Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Cryosectioning Méthode de microdissection de murin côlon Muqueuse

doi: 10.3791/53112 Published: July 12, 2015

Introduction

L'épithélium colique est un tissu très régénérative, avec des cellules souches résidentes reconstitution du tissu tous les quelques jours 1. Ce processus de régénération nécessite le maintien d'un compartiment de cellules souches proliférative. Avec le temps, les cellules filles nouvellement produits perdent leur potentiel de prolifération et de la migration vers la surface luminale de l'intestin. Coïncidant avec la migration, les cellules progénitrices se différencient en entérocytes de barrière formant matures ou cellules muqueuses caliciformes productrices. Le défaut de ce programme de différenciation est considérée comme compromise contribuer à barrière epitheliale comme cela est observé dans la maladie inflammatoire de l'intestin et du côlon 2,3.

Une étude détaillée des processus ci-dessus, il faudra des méthodes pour isoler les populations crypte-base et cellulaires de surface. Plusieurs méthodes existent, chacune avec des avantages uniques et des inconvénients. Les méthodes actuelles pour l'isolement de cellules épithéliales intestinales comprennent chagents exaltants et dissociation mécanique, ce qui entraîne l'isolement des cryptes entiers, des feuilles epitheliales ou des cellules individuelles en fonction des conditions expérimentales 4,5. Ce sont des méthodes à haut rendement, mais les changements dans la signalisation intracellulaire ont été rapportés dans ces conditions, qui peuvent ne pas représenter l'environnement natif 6,7. microdissection laser permet la collecte de matériau distinct spatiale, mais réalise moléculaire faible rendement 8,9. Dans les tissus du côlon humain, les méthodes de cryosectioning horizontaux de série ont été mis au point 10. Cependant, tissus murins muqueuses sont prohibitifs petit pour l'appropriation directe de cette technique. Chez les humains, les longueurs de la crypte intestinale (la distance entre la crypte-base et cellules de surface) dans le côlon varient entre ~ 100-1000 um 11. Chez les souris, les longueurs sont comprises entre crypte ~ 50 à 300 pm (voir la figure 1A). La petite taille des cryptes murins représente un défi pour l'isolation de ces deux populations de cellules en utilisant des protocoles existants.

Nous décrivons maintenant un faible coût, la méthode à haut rendement pour l'isolement de crypte-base et la surface population de cellules épithéliales dans les tissus du côlon murin. Tissus récoltés de cette manière peut ensuite être analysé par un certain nombre d'applications en aval, y compris les types immunofluorescence, une RT-PCR en temps réel (-Polymerase Chain Reaction) ou transfert de Western.

Protocol

Des expériences utilisés souris C57BL / 6 entre 10 et 12 semaines d'âge. Toutes les procédures utilisant des animaux ont été examinés et approuvés par le Comité de soin et l'utilisation Emory University animaux dans les institutions et ont été effectués selon les National Institutes of Health critères.

1. Configuration expérimentale

  1. Configuration du cryostat
    1. Equilibrer cryostat à -20 ° C, y compris la lame de microtome et mandrins (extrême prudence autour de la lame!).
    2. Remplissez un cryomoule vide avec OCT (Optimal composé coupe de la température) et équilibrer à -20 ° C (~ 30 minutes). Retirer les PTOM congelé du moule et le fixer sur le mandrin avec OCT liquide. Placez le bloc / mandrin dans le bras microtome et permettre l'OPO à définir pour 10 min.
    3. Régler le cryostat à 10 um par section et de se raser le bloc octobre jusqu'à ce qu'il soit plat. Sauvegardez le bras microtome loin de la lame de plusieurs centimètres. À ce stade, ne réglez pas la lame ou le mandrin pour le reste de l'expermode de.
  2. Préparer les lames de rasoir: Préparer deux lames de rasoir par échantillon. Utilisation d'un fichier de métal, terne le bord aiguisé de lames. Ensuite, retirez la bride en aluminium avec une pince.
  3. Pré-refroidir un plat en pyrex ou toute autre surface plane sur glace sèche.
  4. Préparer un plat de dissection avec 10-15 repères de la dissection. A 10 cm de boîte de culture tissulaire de 50% rempli de silicium est suffisante. Ajouter 5 ml de tampon de Hanks à la température ambiante.

2. Dissection du côlon distal Tissue

  1. La place des souris dans une chambre étanche et souris euthanasier par inhalation isoflurane et dislocation cervicale, puis pulvériser éthanol à 70% sur l'abdomen et le thorax 12.
  2. Faire une petite incision dans la peau de l'abdomen avec des ciseaux et ensuite faire une incision pour exposer la cavité péritonéale. Des procédures similaires peuvent être trouvés ici décrit 12.
  3. Couper le gros intestin à la marge de l'anus et de démêler le mésentère jusqu'à ce que le colon est libre.
  4. Exciser un côlon distalsegment compris entre 0 et 6 cm de l'anus. Ici, la profondeur de la crypte est ~ 150 um (voir la figure 1B). Couper ouvrir le côlon longitudinalement l'aide de ciseaux et retirer le contenu fécaux.
  5. Pin le tissu à plat de la dissection avec la surface de la muqueuse vers le haut. Étirer les tissus en utilisant des broches de dissection sur un plat de silicium dans un tampon Hanks et laisser reposer pendant 10 min à température ambiante (figure 1C). Cela supprime les plis du tissu et permet aux couches musculaires de se détendre.

3. Montez tissus sur le cryostat pour la coupe

  1. Faites glisser une lame de rasoir dans la section souhaitée de tissu, puis verser le tampon de Hanks. Ajouter une autre lame de rasoir pour le haut, faire un sandwich. Couper le segment de tissu et de retirer les broches. Transférez le sandwich lame de rasoir / tissu à la glace sèche. Laisser le tissu de geler (5-10 min, figure 1D).
  2. Ramassez le rasoir / sandwich tissu et lui permettre de se réchauffer légèrement en plaçant un doigt sur le bl hautade (côté muqueuse vers le haut. Ceci oriente le tissu de sorte que les couches basales musculaires sont sectionnés premier.). Séparer le sandwich et couper sur les bords du segment de tissu. Couper un segment de tissu d'environ, 0,5 cm x 1 cm. zones de bord ont tendance à se gondoler, ce qui provoque des coupes en série pour contenir de nombreuses couches de tissu. Notez que plus la coupe est meilleure que sous-coupe, de sorte pécher par excès de prudence.
  3. Laisser le tissu à chauffer jusqu'à ce que la glace sur le dessus du tissu commence à fondre. A ce point rapidement et presser délicatement le tissu dans le bloc PTOM du cryostat.
  4. Retirez la lame en plaçant un doigt sur l'échantillon. Le transfert de chaleur vous permettra de retirer la lame sans perturber le tissu.
  5. Enduire le tissu avec PTOM et équilibrer pendant 5 min. Couper des sections à 10 um (figure 1E, F). Inspecter visuellement les sections jusqu'à ce que les cryptes sont vus. sections de placer dans une tubes de 1,5 ml ou sur diapositives.
  6. Pour l'analyse de l'ARNm ou de protéines, endroit til échantillons dans des tubes avec 5 crypte base, 5 transition, et 5 sections de surface par tube. Pour la collecte de l'ARN ajouter 1 ml de réactif d'isolement commercial et incuber à température ambiante pendant 10 min. Effectuer la purification de l'ARN selon les instructions du fabricant. Utilisation 5-10 ug d'ARN total pour la production d'ADNc.
  7. Pour la purification des protéines, ajouter 0,5 ml de RIPA froid tampon de lyse (plus les inhibiteurs de protéase) pour 5 sections. Soniquer trois fois à un cycle de 70%, sur de la glace.
    1. Ajouter échantillons à SDS PAGE tampon de chargement (tampon Laemmli) et incuber à 100 ° C pendant 10 min. Échantillons soumis à SDS-PAGE et de transfert, puis bloquent dans 5% de lait / PBS pendant 2 heures. Effectuer une analyse western blot suivie d'une incubation avec des anticorps Klf4 (1: 500) O / N à 4 ° C.

Representative Results

Coupes de tissus du côlon ont été traitées pour l'évaluation histologique et la coloration H & E 13. Une vue en coupe transversale traditionnelle de la muqueuse est vu sur la figure 2A. Zones basales contiennent l'externe de la musculeuse, composée principalement de la musculeuse circulaires. En procédant vers la lumière, de la muqueuse musculaire est évident adjacente aux cellules epitheliales cryptiques-base et les cellules de transition sont au milieu du tissu, et enfin, des populations de cellules de surface font face à la lumière intestinale. La méthode décrite ici coupes sériées maintient une orientation telle que la musculeuse longitudinales et circulaires se rencontrent d'abord (figure 2B), suivie de la muscularis mucosa (figure 2C). On note l'apparition de cellules interstitielles non-musculaires en haut à gauche de l'image. Pour l'analyse en aval décrit ci-dessous, les sections de muscles sont écartés. Les sections suivantes contiennent des cellules épithéliales et tissu interstitiel (lamina propria), En commençant par les cellules crypte-base (Figure 2D). Noter l'absence d'une lumière centrale dans la plupart des cryptes, qui apparaissent plus foncées dues aux noyaux serrés. Ces couches contiennent du compartiment prolifératif. Les cellules transitoires apparaissent comme serrés glandes avec lumens centraux importants (figure 2E). Enfin, les populations de cellules de surface ont une structure irrégulière, avec des zones de la monocouche épithéliale vu de face (figure 2F).

Des coupes en série comme décrit ci-dessus peuvent également être traitées à l'étiquetage d'immunofluorescence et la microscopie confocale (comme décrit ici 14). Figure 2G montre cryptes isolées fixes et perméabilisées dans 100% de méthanol et ensuite colorées pour les noyaux (bleu) et la protéine de jonction cellule-cellule Zonula occludens 1 (ZO-1, vert). Dans l'orientation de sectionnement traditionnelle, cellule crypte et la surface peut être consulté simultanément (Figure 2G (figure 2G). Enhanced ZO-1 tache est vu dans des populations cellulaires de surface (Figure 2I et J).

Plusieurs facteurs de différenciation sont connues pour être exprimées d'une manière spatio-temporelle le long de l'axe crypte-à-surface. Cela comprend le facteur facteur de transcription Kruppel-like 4 (KLF4), qui est connu pour être enrichi dans des populations cellulaires de surface. En utilisant des méthodes traditionnelles de sectionnement, KLF4 se trouve dans les noyaux de lumière faisant face populations cellulaires de surface (Figure 2K). On a donc supposé que KLF4 ARNm serait exprimé de manière prédominante dans des populations cellulaires de surface. Pour tester cela, des coupes en série ont été collectés et regroupés dans des échantillons de surface, de transition, et la crypte-base. Subsequently, l'ARN a été récolté en utilisant l'extraction Trizol standard, avec une purification supplémentaire par colonne RNeasy et le traitement DNAse. L'ARN a été recueilli à partir de 5 sections consécutives en gestion commune, qui a donné entre 5-10 ug d'ARN total par échantillon. Ces échantillons ont ensuite été soumis à la PCR en temps réel semi-quantitative pour les deux KLF4 et un gène de référence, TATA liaison box protein 1 (TBP-1) (Figure 2L) 14. Comme représenté sur la figure 2L, après normalisation de la TBP-1, des cellules de surface se sont révélés exprimer jusqu'à huit fois la KLF4 ARNm qui est exprimée dans les cellules cryptiques. De même, les niveaux de protéine Klf4 ont été trouvés à exposer régulation spatiale long de l'axe crypte-surface. Des coupes sériées ont été réunies comme décrit ci-dessus, puis incubées dans du tampon de lyse pendant 20 min à 4 ° C. Cela a donné entre 200-250 pg de protéine par échantillon. Les échantillons ont ensuite été soumis analyse par SDS-PAGE (Figure 2 M) 15. Comme le montre la Figure 2 M, p KLF4rotein niveaux sont considérablement plus élevés dans les populations de cellules de surface. Les résultats ci-dessus démontrent la capacité de ce protocole pour isoler de grandes quantités de surface et les cellules épithéliales des cryptes de la muqueuse du côlon murin.

Figure 1
Figure 1: (A) Schéma démontrant muqueuse du côlon murin et des couches de muscles externes. Notre méthode vise à recueillir des populations de cellules distinctes de cellules de surface et de la crypte-base par cryosectioning série (10 um chacun). Les couches musculaires externes sont éliminés. Hauteur (B) crypte varie sur la longueur du côlon (distance entre les couches à base de cryptes et de surface). Les points de données indiquent les mesures et les symboles de la crypte individuels indiquent répétitions biologiques (n = 4). (C) des segments de Colon recueillies, bissectées et épinglés sur un plat de silicium dissection. (D) Un tissu soigment environ 3 cm de l'anus est pressé entre deux lames de rasoir et de la gelée sur glace sèche. (E) Le tissu est ensuite monté sur un bloc octobre pré-nivelé. (F) cryosections sont enlevés et inspecté visuellement.

Figure 2
Figure 2:. Les données représentatives (A) des tissus du côlon colorées à l'hématoxyline-éosine en coupe montrant la musculeuse circulaires (cm), la muqueuse de la musculeuse (mm), les cellules crypte-base, cellules transitoires, et les cellules de surface. (B - C) des couches musculaires du côlon. (D) des cellules Crypt-base. Noter l'absence d'une lumière centrale. (E) Les cellules transitionnelles. (F) cellules de surface. (G) Immunofluorescence des cryptes coliques isolés. ZO-1 (vert) et noyaux (bleu) sont observées en coupe. (SALUT) ZO-1 et coloration nucléaire dans les cellules de transition et de surface. (J) de la vue agrandie de ZO-1 coloration. (K) KLF4 (vert) est enrichi en des populations cellulaires de surface. (L) en temps réel PCR évaluation des niveaux d'ARNm KLF4 entre les trois compartiments. (M) Western blot de l'analyse des taux de protéines Klf4 dans ces populations de cellules.

Discussion

Les mécanismes moléculaires impliqués dans le côlon prolifération des cellules épithéliales et la différenciation sont mal comprises. Cela comprend lacunes dans notre compréhension de l'environnement de la signalisation cellulaire du compartiment des cellules souches à la base des cryptes épithéliales du côlon. Il ya également un intérêt croissant dans les processus qui sous-tendent la différenciation des entérocytes. Par exemple, une meilleure compréhension de la différenciation in vivo est requise comme une référence pour les études visant à produire in vitro des systèmes intestinaux primaires 16.

La procédure ci-dessus contient plusieurs mesures qui nécessitent une attention particulière. Tout d'abord, enlever les bords autour du segment de tissu congelé (tel que discuté à la section 3.2) est nécessaire que les bords de tissus papillotes pendant la dissection et la congélation. Si vous ne déplacez ces arêtes résultats est une population mixte de cellules de surface et de base crypte. Montage du tissu sur un pré-réfrigérés, EAO bloc nivelé est également essentiel. Tson protocole peut être adapté à d'autres régions du côlon distal en modifiant le nombre de sections dans chaque pool. Par exemple, comme représenté sur la figure 1B, la longueur de la muqueuse crypte varie entre 150 à 300 um. Par conséquent, lorsque l'on étudie la zone comprise entre 4 cm-6 cm de l'anus, le nombre de sections doit être augmentée de 15 à 30. Il est important, ce protocole est pas suggéré pour le côlon proximal (7 cm 9 cm) en raison des plis ( plicae obliquae) qui étendent dans la lumière qui rend impossible de surface et de la crypte à base de cellules séparées par sectionnement série.

Techniques de coupes sériées ont été utilisés pour étudier la crypte-base et la surface populations de cellules épithéliales chez l'homme. Cependant, notre protocole ajoute des étapes supplémentaires qui sont nécessaires en raison de la petite taille du tissu murin. Nous proposons que le protocole ci-dessus permettra de l'enquête de base et crypte-population de cellules épithéliales de surface dans les systèmes de souris génétiquement traitables. En effet, les sections regroupées Yield protéines de haute qualité et d'analyse en aval appropriée de l'ARN. Les applications futures pourraient inclure l'étude des voies de signalisation cellulaire ou immunoprécipitation de la chromatine. Toutefois, il convient de noter que, comme plusieurs des méthodes décrites ci-dessus, les sections résultantes contiennent un mélange de cellules épithéliales lamina propria et interstitielles. En conclusion, le protocole décrit ici fournit un procédé de production rapide, haut pour l'analyse de processus moléculaires dans des régions spatialement distinctes de la muqueuse du côlon murin.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Cryosectioning Méthode de microdissection de murin côlon Muqueuse
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter