Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Cryosectioning Metode til mikrodissektion af murint tyktarmsslimhinde

doi: 10.3791/53112 Published: July 12, 2015

Introduction

Colon epitelforingen er en meget regenerativ væv, med bopæl stamceller genopfyldning vævet hver par dage 1. Denne proces med regenerering kræver opretholdelse af en proliferativ knoglemarven. Over tid, de nyligt fremstillede datterceller mister deres proliferative potentiale og migrere mod den luminale overflade af tarmen. Sammenfaldende med migration, progenitor celler differentierer til modne barriere-dannende enterocyterne eller mukøse producerende slimceller. Svigt af denne differentiering program menes at bidrage til kompromitteret epitelbarriere såsom observeres ved inflammatorisk tarmsygdom og tyktarmskræft 2,3.

Detaljeret undersøgelse af de ovennævnte processer vil kræve metoder til isolering af krypt-base og overfladen cellepopulationer. Der findes flere metoder, hver med unikke fordele og ulemper. Nuværende fremgangsmåder til isolering af intestinale epitelceller omfatter lmelating agenter og mekanisk dissociation, hvilket resulterer i isoleringen af hele krypter, epitelbaner eller enkelte celler, afhængig af forsøgsbetingelser 4,5. Disse er højt udbytte metoder, men er blevet rapporteret ændringer i intercellulære signalering under disse betingelser, som ikke repræsenterer oprindelige miljø 6,7. Laser capture mikrodissektion muliggør indsamling af rumlige særskilt materiale, men opnår lav molekylær udbytte 8,9. I humant colonvæv, er blevet udviklet serielle horisontale cryosectioning metoder 10. Imidlertid murine mucosale væv er uoverkommeligt små til direkte bevilling af denne teknik. Hos mennesker, intestinal crypt længder (den fjernt mellem krypten-base og overflade celler) i tyktarmen varierer mellem ~ 100-1.000 um 11. Hos mus, crypt længder er mellem ~ 50-300 um (se Figur 1A). Den lille størrelse af murine krypter udgør en udfordring for isolaaf disse to cellepopulationer ved anvendelse af eksisterende protokoller.

Vi beskriver nu en lav pris, højt udbytte fremgangsmåde til isolering af krypten-base og overflade epithelial cellepopulation i murine colonvæv. Væv høstet på denne måde kan derefter analyseres ved en række standard efterfølgende anvendelser, herunder immunfluorescensfarvning, RT-PCR (Real Time-polymerasekædereaktion) eller Western blotting.

Protocol

Eksperimenter anvendte C57BL / 6-mus mellem 10 og 12 uger gamle. Alle procedurer ved hjælp af dyr blev revideret og godkendt af Emory University Institutional Animal Care og brug Udvalg og blev udført i henhold til National Institutes of Health kriterier.

1. Eksperimentel opsætning

  1. Opsætning af Kryostat
    1. Ækvilibrer kryostat til -20 ° C, herunder mikrotom kniven og borepatroner (udvise ekstrem forsigtighed omkring bladet!).
    2. Fyld en tom kryoformen med oktober (Optimal Cutting Temperatur forbindelse) og tempereres til -20 ° C (~ 30 min). Fjern den frosne oktober fra formen og ordne det på borepatron med væske oktober Placér blokken / chuck i microtome arm og lade OLT at sætte i 10 min.
    3. Indstil kryostat til 10 um per sektion og barbere OLT blok, indtil det er fladt. Bakke mikrotomen arm væk fra kniven ved flere centimeter. På dette punkt ikke justere klingen eller borepatron til resten af ​​experprøv dig frem.
  2. Forbered barberblade: Forbered 2 barberblade pr prøve. Ved hjælp af en metal-fil, dull sharped kant af vinger. Næste, skal du fjerne aluminium flange med en pincet.
  3. Pre-chill en Pyrex fad eller en anden flad overflade på tøris.
  4. Forbered en dissektion skål med 10-15 dissektion ben. En 10 cm vævskulturskål 50% fyldt med silicium vil være tilstrækkeligt. Der tilsættes 5 ml Hanks-buffer ved stuetemperatur.

2. Dissektion af Distal colonvæv

  1. Placer mus i et forseglet kammer, og aflive mus ved isofluran inhalation og cervikal dislokation, derefter sprøjte 70% ethanol på abdomen og thorax 12.
  2. Lave et lille snit i maveskindet med en saks og derefter foretage et indsnit for at blotlægge det peritoneale hulrum. Lignende fremgangsmåder kan findes her 12 beskrevet.
  3. Skær tyktarmen ved anal randen og drille hinanden mesenterium indtil tyktarmen er gratis.
  4. Udskære en distal colonsegment mellem 0 og 6 cm fra anus. Her kryptdybde er ~ 150 um (se figur 1 B). Skar tyktarmen på langs med en saks, og fjern de fækale indhold.
  5. Pin væv til dissektion skål med slimhindeoverfladen opad. Strække væv under anvendelse dissektion benene på en silicium skål i Hanks buffer og lad hvile i 10 minutter ved stuetemperatur (figur 1C). Dette fjerner folder fra vævet og tillader musklen lag til at slappe af.

3. Monter Væv på Kryostat for Skæring

  1. Skub et barberblad under det ønskede udsnit af væv, og derefter hælde fra Hanks buffer. Tilføje en anden barberblad til toppen, hvilket gør en sandwich. Skær vævet segment og fjern benene. Overfør barberblad / væv sandwich til tøris. Tillade væv at fryse (5-10 min, figur 1D).
  2. Afhente barberkniv / vævet sandwich og lad det varme lidt ved at placere en finger på den øverste blade (mucosal opad. Dette orienterer vævet, således at de basale muskellag er sektioneret først.). Adskil sandwich og skære rundt om kanterne på vævssegment. Skær en vævssegment tilnærmelsesvis 0,5 cm x 1 cm. Kantområder har en tendens til at krølle, hvilket får serielle sektioner for at indeholde mange vævslag. Bemærk, at over-skæring er bedre end under-skæring, så fejle på siden af ​​forsigtighed.
  3. Tillade vævet at varme indtil isen på toppen af ​​vævet begynder at smelte. På dette punkt hurtigt og omhyggeligt trykker vævet ind i oktober blok i kryostaten.
  4. Tag klingen ved at placere en finger over prøven. Varmeoverførslen vil tillade dig at fjerne kniven uden at forstyrre vævet.
  5. Coat vævet med oktober og i ligevægt i 5 min. Skåret sektioner på 10 um (figur 1E, F). Efterse afsnittene indtil krypter ses. Placer sektioner i en 1,5 ml rør eller på dias.
  6. Til analyse af mRNA eller protein, sted than prøver i rør med 5 krypt-base, 5 overgangsordning, og 5 overflade sektioner pr rør. Til RNA-samling tilsættes 1 ml kommerciel isolation reagens og inkuberes ved stuetemperatur i 10 min. Udføre RNA oprensning i overensstemmelse med producentens instruktioner. Bruge 5-10 ug totalt RNA til cDNA generation.
  7. For proteinoprensning, tilsættes 0,5 ml kold RIPA-lysepuffer (plus proteaseinhibitorer) per 5 sektioner. Sonikeres 3 gange ved et 70% cyklus, på is.
    1. Tilsæt prøver til SDS PAGE loading puffer (Laemmli-buffer) og inkuberes ved 100 ° C i 10 min. Underlagt prøver til SDS PAGE og overførsel, så blokerer i 5% mælk / PBS i 2 timer. Udføre western blot-analyse efterfulgt af inkubation med KLF4 antistoffer (1: 500) O / N ved 4 ° C.

Representative Results

Colon vævssnit blev forarbejdet til histologisk vurdering og H & E farvning 13. En traditionel tværsnitsbillede af slimhinden ses i figur 2A. Basale områder indeholder muscularis externa, der hovedsagelig er sammensat af de cirkulære muscularis. Procedure mod lumen, muscularis mucosa er indlysende støder op til krypt-basen epitelceller, overgangs- cellerne er i midt i væv, og endelig overflade cellepopulationer står tarmlumen. Den serielle sektionering her beskrevne fremgangsmåde opretholder en orientering, således at de langsgående og cirkulære muscularis støder først (figur 2B) efterfulgt af muscularis mucosa (figur 2C). Bemærk forekomsten af ​​ikke-muskelceller interstitielle celler i øverste venstre hjørne af billedet. For beskrev den nedstrøms analyse nedenfor, muskel sektioner kasseres. De efterfølgende afsnit indeholder epitelceller og interstitielle væv (lamina propria), Begyndende med de krypt-base-celler (figur 2D). Bemærk fraværet af en central lumen i de fleste af krypter, som synes mørkere på grund af de tæt pakkede kerner. Disse lag indeholder den proliferative rum. Overgangsbestemmelserne celler vises som tæt pakket kirtler med fremtrædende centrale lumen (Figur 2E). Endelig overflade cellepopulationer har en uregelmæssig struktur, med områder af epitel monolag set en face (figur 2F).

Serielle snit som beskrevet ovenfor, kan også behandles med henblik immunfluorescens mærkning og konfokal mikroskopi (som beskrevet her 14). Figur 2G viser isolerede krypter faste og permeabiliserede i 100% methanol og efterfølgende farvet for kerner (blå) og celle-celle-junction protein zonula occludens 1 (ZO-1, grøn). I den traditionelle sektionering orientering, kan krypt og overflade celle ses samtidigt (figur 2G (Figur 2G). Udvidet ZO-1 plet ses i overfladen cellepopulationer (Figur 2I og J).

Adskillige differentieringsfaktorer vides at blive udtrykt i en Spatiotemporal måde langs krypten-til-overflade akse. Dette omfatter transkriptionsfaktoren Kruppel-lignende faktor 4 (KLF4), som vides at være beriget i overfladen cellepopulationer. Ved hjælp af traditionelle sektionsopdelingen metoder er KLF4 findes i kerner af lumen står overflade cellepopulationer (figur 2K). Vi spekulerede derfor, at KLF4 mRNA ville blive overvejende udtrykt i overfladen cellepopulationer. For at teste dette, blev serielle snit indsamlet og grupperet i overfladen, overgangsbestemmelser og krypt-base prøver. Subsequently blev RNA høstet ved anvendelse af standard Trizol ekstraktion, med en yderligere oprensning ved RNeasy-søjle og DNAse behandling. RNA blev opsamlet fra 5 pooled konsekutive sektioner, hvilket gav mellem 5-10 ug totalt RNA pr prøve. Disse prøver blev derefter underkastet semi-kvantitativ realtids-PCR for både KLF4 og en reference-gen, TATA-boks-bindende protein 1 (TBP-1) (figur 2L) 14. Som vist i figur 2L, efter normalisering til TBP-1 blev overflade celler sig at udtrykke op til 8 gange den KLF4 mRNA, der er udtrykt i kryptceller. Tilsvarende blev KLF4 proteinniveauerne fundet at udvise rumlig regulering langs krypten-overflade akse. Serielle snit blev kombineret som beskrevet ovenfor og derefter inkuberet i lysepuffer i 20 minutter ved 4 ° C. Dette gav mellem 200-250 ug protein per prøve. Prøver blev derefter underkastet analyse ved SDS-PAGE (figur 2M) 15. Som vist i figur 2 M, KLF4 protein niveauer er dramatisk højere i overfladen cellepopulationer. Ovenstående resultater viser evne denne protokol til at isolere store mængder af overfladevand og krypt epitelceller fra murine kolonmucosa.

Figur 1
Figur 1: (A) Skematisk viser murine colon mucosa og eksterne muskellag. Vores metode til formål at indsamle diskrete overflade celle- og krypt-base cellepopulationer ved seriel cryosectioning (10 um hver). De ydre muskellag kasseres. (B) Crypt højde varierer langs længden af tyktarmen (afstanden mellem krypt-base og overfladelag). Datapunkter angiver individuelle crypt målinger og symboler angiver biologiske replikater (n = 4). (C) Colon segmenter indsamles, gennemskæres, og fastgjort på en silicium dissekere fad. (D) en vævet segment ca. 3 cm fra anus presses mellem to barberblade og den frosne på tøris. (E) Tissue monteres derefter på en forud nivelleret oktober blok. (F) kryosnit fjernes og inspiceres visuelt.

Figur 2
Figur 2:. Repræsentative data (A) colonvæv farvet med Hematoxylin-Eosin i tværsnit, der viser de cirkulære muscularis (cm), muscularis mucosa (mm), krypt-base-celler, overgangs- celler og overflade celler. (B - C) colon muskellag. (D) Crypt-base-celler. Bemærk fraværet af en central lumen. (E) Overgangsbestemmelser celler. (F) Surface celler. (G) Immunofluorescens-farvning af isolerede colon krypter. ZO-1 (grøn) og kerner (blå) observeres i tværsnit. (HI) ZO-1 og nuklear farvning i overgangs- og overflade celler. (J) forstørret billede af ZO-1 farvning. (K) KLF4 (grøn) er beriget i overfladen cellepopulationer. (L) Real-time PCR vurdering af KLF4 mRNA niveauer mellem de tre kamre. (M) Western blot-analyse af KLF4 proteinniveauer i disse cellepopulationer.

Discussion

De molekylære mekanismer involveret i colon epitelcelleproliferation og differentiering er dårligt forstået. Dette omfatter huller i vores forståelse af den cellulære signalering miljø stamceller rum ved bunden af ​​tyktarmen epitel krypter. Der er også en stigende interesse for de processer, der ligger til grund enterocytterne differentiering. For eksempel øget forståelse af in vivo-differentiering er nødvendig som benchmark for undersøgelser med henblik på at producere in vitro primære tarm systemer 16.

Den ovennævnte fremgangsmåde indeholder flere trin, der kræver ekstra opmærksomhed. For det første at fjerne kanter omkring det frosne væv segment (som omtalt i afsnit 3.2) er påkrævet, da væv kanter krøller under dissektion og frysning. Manglende flytte disse kanter resultater er en blandet population af overflade- og krypt base-celler. Montering af væv på en pre-kølet, nivelleret oktober blok er også vigtigt. Thans protokol kan tilpasses til andre områder af den distale colon ved at ændre antallet af sektioner i hver pulje. For eksempel som vist i figur 1B, mukosal krypt længde varierer mellem 150-300 um. Derfor, når man studerer området mellem 4 cm-6 cm fra anus, antallet af sektioner skal øges fra 15 til 30. Vigtigt er denne protokol ikke foreslået til den proximale colon (7 cm-9 cm) på grund af folderne ( plicae obliquae), der strækker sig ind i hulrummet, hvilket gør det umuligt at adskille overflade- og krypt-base-celler ved seriel sektionering.

Serielle sektionsopdelingen teknikker er blevet anvendt til at undersøge crypt-base og overflade epiteliale cellepopulationer i mennesker. Men vores protokol tilføjer yderligere trin, der kræves på grund af den lille størrelse af murine væv. Vi foreslår, at ovennævnte protokol vil give mulighed for undersøgelse af krypten-base og overflade epitelcelle befolkning genetisk medgørlige mus-systemer. Faktisk puljede sektioner Yield protein af høj kvalitet og RNA egnet nedstrøms analyse. Fremtidige applikationer kunne omfatte studiet af cellens signalveje eller kromatin immunofældning. Imidlertid bør det bemærkes, at, ligesom flere af de alternative metoder beskrevet ovenfor, de resulterende afsnit indeholder en blanding af epitel- og interstitielle lamina propria-celler. Det konkluderes, at protokollen beskrevet her tilvejebringer en hurtig, højt udbytte metode til analyse af molekylære processer i rumligt adskilte regioner af det murine colon mucosa.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Cryosectioning Metode til mikrodissektion af murint tyktarmsslimhinde
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter