Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

الطريقة Cryosectioning لتسليخ مجهري الفئران القولون الغشاء المخاطي

doi: 10.3791/53112 Published: July 12, 2015

Introduction

بطانة القولون الظهارية هي الأنسجة التجدد للغاية، مع الخلايا الجذعية المقيمة تجديد الأنسجة كل بضعة أيام 1. هذه عملية تجديد تتطلب الحفاظ على التكاثري مقصورة الخلايا الجذعية. مع مرور الوقت، فإن الخلايا ابنة المنتجة حديثا تفقد إمكانية التكاثري، وتهاجر نحو السطح اللمعية من الأمعاء. تتزامن مع الهجرة، الخلايا الاصلية تفرق في المعوية لتشكيل حاجز ناضجة أو الخلايا المنتجة للكأس المخاطية. ويعتقد أن فشل هذا البرنامج التمايز للمساهمة في خطر حاجز الظهارية مثل ما لوحظ في مرض التهاب الأمعاء وسرطان القولون 2،3.

سوف دراسة مفصلة عن العمليات المذكورة أعلاه تتطلب منهجيات لعزل سرداب قاعدة والخلايا السطحية السكان. توجد أساليب متعددة، ولكل منها مزايا وعيوب فريدة من نوعها. الأساليب الحالية لعزل الخلايا الظهارية في الأمعاء تشمل الفصلوكلاء الإنتشاء والبراءة الميكانيكية، مما أدى إلى عزل الخبايا بأكملها، ورقة الظهارية، أو خلايا واحدة، تعتمد على الظروف التجريبية 4،5. هذه هي أساليب عالية الغلة، ولكن تم الإبلاغ عن التغييرات في إشارة بين الخلايا في ظل هذه الظروف التي قد لا تمثل البيئة المحلية 6،7. القبض على الليزر تسليخ مجهري يسمح لجمع المواد المكانية متميزة، ولكن يحقق الجزيئي المنخفض 8،9 الغلة. في أنسجة القولون الإنسان، مسلسل الطرق cryosectioning الأفقية وقد وضعت 10. ومع ذلك، والأنسجة المخاطية الفئران صغيرة باهظة للاعتماد المباشر لهذه التقنية. في البشر، وأطوال سرداب الأمعاء (والبعيدة بين سرداب قاعدة والخلايا السطحية) في القولون تتفاوت بين ~ 100-1،000 ميكرون 11. في الفئران، وأطوال سرداب ما بين 50-300 ميكرون ~ (انظر الشكل 1A). صغر حجم الخبايا الفئران تحديا لايزولانشوئها من هؤلاء السكان اثنين من خلية باستخدام بروتوكولات القائمة.

نحن الآن وصف منخفضة التكلفة، وطريقة العائد المرتفع لعزل سرداب قاعدة وسطح السكان الخلايا الظهارية في أنسجة القولون الفئران. الأنسجة التي تحصد في هذه الطريقة قد ثم يتم تحليلها من قبل عدد من التطبيقات المصب القياسية، بما في ذلك تلطيخ المناعي، RT-PCR (في الوقت الحقيقي، البلمرة المتسلسل) أو النشاف الغربي.

Protocol

تجارب استخدمت C57BL / 6 الفئران بين 10 و 12 أسبوعا من العمر. تم استعراض جميع الإجراءات باستخدام الحيوانات التي وافقت عليها لجنة جامعة إيموري المؤسسي رعاية الحيوان واستخدام وتم إجراء فقا لالمعاهد الوطنية للمعايير الصحية.

1. الإعداد التجريبي

  1. إعداد ناظم البرد
    1. تتوازن ناظم البرد إلى -20 ° C، بما في ذلك شفرة مشراح وخراطيش (ممارسة الحذر الشديد في جميع أنحاء شفرة!).
    2. ملء cryomold فارغ أكتوبر (الأمثل مركب قطع درجة الحرارة) وتتوازن إلى -20 ° C (~ 30 دقيقة). إزالة أكتوبر المجمدة من العفن وإصلاحه على لتشاك مع السائل أكتوبر وضع كتلة / تشوك في الذراع مشراح والسماح للأكتوبر لضبط لمدة 10 دقيقة.
    3. تعيين ناظم البرد إلى 10 ميكرون لكل قسم ويحلق كتلة أكتوبر حتى أنها مسطحة. دعم ذراع مشراح بعيدا عن شفرة من قبل عدة سنتيمترات. في هذه المرحلة لا ضبط شفرة أو ظرف للفترة المتبقية من والخبيرiment.
  2. إعداد شفرات الحلاقة: إعداد 2 شفرات الحلاقة في العينة. باستخدام ملف المعدنية، مملة حافة sharped من ريش. المقبل، وإزالة شفة الألومنيوم مع ملقط.
  3. قبل البرد طبق بيركس أو أي سطح مستو على الثلج الجاف.
  4. إعداد طبق تشريح مع 10-15 دبابيس تشريح. وهناك صحن 10 سم زراعة الأنسجة 50٪ مليئة السيليكون تكفي. إضافة 5 مل من العازلة هانكس في RT.

2. تشريح القاصي القولون الأنسجة

  1. مكان الفئران في غرفة مغلقة والموت ببطء الفئران عن طريق استنشاق الأيزوفلورين وخلع عنق الرحم، ثم رش 70٪ من الإيثانول على 12 البطن والصدر.
  2. إجراء شق صغير في جلد البطن مع مقص ومن ثم إجراء شق لكشف التجويف البريتوني. ويمكن الاطلاع على إجراءات مماثلة وصفها هنا 12.
  3. قطع الأمعاء الغليظة على حافة الشرج وندف بعيدا مساريق حتى القولون مجانا.
  4. استئصال القولون القاصيالجزء بين 0 و 6 سم من فتحة الشرج. هنا، وعمق سرداب هو ~ 150 ميكرون (انظر الشكل 1B). خفض فتح القولون باستخدام مقص طوليا وإزالة محتويات البراز.
  5. دبوس الأنسجة إلى الطبق تشريح مع سطح الغشاء المخاطي مواجهة. تمتد النسيج باستخدام دبابيس تشريح على طبق السيليكون في المخزن هانكس وترك الباقي لمدة 10 دقيقة في RT (الشكل 1C). هذا يزيل طيات من الأنسجة ويسمح للطبقات العضلات على الاسترخاء.

3. جبل الأنسجة على ناظم البرد لباجتزاء

  1. مرر شفرة حلاقة تحت القسم المطلوب من الأنسجة ومن ثم تخلصي من عازلة هانكس. إضافة شفرة حلاقة أخرى إلى الأعلى، مما يجعل شطيرة. قطع الجزء الأنسجة وإزالة المسامير. نقل شطيرة شفرة حلاقة / الأنسجة إلى الثلج الجاف. السماح للأنسجة لتجميد (5-10 دقيقة، 1D الشكل).
  2. التقاط الحلاقة / شطيرة الأنسجة والسماح لها دافئ قليلا من خلال وضع الاصبع على BL الأعلىADE (الجانب المخاطية يصل، وهذا يوجه النسيج بحيث يتم مقطوع طبقات العضلات القاعدية أولا). فصل ساندويتش وخفض حول حواف الجزء الأنسجة. قطع شريحة الأنسجة حوالي 0.5 سم × 1 سم. المناطق حافة لديهم ميل إلى حليقة، مما تسبب في مسلسل أقسام تحتوي على العديد من طبقات الأنسجة. لاحظ أن الإفراط في قطع هو أفضل من دون قطع، لذلك يتجه الى جانب الحذر.
  3. السماح للأنسجة لتدفئة حتى يبدأ الجليد على قمة الأنسجة في الذوبان. في هذه المرحلة بسرعة وبدقة الضغط على الأنسجة في كتلة أكتوبر في ناظم البرد.
  4. إزالة شفرة من خلال وضع الاصبع على العينة. ونقل الحرارة يسمح لك لإزالة شفرة دون تعطيل الأنسجة.
  5. معطف النسيج مع أكتوبر ويوازن لمدة 5 دقائق. قطع المقاطع في 10 ميكرون (الشكل 1E، F). تفقد البصر الأقسام حتى ينظر الخبايا. أقسام مكان في 1.5 مل أنابيب أو على الشرائح.
  6. لتحليل مرنا أو البروتين، مكان رانه العينات في الأنابيب مع 5 سرداب قاعدة، 5 الانتقالي، و 5 أقسام السطح في أنبوب. لجمع RNA إضافة 1 مل العزلة كاشف التجاري واحتضانها في RT لمدة 10 دقيقة. أداء تنقية RNA وفقا لتعليمات الشركة الصانعة. استخدام 5-10 ميكروغرام من الحمض النووي الريبي مجموع لتوليد كدنا].
  7. لتنقية البروتين، إضافة 0.5 مل من RIPA الباردة العازلة تحلل (بالإضافة إلى مثبطات الأنزيم البروتيني) في 5 أقسام. يصوتن 3 مرات في دورة 70٪، على الجليد.
    1. إضافة إلى عينات SDS العازلة تحميل الصفحة (العازلة Laemmli)، واحتضان عند 100 درجة مئوية لمدة 10 دقيقة. العينات الخاضعة للSDS PAGE ونقلها، ثم يعثرا في الحليب 5٪ / برنامج تلفزيوني لمدة 2 ساعة. إجراء تحليل لطخة غربية تليها الحضانة مع الأجسام المضادة KLF4 (1: 500) O / N عند 4 درجات مئوية.

Representative Results

تم تجهيز أقسام الأنسجة القولون لتقييم النسيجي وH & E تلطيخ 13. وينظر الى عرض المقطع العرضي التقليدي للالغشاء المخاطي في الشكل 2A. المناطق القاعدية تحتوي على الط العضلية، وتتكون أساسا من العضلية الدائرية. وانطلاقا نحو التجويف، والعضلية المخاطية واضح المتاخمة للخلايا الظهارية-سرداب قاعدة والخلايا الانتقالية هي في منتصف الأنسجة، وأخيرا، يواجه سكان الخلية سطح التجويف الأمعاء. طريقة باجتزاء المسلسل هو موضح هنا يؤكد هذا التوجه بحيث العضلية الطولية والدائرية واجهت أول (الشكل 2B)، تليها العضلية المخاطية (الشكل 2C). لاحظ ظهور خلايا الخلالية غير العضلات في الجزء العلوي الأيسر من الصورة. لوصف تحليل المصب أدناه، يتم تجاهل أقسام العضلات. الأقسام اللاحقة تحتوي على الخلايا الظهارية والنسيج الخلالي (الصفيحة المخصوصة)، بدءا من خلايا سرداب قاعدة (الشكل 2D). لاحظ عدم وجود التجويف المركزي في معظم الخبايا، التي يبدو أغمق بسبب نوى معبأة بشكل وثيق. هذه الطبقات تحتوي على مقصورة التكاثري. الخلايا الانتقالية تظهر معبأة بإحكام الغدد مع شمعة وسط بارزة (الشكل 2E). وأخيرا، السكان خلية السطح لديها بنية غير منتظمة، مع مناطق أحادي الطبقة الظهارية ينظر أون الوجه (الشكل 2F).

ويمكن أيضا معالجة مسلسل أقسام على النحو المبين أعلاه لوضع العلامات المناعي والفحص المجهري متحد البؤر (كما هو موضح هنا 14). الشكل 2G معارض الخبايا معزولة الثابتة وpermeabilized في الميثانول بنسبة 100٪ وبعد ذلك الملون للنوى (الأزرق) والبروتين تقاطع خلية خلية نطيقة النطيقة 1 (ZO-1، الأخضر). في الاتجاه باجتزاء التقليدية، ويمكن أن ينظر خلية سرداب والسطحية في وقت واحد (الشكل 2G الشكل (2G). ويعتبر تعزيز ZO-1 وصمة عار في السكان الخلية السطحية (الشكل 2I وJ).

ومن المعروف أن عدة عوامل التمايز أن يتم التعبير عنها بطريقة الزمانية المكانية على طول محور سرداب إلى السطح. ويشمل هذا العامل عامل النسخ Kruppel الشبيهة 4 (KLF4)، والذي يعرف لتخصيبه في السكان الخلية السطح. باستخدام أساليب باجتزاء التقليدية، وجدت KLF4 في نوى التجويف التي تواجه سكان الخلية السطحية (الشكل 2K). وبالتالي فإننا تكهن بأن KLF4 مرنا سيتم التعبير عنه في الغالب في السكان الخلية السطح. لاختبار هذا، وقد تم جمع الأجزاء المتسلسلة وتجميعها في العينات السطحية، الانتقالية، وسرداب قاعدة. Subsequently، كان حصادها RNA باستخدام استخراج Trizol القياسية، مع تنقية إضافية عن طريق العمود RNeasy والعلاج الدناز. وقد تم جمع الحمض النووي الريبي من 5 أقسام متتالية المجمعة، والتي أسفرت عن بين 5-10 ميكروغرام من الحمض النووي الريبي مجموع لكل عينة. ثم تم إخضاع هذه العينات لنصف الكمية في الوقت الحقيقي PCR لكلا KLF4 والجين المرجعية، TATA مربع بروتين ملزمة 1 (TBP-1) (الشكل 2L) 14. كما هو مبين في الشكل 2L، بعد تطبيع لTBP-1، تم العثور على الخلايا السطحية للتعبير عن ما يصل إلى 8 أضعاف KLF4 مرنا التي يعبر عنها في خلايا سرداب. وبالمثل، تم العثور على مستويات البروتين KLF4 لعرض التنظيم المكاني على طول محور سرداب أرض. وكان يتم تجميع الأجزاء المتسلسلة كما هو موضح أعلاه ثم حضنت في تحلل العازلة لمدة 20 دقيقة على 4 درجات مئوية. ونتجت عن ذلك بين 200-250 ميكروغرام من البروتين لكل عينة. عينات ثم تعرض تحليلها من قبل SDS-PAGE (الشكل 2M) 15. كما هو مبين في الشكل 2M، KLF4 صمستويات rotein هي أعلى بشكل كبير في أعداد الخلايا السطحية. النتائج المذكورة أعلاه تدل على قدرة هذا البروتوكول لعزل كميات كبيرة من المياه السطحية والخلايا الظهارية سرداب من الغشاء المخاطي للقولون الفئران.

الشكل 1
الشكل 1: (A) عرض تخطيطي الغشاء المخاطي للقولون الفئران وطبقات العضلات الخارجية. ويهدف لدينا وسيلة لجمع الخلايا السطحية وسرداب قاعدة السكان خلية منفصلة من قبل cryosectioning التسلسلي (10 ميكرون لكل منهما). يتم تجاهل طبقات العضلات الخارجية. (B) القبو ارتفاع يتفاوت على طول القولون (المسافة بين سرداب قاعدة وسطح طبقات). نقاط البيانات تشير القياسات سرداب الفردية والرموز تشير مكررات البيولوجية (ن = 4). (C) شرائح القولون التي تم جمعها، أوصال، ويشبك على طبق السيليكون تشريح. (D) والأنسجة ذاتهاgment الضغط حوالي 3 سم من فتحة الشرج بين لشفرات الحلاقة والمجمدة على الثلج الجاف. (E) الأنسجة ثم يتم تركيبه على التعادل قبل كتلة أكتوبر. تتم إزالة (F) Cryosections وتفقد البصر.

الرقم 2
الشكل 2: بيانات تمثيلية (A) أنسجة القولون ملطخة الهيماتوكسيلين-يوزين في المقطع العرضي تبين العضلية الدائرية (سم)، والعضلية المخاطية (مم)، وخلايا سرداب قاعدة والخلايا الانتقالية، والخلايا السطحية. (B - C) طبقات العضلات القولون. (D) خلايا القبو قاعدة. لاحظ عدم وجود التجويف المركزي. (E) الخلايا الانتقالية. (F) الخلايا السطحية. (G) المناعي تلطيخ من الخبايا القولون المعزولة. ويلاحظ ZO-1 (الخضراء) ونوى (الأزرق) في المقطع العرضي. (مرحبا) ZO-1 وتلطيخ النووي في الخلايا الانتقالية والسطحية. (J) صورة مكبرة من ZO-1 تلطيخ. (K) KLF4 (الأخضر) غير المخصب في السكان الخلية السطح. (L) في الوقت الحقيقي PCR تقييم مستويات KLF4 مرنا بين المقصورات الثلاث. (M) تحليل لطخة غربية من مستويات البروتين KLF4 في هؤلاء السكان الخلية.

Discussion

غير مفهومة الآليات الجزيئية المشاركة في القولون تكاثر الخلايا الظهارية والتمايز. وهذا يشمل فجوات في فهمنا للبيئة الإشارات الخلوية من مقصورة الخلايا الجذعية في قاعدة الخبايا الظهارية القولون. وهناك أيضا اهتمام متزايد في العمليات التي تكمن وراء خلية معوية التمايز. على سبيل المثال، زيادة مطلوب فهم في الجسم الحي التمايز كمقياس للدراسات تهدف الى انتاج في المختبر أنظمة المعوية الابتدائية 16.

يحتوي الإجراء أعلاه العديد من الخطوات التي تتطلب المزيد من الاهتمام. أولا، وإزالة الحواف حول قطاع الأنسجة المجمدة (كما هو مبين في القسم 3.2) مطلوب كما حواف الأنسجة حليقة أثناء تشريح والتجمد. الفشل في نقل هذه النتائج حواف هو يسكنها خليط من الخلايا السطحية وقاعدة سرداب. تركيب الأنسجة على قبل المبردة، أكتوبر كتلة تعادل الضروري أيضا. تيبروتوكول له يمكن أن تتكيف مع مناطق أخرى من القولون البعيدة عن طريق تغيير عدد من المقاطع في كل تجمع. على سبيل المثال، كما هو مبين في الشكل 1B، المخاطية طول سرداب يتراوح بين 150-300 ميكرون. لذا، عند دراسة المنطقة الواقعة بين 4 سم 6 سم من فتحة الشرج، ينبغي زيادة عدد الفروع من 15 إلى 30. الأهم من ذلك، لا اقترح هذا البروتوكول لالقولون الداني (7 سم 9 سم) وذلك بسبب طيات ( الثنيات المائلة) التي تمتد إلى التجويف مما يجعل من المستحيل خلايا منفصلة السطحية وسرداب قاعدة من قبل باجتزاء المسلسل.

وقد استخدمت تقنيات باجتزاء مسلسل لدراسة سرداب قاعدة وسطح السكان الخلايا الظهارية في البشر. ومع ذلك، لدينا بروتوكول يضيف خطوات إضافية مطلوبة نظرا لصغر حجم أنسجة الفئران. نقترح أن البروتوكول المذكور أعلاه سيسمح للتحقيق في سرداب قاعدة والسكان الخلايا الظهارية السطحية في أنظمة الماوس لين العريكة وراثيا. في الواقع، yie أقسام المجمعةدينار بروتين عالي الجودة وRNA تحليل المصب مناسبة. ويمكن أن تشمل التطبيقات المستقبلية دراسة مسارات الإشارات الخلوية أو لونين مناعي. ومع ذلك، تجدر الإشارة إلى أنه، مثل العديد من الطرق البديلة المذكورة أعلاه، تحتوي على أقسام أدى مزيج من الخلايا الظهارية الصفيحة المخصوصة والخلالي. في الختام، بروتوكول الموصوفة هنا يوفر، طريقة العائد المرتفع السريع لتحليل العمليات الجزيئية في مناطق مختلفة مكانيا من الغشاء المخاطي للقولون الفئران.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
الطريقة Cryosectioning لتسليخ مجهري الفئران القولون الغشاء المخاطي
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter