1 saat boyunca 50 ° C'de inkübe edilir. O. GKD 2 kullanılarak 5: İsteğe bağlı olarak, cDNA ürününü 1 sulandırmak
  8. Kantitatif PCR kullanımı 2 ul cDNA, 2 ul GKD 2 O, 5 ul qPCR usta karışımı ve 1 içinİleri 10 uM her ul ve seçim gen (ler) yükseltmek için primer stokları ters. 96 oyuklu bir plaka içerisinde karıştırın ve kantitatif PCR makinesi (Şekil 1B ve 1C) kullanarak analiz eder.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aşağıdaki sonuçlar concatemerized DNA, nispeten kolay bir şekilde üretilebilir ve hücrelerde ve farelerde güçlü bir doğal bağışıklık tepkisini uyarabilen edilebileceğini gösterir. PEG8000 kullanımı ile, açık bir şekilde oluşturulan DNA uzunluğu önemli ölçüde daha uzun ve CXCL10 kopyalanmasının indükleme yeteneğine eşit olduğu görülebilir. Agaroz jel analizi ile görüldüğü gibi, PEG8000 ile numune için, DNA uzunluğu 10000 bp (Şekil 1A) aşan sarmallar da dahildir ise, standart concatemerization, en fazla 800 baz çifti (bp) DNA bölgesinin uzunluğuna sahip. Fare embriyonik fibroblastlar (MEF'ler) ve farelere bu DNA'ların transfeksiyonu doğuştan gelen bağışıklık DNA, algılama makineler (Şekil 1B ve 1C) uyarılmasını gösteren qPCR ölçülebilir sitokinler ve kemokinlerin sağlam bir transkripsiyon neden olur.

reklam / 51593 / 51593fig1highres.jpg "/>
Fibroblastlar ve farelerin concatemerized ISD DNA (conDNA) üretimini ve stimülasyon gösteren Şekil 1. Örnek verileri (A). Concatemerized DNA numunesi ile ya da agaroz jel elektroforezi ile analiz PEG8000 olmadan ile üretilebilir. (B), MEF'ler mi 10 ug / çeşitli DNA'lar ile uyarıldı ve CXCL10 ve IL-6 mRNA seviyeleri, 6 saat sonra QPCR kullanılarak ölçüldü. (C) Fareler 12 saat sonra ölçülen qPCR conDNA ve CXCL10 düzeyleri ve IL-6 mRNA ile kulak memelerine harici olarak enjekte edilir. Veri HPRT (RQ) ve hata çubukları, düzeyine kat artış göreceli olarak gösterilmiştir olan +/- ± SEM (n = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Burada açıklanan protokoller hücre tiplerinin geniş bir yelpazede ve in vivo olarak yeniden üretilebilir sonuçlar sitosolik doğuştan gelen bağışıklık tepkisi ortaya çıkarmak için dsDNA oluşturmak için kullanılır. Ikinci ana tabaka reaktif bir sentetik oligonükleotid olduğu, alternatif bir DNA sekanslarını veya kimyasal modifikasyonlar için, bu sistemde bir esneklik elde edilir. Bu, örneğin, bir flüoresan etiket veya lokalizasyonunu etiket ya da diğer biyomoleküllerle etkileşiminin belirlenmesi için bir biyotin parçası ihtiva biri ile bu protokolde tarif edilen ileri telli oligonükleotit yerine mümkündür.

DNA, concatemerization en önemli avantajlarından biri de, sırası kontrol edilebilir bir şekilde dsDNA uzun şeritlerin üretimidir. C: Bu tepkimenin ürünü ticari RNA analog poli (l 'e benzer, farklı uzunluklardaki DNA (bir karışımının her zaman yani, DNA uzunluk tam izlenemez ki burada bir sınırlama yoktur)). Bu tekniğin bir başka avantajı, (miktarda mg kadar) immüno-uyarıcı DNA büyük kütle miktarlarının üretimini sağlamasıdır. Gerektiği gibi daha sonraki saflaştırma adımları ve protokol özetlenen ölçek alikolar içinde yapılması gerektiğini belirtmek gerekir, ancak concatemerization adım kolayca ölçeklendirilebilir.

DNA concatemerizing diğer yöntemler ile karşılaştırıldığında, ana ekleme bağlanma verimliliğini artırmak için ligasyon karışımı PEG8000 kullanılmasıdır. PEG8000, bir% 60 yapmak için (ağ / hac) stok çözünmesi zor olabilir, ancak hafifçe vortekslenir ve çözünürleştirme yardımcı olmak için ısıtılabilir unutmayın. Ligasyon belirtilmedikçe daha uzun bir süre boyunca kuluçkada bırakılır, ancak bu DNA uzunluğu üretilen etkiler görülmez. Bu kanserojen ve korozif olabilir gibi fenol ve kloroform tutarken Bazı bakım ihtiyaçları da dikkate alınmalıdır. Bizim ellerde genler dA (örneğin ticari poli gibi diğer sentetik DNA'lar (upregülasyon: DT)) concatemerized ISD upregülasyon farklıdır. Ancak, diğerleri hücre türleri arasındaki varyasyon analiz ediliyor yansıtıyor olabilir, bu tür farklılıkları 10, bulamadı. Bu çakışmaları rağmen, concatemerized ISD satın poli ile karşılaştırıldığında önemli ölçüde daha ucuz oluşturmak için: a ticari bir kaynaktan (dA dT) ve sıra seçimi ve değişiklikler ile daha fazla esneklik sağlar.

Altında incelenmiş olan DNA'yı algılamanın bir yönü uyarılmasından in vivo yanıttır. Bu protokol, in vivo deneyler için müsait DNA 7 üretmek için kullanılabileceğini göstermiştir. DsDNA Ürün farelere enjeksiyon ve doğuştan gelen bağışıklık sinyalizasyon işlemlerinin sonraki ölçümünü sağlamak için saf ve yeterince yüksek konsantrasyon olduğunu. Burada anlatılan protokolde, bakım endotoksin, RNaz ve DNaz serbest nihai DNA pelet çözmek için kullanılan su emin olmak için dikkat edilmelidir. Serbest DNA veya DNA enjeksiyonugibi, DNA algılama süreçlerin beklendiği gibi, bir interferon yanıt olarak lipid kompleksleri sonuçlar concatemerized ile DNA algılama in vivo çok yönlerini incelemek için kullanılabilir.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Yazarlar bildirimleri var.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
Sitoplazmik DNA Algılama Pathways uyarılması<em&gt; İn Vitro</em&gt; Ve<em&gt; In Vivo</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter