Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Metodo criosezionamento per Microdissezione di Murine colon mucosa

doi: 10.3791/53112 Published: July 12, 2015

Introduction

Il rivestimento epiteliale del colon è un tessuto altamente rigenerativa, con le cellule staminali residenti rifornire il tessuto ogni pochi giorni 1. Questo processo di rigenerazione richiede il mantenimento di un compartimento staminale proliferativa. Nel corso del tempo, le cellule figlie nuova produzione perdono il loro potenziale proliferativo e migrano verso la superficie luminale dell'intestino. In coincidenza con la migrazione, le cellule progenitrici differenziarsi in enterociti-barriera che formano mature o cellule caliciformi che producono muco. Fallimento di questo programma differenziazione è pensato per contribuire alla compromissione barriera epiteliale, come si osserva nella malattia infiammatoria intestinale e del colon 2,3.

Studio dettagliato dei processi di cui sopra richiede metodologie per isolare le popolazioni cripta-base e delle cellule di superficie. Esistono metodi multipli, ciascuno con vantaggi e svantaggi. Gli attuali metodi per l'isolamento delle cellule epiteliali intestinali includono chagenti elating e dissociazione meccanica, con conseguente isolamento di intere cripte, fogli epiteliali, o cellule singole, dipendenti condizioni sperimentali 4,5. Questi sono metodi ad alto rendimento, ma i cambiamenti nella segnalazione intercellulare sono stati riportati in queste condizioni, che non possono rappresentare l'ambiente nativo 6,7. Microdissezione laser consente la raccolta di materiale spaziale distinte, ma realizza bassa resa 8,9 molecolare. Nel tessuto del colon umano, metodi criosezionamento orizzontali di serie sono stati sviluppati 10. Tuttavia, mucose murini sono proibitivamente piccole per appropriazione diretta di questa tecnica. Negli esseri umani, le lunghezze cripta intestinale (la distanza tra la cripta-base e cellule di superficie), nel colon varia tra ~ 100-1.000 micron 11. Nei topi, le lunghezze cripta sono tra ~ 50-300 micron (vedi Figura 1A). Le piccole dimensioni delle cripte murine rappresenta una sfida per l'isolazione di queste due popolazioni cellulari che utilizzano protocolli esistenti.

Descriviamo ora un basso costo, il metodo ad alto rendimento per l'isolamento di cripta-base e la superficie popolazione di cellule epiteliali nel tessuto del colon murino. Tissue raccolti in questo modo può poi essere analizzato da un certo numero di applicazioni a valle standard, tra immunofluorescenza, RT-PCR (Real Time-Polymerase Chain Reaction) o western blotting.

Protocol

Esperimenti utilizzati topi C57BL / 6 tra 10 e 12 settimane di età. Tutte le procedure che utilizzano gli animali sono stati esaminati e approvati dall'Università Istituzionale Cura e Comitato uso degli animali Emory e sono state eseguite secondo National Institutes of Criteri sanitari.

1. Setup sperimentale

  1. Impostazione del criostato
    1. Equilibrare criostato a -20 ° C, tra cui la lama microtomo e mandrini (estrema cautela intorno alla lama!).
    2. Riempire un vuoto con cryomold ottobre (Ottimale composta Taglio temperatura) ed equilibrare a -20 ° C (~ 30 min). Rimuovere l'ottobre congelato dallo stampo e fissarlo sul mandrino con liquido ottobre Posizionare il blocco / mandrino nel braccio microtomo e consentire di Office per impostare per 10 minuti.
    3. Impostare il criostato a 10 micron per sezione e radersi il blocco ottobre fino a quando non è piatta. Eseguire il braccio microtomo lontano dalla lama di alcuni centimetri. A questo punto non regolare la lama o mandrino per il resto della experiment.
  2. Preparare le lamette da barba: Preparare 2 lamette per campione. Utilizzo di un file di metallo, opaco bordo sharped di lame. Quindi, rimuovere la flangia in alluminio con una pinza.
  3. Pre-raffreddare una pirofila o altra superficie piatta in ghiaccio secco.
  4. Preparare un piatto dissezione con 10-15 perni dissezione. A 10 centimetri piatto di coltura tissutale 50% pieno di silicio sarà sufficiente. Aggiungere 5 ml di tampone Hanks a temperatura ambiente.

2. dissezione distale colon Tissue

  1. Topi posto in una camera sigillata e Euthanize topi per inalazione isoflurano e dislocazione cervicale, quindi spruzzare il 70% di etanolo sul ventre e del torace 12.
  2. Fai una piccola incisione nella pelle dell'addome con le forbici e poi fare un'incisione per esporre la cavità peritoneale. Procedure simili si possono trovare qui 12 descritto.
  3. Tagliare l'intestino crasso al margine anale e prendere in giro a parte il mesentere fino a quando il colon è gratuito.
  4. Accise un colon distalesegmento tra 0 e 6 cm dalla ano. Qui, la profondità cripta ~ 150 micron (vedere Figura 1B). Taglio aperto il colon longitudinalmente con le forbici e rimuovere il contenuto fecale.
  5. Pin il tessuto al piatto dissezione con la superficie della mucosa rivolta verso l'alto. Allungare il tessuto con perni dissezione su un piatto di silicio in tampone Hanks e lasciare riposare per 10 minuti a temperatura ambiente (Figura 1C). Questo elimina pieghe dal tessuto e permette strati muscolari di rilassarsi.

3. Montare tessuto sulla Criostato per il sezionamento

  1. Infilare una lametta sotto la sezione desiderata del tessuto e quindi versare il tampone Hanks. Aggiungere un'altra lametta all'inizio, facendo un sandwich. Tagliare il segmento tessuti e rimuovere i perni. Trasferire il panino lametta / tessuto a ghiaccio secco. Lasciare che il tessuto di congelare (5-10 min, Figura 1D).
  2. Sollevare il rasoio / panino tessuto e lasciarlo riscaldare leggermente mettendo un dito sul bl superioreade (lato mucosale up. Questo orienta il tessuto in modo che gli strati muscolari basali sono sezionate prima.). Separare il sandwich e tagliare lungo i bordi del segmento tissue. Tagliare un segmento di tessuto di circa 0,5 x 1 cm. Aree di bordo hanno la tendenza ad arricciarsi, causando sezioni seriali contengono molti strati di tessuto. Si noti che l'eccesso di taglio è migliore di sotto-taglio, in modo sbagliare sul lato della cautela.
  3. Lasciare il tessuto riscaldare fino ghiaccio sulla parte superiore del tessuto inizia a fondere. A questo punto rapidamente e con attenzione premere il tessuto nel blocco OCT criostato.
  4. Rimuovere la lama inserendo un dito sul campione. Il trasferimento di calore permette di rimuovere la lama senza interrompere il tessuto.
  5. Cappotto il tessuto con ottobre e equilibrare per 5 minuti. Tagliare le sezioni a 10 micron (Figura 1E, F). Visivamente sezioni fino a quando le cripte sono visti. Luogo sezioni in un provette da 1,5 ml o su diapositive.
  6. Per l'analisi di mRNA e di proteine, luogo tegli campioni in tubi con 5 cripta-base, 5 di transizione, e 5 sezioni di superficie per provetta. Per la raccolta RNA aggiungere 1 ml di reagente commerciale isolamento e incubare a temperatura ambiente per 10 min. Eseguire la purificazione di RNA secondo le istruzioni del produttore. Utilizzare 5-10 mg di RNA totale per la generazione di cDNA.
  7. Per purificazione della proteina, aggiungere 0,5 ml di freddo RIPA Lysis Buffer (più inibitori della proteasi) per 5 sezioni. Sonicare 3 volte in un ciclo di 70%, su ghiaccio.
    1. Aggiungere esempi di SDS tampone di caricamento delle pagine (buffer Laemmli) e incubare a 100 ° C per 10 min. Campioni soggetti a SDS PAGE e trasferimento, poi bloccano in 5% di latte / PBS per 2 ore. Eseguire l'analisi Western Blot seguita da incubazione con anticorpi Klf4 (1: 500) O / N a 4 ° C.

Representative Results

Sezioni di tessuto del colon sono stati elaborati per la valutazione istologica e H & E colorazione 13. Una visione tradizionale sezione trasversale della mucosa è visto in Figura 2A. Aree basali contengono il externa muscolare, composta principalmente delle muscolare circolari. Procedendo verso il lume, la mucosa muscolare è evidente adiacente alle cellule epiteliali cripta-base, cellule transizionali sono al centro del tessuto, e, infine, popolazioni cellulari superficie faccia lume intestinale. Il metodo descritto qui sezionamento seriale mantiene un orientamento tale che le muscolare longitudinali e circolari sono incontrate, prima (Figura 2B), seguita dalla mucosa muscolare (Figura 2C). Si noti la comparsa di cellule interstiziali non muscolari in alto a sinistra dell'immagine. Per l'analisi valle descritto di seguito, le sezioni muscolari vengono scartati. Le sezioni successive contengono cellule epiteliali e tessuto interstiziale (lamina propria), A partire dalle cellule cripta-base (Figura 2D). Si noti l'assenza di un lume centrale nella maggior parte delle cripte, che appaiono più scuro a causa dei nuclei fitte. Questi strati contengono il vano proliferativa. Le cellule di transizione appaiono come accuratamente imballati ghiandole con lumen centrali importanti (Figura 2E). Infine, le popolazioni di cellule superficie hanno una struttura irregolare, con aree del monostrato epiteliale visto en face (Figura 2F).

Sezioni seriali descritti sopra possono anche essere trattati per l'etichettatura immunofluorescenza e microscopia confocale (come descritto qui 14). La figura 2G mostra cripte isolate fissi e permeabilizzate in 100% di metanolo e successivamente colorate per nuclei (blu) e la proteina giunzione cellula-cellula zonula occludere 1 (ZO-1, verde). Nel orientamento sezionamento tradizionale, cellule cripta e la superficie può essere visto contemporaneamente (Figura 2G (figura 2G). Avanzato ZO-1 macchia è visto in popolazioni cellulari di superficie (figura 2I e J).

Diversi fattori di differenziazione sono noti per essere espressi in modo spaziotemporale lungo l'asse cripta-superficie. Questo include il fattore di fattore di trascrizione Kruppel-like 4 (Klf4), che è noto per essere arricchito in popolazioni cellulari di superficie. Con i metodi tradizionali di sezionamento, Klf4 si trova nei nuclei di lume di fronte popolazioni cellulari di superficie (Figura 2K). Abbiamo quindi ipotizzato che Klf4 mRNA sarebbe espressa prevalentemente in popolazioni di cellule superficiali. Per verificare ciò, sezioni seriali sono stati raccolti e raggruppati in campioni di superficie, di transizione, e cripta-base. Subsequente, RNA è stato raccolto con l'estrazione di serie Trizol, con una purificazione supplementare RNeasy colonna e trattamento DNAsi. L'RNA è stato raccolto da 5 sezioni consecutive messe in comune, che diedero tra 5-10 mg di RNA totale per campione. Questi campioni sono stati poi sottoposti a semi-quantitativa real time PCR sia Klf4 e un gene di riferimento, TATA binding protein 1 scatola (TBP-1) (Figura 2L) 14. Come mostrato in Figura 2L, dopo la normalizzazione di TBP-1, cellule superficiali sono stati trovati per esprimere fino a 8 volte il Klf4 mRNA che è espresso nelle cellule cripta. Allo stesso modo, sono stati trovati livelli di proteina Klf4 esporre regolazione spaziale lungo l'asse cripta superficie. Sezioni seriali sono stati riuniti come descritto sopra e poi incubate in tampone di lisi per 20 min a 4 ° C. Questo ha prodotto tra 200-250 mg di proteine ​​per campione. I campioni sono stati poi sottoposti analisi mediante SDS-PAGE (Figura 2M) 15. Come mostrato nella Figura 2M, Klf4 plivelli rotein sono drammaticamente più alta in popolazioni di cellule di superficie. I risultati di cui sopra dimostrano la capacità di questo protocollo per isolare grandi quantità di superficie e le cellule epiteliali cripta della mucosa del colon murino.

Figura 1
Figura 1: (A) mostra schematica murine mucosa del colon e strati muscolari esterni. Il nostro metodo si propone di raccogliere cellulari di superficie e la cripta-base popolazioni cellulari discreti criosezionamento seriale (10 micron ciascuna). Gli strati muscolari esterni vengono scartati. Altezza (B) cripta varia lungo la lunghezza del colon (distanza interstrato cripta-base e la superficie). I punti dati indicano singole misurazioni cripta e simboli indicano repliche biologiche (n = 4). (C) segmenti Colon raccolti, Diviso in due parti, e appuntato su un piatto di silicio dissezione. (D) Un tessuto segment circa 3 cm dal ano si preme tra di lamette da barba e congelati in ghiaccio secco. (E) tessuto viene poi montato su un blocco Ottobre pre-livellato. (F) criosezioni vengono rimosse ed esame visivo.

Figura 2
Figura 2:. Dati rappresentativi (A) tessuto del colon colorate con ematossilina-eosina in sezione trasversale che mostra la muscolaris circolari (cm), la mucosa muscolare (mm), cellule cripta-base, cellule di transizione, e cellule superficiali. (B - C) strati muscolari del colon. (D) le cellule Cripta-base. Si noti l'assenza di un lume centrale. (E) le cellule di transizione. (F), le cellule di superficie. (G) Immunofluorescenza di isolati cripte del colon. ZO-1 (verde) e nuclei (blu) si osservano in sezione trasversale. (CIAO) ZO-1 e colorazione nucleare in cellule di transizione e di superficie. (J) vista ingrandita ZO-1 colorazione. (K) Klf4 (verde) si arricchisce in popolazioni di cellule di superficie. (L) Real-time PCR valutazione dei livelli di mRNA Klf4 tra i tre compartimenti. (M) Western blot dei livelli di proteine ​​Klf4 in queste popolazioni di cellule.

Discussion

I meccanismi molecolari coinvolti nella proliferazione delle cellule epiteliali del colon e la differenziazione sono poco conosciute. Questo include lacune nella nostra comprensione dell'ambiente segnalazione cellulare del compartimento di cellule staminali alla base delle cripte epiteliali del colon. Vi è anche un crescente interesse per i processi che stanno alla base di differenziazione enterociti. Ad esempio, ha aumentato la comprensione di differenziazione in vivo è necessaria come punto di riferimento per gli studi volti a produrre in vitro sistemi intestinali primarie 16.

La procedura di cui sopra contiene diversi passaggi che richiedono una particolare attenzione. In primo luogo, eliminando i bordi intorno al segmento tessuto congelato (come discusso nella sezione 3.2) è richiesto come i bordi di tessuto riccio durante la dissezione e il congelamento. La mancata spostare questi spigoli risultati è una popolazione mista di cellule superficiali e base cripta. Montaggio il tessuto su una, ottobre blocco livellati pre-raffreddata è anche essenziale. Tsuo protocollo può essere adattato ad altre zone del colon distale modificando il numero di sezioni in ciascun pool. Ad esempio, come mostrato nella Figura 1B, lunghezza cripta mucosa varia tra 150-300 micron. Pertanto, quando si studia la regione tra 4 CM-6 centimetri dall'ano, il numero di sezioni dovrebbe essere aumentato da 15 a 30. È importante sottolineare che questo protocollo non è suggerito per il colon prossimale (7 gli cm-9 cm) a causa di pieghe ( pliche obliquae) che si estendono nel lume rendendo impossibile superficie e la cripta-base celle separate di sezionamento seriale.

Tecniche di sezionamento seriali sono state usate per studiare cripta-base e la superficie popolazioni di cellule epiteliali nell'uomo. Tuttavia, il nostro protocollo aggiunge passaggi aggiuntivi richiesti a causa delle piccole dimensioni del tessuto murino. Proponiamo che il protocollo di cui sopra consentirà la ricerca di cripta-base e la popolazione di cellule epiteliali di superficie nei sistemi geneticamente trattabili mouse. In effetti, le sezioni pool Yield proteine ​​di alta qualità e RNA analisi valle adatto. Le applicazioni future potrebbero includere lo studio delle vie di segnalazione cellulare o immunoprecipitazione della cromatina. Tuttavia, va notato che, come molti dei metodi alternativi descritti sopra, le sezioni ottenute contengono una miscela di cellule lamina propria epiteliali e interstiziali. In conclusione, il protocollo qui descritto fornisce un rapido metodo del rendimento, alta per l'analisi dei processi molecolari in regioni spazialmente distinte della mucosa del colon murino.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Metodo criosezionamento per Microdissezione di Murine colon mucosa
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter