Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Kryoschneiden Verfahren zur Mikrodissektion von Murine Kolonschleimhaut

doi: 10.3791/53112 Published: July 12, 2015

Introduction

Die Colon-Epithel ist ein hoch regenerativer Gewebe, mit Wohnsitz Stammzellen Auffüllen der Gewebe alle paar Tage ein. Dieser Prozess der Regeneration erfordert die Aufrechterhaltung einer proliferativen Stammzellkompartiments. Im Laufe der Zeit können die neu erzeugten Tochterzellen verlieren ihre proliferative Potenzial und wandern zu der luminalen Oberfläche des Darms. Gleichzeitig mit der Migration zu unterscheiden Vorläuferzellen in reife Barriere bildenden Enterozyten oder Schleimhaut produzierenden Becherzellen. Ausfall dieses Differenzierungsprogramms wird angenommen, tragen zur Epithelbarriere beeinträchtigt, wie es in entzündliche Darmerkrankungen und Kolonkrebs 2,3 beobachtet.

Studieren der obigen Prozesse werden Methoden zur Isolierung von Krypta-Basis- und Oberflächenzellpopulationen erforderlich. Mehrere Methoden existieren, die jeweils mit einzigartigen Vorteilen und Nachteilen. Aktuelle Verfahren für die Isolierung von intestinalen Epithelzellen schließen CHelating Mittel sowie mechanische Dissoziation, was in der Isolierung des gesamten Krypten Epithellappen oder Einzelzellen, abhängig von den experimentellen Bedingungen 4,5. Dies sind Hochzinsmethoden, noch Änderungen der interzellulären Signalübertragung haben unter diesen Bedingungen, die nicht der nativen Umgebung 6,7 darstellen können gemeldet. Laser Mikrodissektion ermöglicht die Sammlung von Raum unterschiedlichen Material, sondern erreicht mit niedrigem Molekular Ausbeute 8,9. In menschlichen Dickdarmgewebe, haben Serien horizontal Kryoschneiden Methoden entwickelt worden 10. Allerdings sind murine Schleimhautgewebe unerschwinglich klein für die direkte Verwendung dieser Technik. Beim Menschen Darm Krypta Längen (die ferne zwischen der Krypta-Basis und Oberflächenzellen) in den Dickdarm liegt zwischen ~ 100-1000 & mgr; m 11. Bei Mäusen sind crypt Längen zwischen ~ 50-300 & mgr; m (siehe Abbildung 1A). Die geringe Größe der murine Krypten stellt eine Herausforderung für die isolation dieser beiden Zellpopulationen in einem der vorhandenen Protokolle.

Wir beschreiben nun eine kostengünstige, High-Yield-Verfahren zur Isolierung von Krypta-Basis und Oberfläche epithelialen Zellpopulation in murinen Dickdarmgewebe. Gewebe in dieser Weise geerntet kann dann durch eine Reihe von Standard-Downstream-Anwendungen, einschließlich Immunfluoreszenzfärbung, RT-PCR (Echtzeit-Polymerase-Kettenreaktion) oder Western-Blot analysiert werden.

Protocol

Versuchen verwendeten C57BL / 6-Mäusen, 10 bis 12 Wochen alt sind. Alle Verfahren unter Verwendung von Tieren wurden überprüft und von der Emory University Institutional Animal Care und Verwenden Committee genehmigt und wurden nach den National Institutes of Health Kriterien durchgeführt.

1. Versuchsaufbau

  1. Einrichten des Kryostaten
    1. Äquilibrieren Kryostaten auf -20 ° C, einschließlich der Mikrotomklinge und Spannfutter (äußerst vorsichtig vorgehen, um die Klinge!).
    2. Füllen Sie eine leere cryomold mit OCT (optimale Schnitt Temperatur-Verbindung) und ins Gleichgewicht zu -20 ° C (~ 30 min). Entfernen Sie die gefrorenen Oktober aus der Form und befestigen Sie es am Spannfutter mit flüssigem Oktober Setzen Sie den Block / Spannfutter im Mikrotom Arm und lassen Sie das OAT 10 min eingestellt.
    3. Stellen Sie den Kryostaten bis 10 & mgr; m pro Schnitt und Rasur des Office-Block, bis es flach ist. Rücken des Mikrotoms Arm weg von der Klinge um mehrere Zentimeter. An dieser Stelle nicht das Messer oder Spannfutter für den Rest der Erfahrung anzupassen weißBeispiel.
  2. Bereiten Sie die Rasierklingen: Bereiten Sie 2 Rasierklingen pro Probe. Unter Verwendung einer Metallfeile, dumpf die sharped Rand der Blätter. Dann entfernen Sie den Flansch aus Aluminium mit einer Pinzette.
  3. Pre-Chillen ein Pyrex Gericht oder einer anderen flachen Oberfläche auf Trockeneis.
  4. Bereiten Sie eine Dissektion Gericht mit 10-15 Dissektion Stifte. A 10 cm Gewebekulturschale mit 50% Silizium gefüllt wird ausreichen. 5 ml Hanks-Puffer bei RT.

2. Präparation der Distal Kolongewebe

  1. Platz Mäusen in einer abgedichteten Kammer und einschläfern Mäusen durch Isofluran-Inhalation und Genickbruch, dann sprühen 70% Ethanol auf den Bauch und Brustkorb 12.
  2. Machen Sie einen kleinen Schnitt in der Haut des Bauches mit einer Schere und dann ein Einschnitt in die Bauchhöhle aus. Ähnliche Verfahren können hier 12 beschrieben gefunden werden.
  3. Schneiden Sie den Dickdarm am Rande anal und necken neben der Gekröse, bis der Doppelpunkt ist frei.
  4. Auszuschneiden einen distalen KolonSegment zwischen 0 und 6 cm vom Anus. Hier ist die Kryptentiefe ~ 150 & mgr; m (siehe Abbildung 1B). Schneiden Sie den Doppelpunkt in Längsrichtung mit einer Schere und die fäkale Inhalt zu entfernen.
  5. Pin das Gewebe auf die Dissektion Gericht mit der Schleimhautoberfläche nach oben zeigt. Dehnen die Verwendung Gewebedissektion Stifte auf einem Silizium-Gericht in Hanks-Puffer und ruhen lassen für 10 Minuten bei RT (1C). Dies entfernt Falten aus dem Gewebe und erlaubt die Muskelschichten zu entspannen.

3. Montieren Tissue auf dem Kryostat zum Schneiden

  1. Schieben einer Rasierklinge unter der gewünschten Gewebebereich und dann abgießen Hanks-Puffer. Einen weiteren hinzufügen Rasierklinge nach oben, so dass ein Sandwich. Schneiden Sie das Gewebesegment und die Stifte zu entfernen. Übertragen Sie die Rasierklinge / Gewebe-Sandwich auf Trockeneis. Lassen Sie das Gewebe einzufrieren (5-10 min, 1D).
  2. Nehmen Sie den Rasierer / Gewebe Sandwich und lassen Sie ihn leicht, indem Sie einen Finger auf die Oberseite bl wärmenade (Schleimhautseite nach oben. Dieser richtet das Gewebe, so dass die basalen Muskelschichten werden zuerst geschnitten.). Trennen Sie die Sandwich-und schneiden um die Ränder des Gewebesegment. Schneiden Sie ein Gewebesegment rund, 0.5 cm x 1 cm. Randbereiche haben eine Tendenz zu kräuseln, wodurch die Serienschnitte vieler Gewebeschichten. Beachten Sie, dass Überschneiden ist besser als unter Schneiden, so irren auf der Seite der Vorsicht.
  3. Damit das Gewebe erwärmt, bis das Eis auf der Oberseite des Gewebes zu schmelzen beginnt. An dieser Stelle schnell und sorgfältig drücken das Gewebe in OCT-Block in den Kryostaten.
  4. Entfernen Sie das Blade, indem Sie einen Finger über die Probe. Die Wärmeübertragung ermöglicht es Ihnen, die Klinge, ohne das Gewebe zu stören zu entfernen.
  5. Coat das Gewebe mit OAT und ins Gleichgewicht für 5 min. Zuschnitte bei 10 um (1E, F). Sichtprüfung der Abschnitte bis die Krypten zu sehen sind. Platz Abschnitte in ein 1,5 ml Röhrchen oder auf Objektträgern.
  6. Für die Analyse von mRNA oder Protein, Ort ter Proben in Röhrchen mit 5 Krypta-Basis, 5 Übergangs und 5 Flächenabschnitte pro Röhrchen. Für die RNA-Sammlung 1 ml kommerziellen Isolation-Reagenz und Inkubation bei Raumtemperatur für 10 min. Zuführen RNA-Reinigung gemß den Herstelleranweisungen. Verwenden 5-10 ug Gesamt-RNA für die cDNA-Generation.
  7. Zur Proteinreinigung, fügen Sie 0,5 ml kaltem RIPA Lysepuffer (plus Protease-Inhibitoren) je 5 Sektionen. Beschallen 3 mal in einer 70% igen Zyklus, auf Eis.
    1. Proben, die SDS-PAGE-Ladepuffer (Laemmli-Puffer) hinzufügen und Inkubation bei 100 ° C für 10 min. Betreff Proben SDS-PAGE und Transfer, dann in 5% Milch / PBS Block 2 Stunden. Western Blot-Analyse durchzuführen, gefolgt von einer Inkubation mit KLF4 Antikörper (1: 500) O / N bei 4 ° C.

Representative Results

Dickdarmgewebeschnitte wurden für die histologische Beurteilung und H & E Färbung 13 verarbeitet. Eine traditionelle Querschnittsansicht der Schleimhaut ist in 2A gesehen. Basal-Bereiche enthalten die Muscularis externa, vor allem der Kreis muscularis besteht. Ausgehend Richtung der Lumen ist die Muscularis mucosa verständlich neben dem Krypta-Basis Epithelzellen, sind Übergangszellen in der Mitte des Gewebes und schließlich Oberfläche Zellpopulationen konfrontiert das Darmlumen. Die hier beschriebene serielle Schnittverfahren unterhält eine Orientierung, so dass die Längs- und Rund muscularis zuerst angetroffen (2B), gefolgt von der Muscularis mucosa (2C). Beachten Sie die Darstellung der Nicht-Muskel interstitieller Zellen in der linken oberen Ecke des Bildes. Für die unten beschriebenen abwärts Analyse werden Muskelabschnitte verworfen. Die folgenden Abschnitte enthalten Epithelzellen und Zwischengewebe (Lamina propria), Mit Krypta-Basiszellen (2D). Bemerke die Abwesenheit eines zentralen Lumens in den meisten der Krypten, die dunkler erscheinen aufgrund der eng gepackten Kernen. Diese Schichten enthalten die proliferative Fach. Die Übergangs Zellen erscheinen als dicht gepackte Drüsen mit prominenten zentralen Lumen (2E). Schließlich Oberfläche Zellpopulationen eine unregelmäßige Struktur mit Bereichen des epithelialen Mono angesehen en face (2F).

Serienschnitte, wie oben beschrieben, können auch für die Immunfluoreszenz Kennzeichnung und konfokale Mikroskopie verarbeitet werden (wie hier 14 beschrieben). 2G zeigt isolierten Krypten fixiert und in 100% Methanol permeabilisiert und anschließend für Kerne (blau) und der Zell-Zell-junction-Protein Zonula gefärbten occludens 1 (ZO-1, grün). In der traditionellen Schnitte Orientierung kann Krypta und Oberflächenzelle gleichzeitig angezeigt werden (Abbildung 2G (Figur 2G). Verbesserte ZO-1-Färbung wird in Oberflächenzellpopulationen (2I und J) zu sehen.

Mehrere Differenzierungsfaktoren sind bekannt, in einem räumlich-zeitliche Art und Weise entlang der Krypta-zu-Oberfläche-Achse ausgedrückt werden. Dies schließt den Transkriptionsfaktor Kruppel artigen Faktor 4 (KLF4), die dafür bekannt ist, in der Oberflächenzellpopulationen angereichert werden. Mit herkömmlichen Schneideverfahren wird KLF4 in den Kernen der Lumen zugewandte Oberfläche Zellpopulationen (2k) gefunden. Wir haben daher vermutet, dass KLF4 mRNA würden vorwiegend in der Oberflächenzellpopulationen exprimiert werden. Um dies zu testen, wurden Serienschnitte gesammelt und in Oberflächenwasser, Übergangs- und Krypta-Basis Proben gruppiert. Subsequently, RNA wurde mit Trizol Standardextraktion geerntet, mit einer zusätzlichen Reinigung durch RNeasy Säule und DNAse-Behandlung. RNA wurde aus 5 gesammelt aufeinanderfolgende Abschnitte, die zwischen 5-10 ug Gesamt-RNA pro Probe ergab gesammelt. Diese Proben wurden dann auf semi-quantitative Echtzeit-PCR sowohl KLF4 und eines Referenzgens, TATA Box-Bindungsprotein 1 (TBP-1) (2L) 14 unterzogen. Wie in Figur 2L gezeigt ist, nach der Normalisierung zu TBP-1 wurden Oberflächenzellen bis zu 8-fache der KLF4 mRNA, die in Krypta-Zellen exprimiert wird, auszudrücken. In ähnlicher Weise wurden KLF4 Proteinspiegel festgestellt, dass räumliche Regelung entlang der Krypta-Flächenachse aufweisen. Serielle Schnitte wurden wie oben für 20 min bei 4 ° C beschrieben, und dann in Lysepuffer gepoolt. Dies ergab 200-250 ug Protein pro Probe. Proben wurden dann Analyse durch SDS-PAGE (2M) 15 unterzogen. Wie in Fig 2M gezeigt KLF4 protein Ebenen sind dramatisch in Oberflächenzellpopulationen höher. Die obigen Ergebnisse zeigen die Fähigkeit dieses Protokoll, um große Mengen von Oberflächen Krypta Epithelzellen aus dem murinen Kolonschleimhaut isolieren.

Abbildung 1
Figur 1: (A) schematische Darstellung murine Colon-Mucosa und äußeren Muskelschichten. Unsere Methode zielt darauf ab, diskrete Oberflächenzelle und Krypta-Basiszellpopulationen durch serielle Kryoschneiden (jeweils 10 & mgr; m) zu sammeln. Die äußeren Muskelschichten werden verworfen. (B) Crypt Höhe entlang der Länge des Dickdarms (Abstand zwischen Krypta-Basis und Deckschichten). Datenpunkte zeigen einzelne Krypta Messungen und Symbole zeigen biologischen Wiederholungen (n = 4). (C) Colon Segmente gesammelt, halbiert, und auf einen Silicium Sezieren Gericht festgesteckt. (D) Ein Gewebe segment etwa 3 cm vom Anus zwischen zu Rasierklingen gedrückt wird und das auf Trockeneis gefroren. (E) Das Gewebe wird dann auf eine vorge nivelliert Oktober Block montiert. (F) Kryoschnitte entnommen und visuell untersucht.

Figur 2
Abb. 2: Repräsentative Daten (A) Dickdarmgewebe mit Hämatoxylin-Eosin gefärbt im Querschnitt, die die kreisförmige muscularis (cm), die Muscularis mucosa (mm), Krypta-Basiszellen, Übergangszellen und Oberflächenzellen. (B - C) Darmmuskelschichten. (D) Crypt-Basiszellen. Bemerke die Abwesenheit eines zentralen Lumens. (E) Transitional-Zellen. (F) Oberflächenzellen. (G) Immunfluoreszenzfärbung von isolierten Kolonkrypten. ZO-1 (grün) und Zellkerne (blau) sind im Querschnitt beobachtet. (HALLO) ZO-1 und Kernfärbung in Übergangs- und Oberflächenzellen. (J) vergrößerte Ansicht ZO-1-Färbung. (K) KLF4 (grün) in Oberflächenzellpopulationen angereichert. (L) Real-time PCR Beurteilung KLF4 mRNA-Spiegel zwischen den drei Kammern. (M) Western Blot-Analyse von Protein KLF4 Niveau in diesen Zellpopulationen.

Discussion

Die molekularen Mechanismen in Kolonepithelzellen Zellproliferation und -differenzierung beteiligt sind kaum verstanden. Dies schließt Lücken in unserem Verständnis der zellulären Signalumgebung des Stammzellkompartiments an der Basis der Krypten Kolonepithel. Es besteht auch ein zunehmendes Interesse an der Prozesse, die Enterozyten Differenzierung unterliegen. Zum Beispiel, ein besseres Verständnis der in vivo Differenzierung wird als Benchmark für Studien an der Herstellung von in vitro Primärdarmsysteme 16 ausgerichtet erforderlich.

Das obige Verfahren beinhaltet mehrere Schritte, die besondere Maßnahmen erfordern. Erstens, das Entfernen der Ränder um die gefrorenen Gewebesegment (wie in Abschnitt 3.2 diskutiert) als die Geweberänder beim Präparieren und Einfrieren curl erforderlich. Die Nichtbeachtung dieser Kanten Ergebnisse zu bewegen ist eine Mischpopulation von Oberfläche und Krypta Basiszellen. Montage des Gewebes auf einem vorgekühlten, eingeebnet Oktober Block ist auch wichtig. Tseinem Protokoll kann zu anderen Bereichen des distalen Kolons durch Verändern der Anzahl von Abschnitten in jedem Pool angepasst werden. Zum Beispiel, wie in 1B gezeigt, variiert Mukosakryptenbereichs Länge zwischen 150-300 um. Daher wird, wenn die Untersuchung der Bereich zwischen 4 cm 6 cm vom Anus aus, die Anzahl der Abschnitte ist von 15 bis 30. Es ist wichtig erhöht werden, wird dieses Protokoll nicht für das proximale Colon vorgeschlagen (7 cm-9 cm) durch Falten ( plicae obliquae), die in das Lumen zu verlängern macht es unmöglich, getrennte Oberfläche und Krypta-Basiszellen durch Serienschnitt.

Serienschnitt Techniken wurden verwendet, um Krypta-Basis zu studieren und Oberfläche epithelialen Zellpopulationen in den Menschen. Fügt jedoch unser Protokoll zusätzliche Schritte, die aufgrund der geringen Größe des Maus-Gewebe erforderlich sind. Wir schlagen vor, dass das obige Protokoll wird für die Untersuchung der Krypta-Basis und Oberfläche epithelialen Zellpopulation in genetisch tractable Maus-Systeme ermöglichen. Tatsächlich vereinigt Abschnitte Yield hochwertiges Protein und RNA geeigneten nachgeschalteten Analyse. Zukünftige Anwendungen könnte die Untersuchung von Zellsignalwege oder Chromatinimmunpräzipitation enthalten. Es sollte jedoch beachtet werden, dass, wie einige der vorstehend beschriebenen alternativen Verfahren, enthalten die resultierenden Abschnitte eine Mischung von epithelialen und interstitielle Lamina propria Zellen sein. Im Ergebnis ist die hier beschriebene Protokoll stellt eine schnelle, hohe Ausbeute Methode für die Analyse von molekularen Prozessen in räumlich unterschiedlichen Regionen des murinen Colon-Schleimhaut.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Kryoschneiden Verfahren zur Mikrodissektion von Murine Kolonschleimhaut
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter