Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Murine Colonic म्यूकोसा के microdissection के लिए Cryosectioning विधि

doi: 10.3791/53112 Published: July 12, 2015

Introduction

colonic उपकला अस्तर निवासी स्टेम कोशिकाओं को हर कुछ दिन 1 ऊतक भरपाई के साथ एक उच्च पुनर्योजी ऊतक है। उत्थान की यह प्रक्रिया एक प्रफलन स्टेम सेल डिब्बे के रखरखाव की आवश्यकता है। समय के साथ, नव निर्मित बेटी कोशिकाओं को उनके proliferative संभावित खो देते हैं और आंत की luminal सतह की ओर पलायन। माइग्रेशन साथ संपाती, मूल कोशिकाओं परिपक्व बाधा के गठन enterocytes या श्लेष्मा उत्पादन जाम कोशिकाओं में अंतर। इस भेदभाव कार्यक्रम की विफलता इस तरह के भड़काऊ आंत्र रोग और पेट के कैंसर 2,3 में मनाया जाता है के रूप में उपकला बाधा से समझौता करने के लिए योगदान करने के लिए सोचा है।

इसके बाद के संस्करण प्रक्रियाओं का विस्तृत अध्ययन तहखाना-आधार है और सतह सेल आबादी को अलग करने के लिए तरीके की आवश्यकता होगी। कई तरीकों अद्वितीय फायदे और कमियां के साथ प्रत्येक मौजूद हैं। आंतों उपकला कोशिकाओं के अलगाव के लिए वर्तमान तरीकों चर्चा में शामिलप्रयोगात्मक शर्तों 4,5 पर निर्भर पूरे तहखाने, उपकला शीट, या एकल कक्षों के अलगाव में जिसके परिणामस्वरूप elating एजेंटों और मैकेनिकल विसंघटन। इन उच्च उपज तरीके हैं, अभी तक कहनेवाला संकेतन में परिवर्तन देशी वातावरण 6,7 प्रतिनिधित्व नहीं हो सकता है कि इन परिस्थितियों में सूचना दी गई है। लेजर कब्जा microdissection के स्थानिक अलग सामग्री के संग्रह के लिए अनुमति देता है, लेकिन कम आणविक उपज 8,9 प्राप्त होता है। मानव colonic ऊतक में, धारावाहिक क्षैतिज cryosectioning तरीकों के 10 विकसित किया गया है। हालांकि, murine श्लैष्मिक ऊतकों इस तकनीक का प्रत्यक्ष विनियोग के लिए बेहद छोटे हैं। इंसानों में, पेट में (तहखाना-आधार है और सतह कोशिकाओं के बीच दूर) आंतों तहखाना लंबाई माइक्रोन 100-1,000 ~ के बीच 11 बदलता रहता है। चूहों में, तहखाना लंबाई माइक्रोन 50-300 ~ के बीच (चित्रा 1 ए देखें) कर रहे हैं। murine तहखाने के छोटे आकार इसोला के लिए एक चुनौती प्रस्तुत करता हैमौजूदा प्रोटोकॉल का उपयोग इन दो सेल आबादी के tion।

अब हम एक कम लागत, तहखाना आधार के अलगाव के लिए उच्च उपज विधि का वर्णन और murine colonic ऊतक में उपकला सेल की आबादी की सतह। इस तरह से काटा ऊतक तो immunofluorescence धुंधला, आरटी पीसीआर (रियल टाइम-पोलीमरेज़ चेन रिएक्शन) या पश्चिमी सोख्ता सहित मानक बहाव के अनुप्रयोगों के एक नंबर से विश्लेषण किया जा सकता है।

Protocol

प्रयोगों उम्र के 10 और 12 सप्ताह के बीच C57BL / 6 चूहों का इस्तेमाल किया। पशुओं का उपयोग सभी प्रक्रियाओं की समीक्षा की और एमोरी विश्वविद्यालय संस्थागत पशु की देखभाल और उपयोग समिति ने मंजूरी दे दी है और स्वास्थ्य मापदंड के राष्ट्रीय संस्थान के अनुसार प्रदर्शन किया गया गया।

1. प्रायोगिक सेटअप

  1. Cryostat सेट अप
    1. सूक्ष्म ब्लेड और chucks सहित, -20 डिग्री सेल्सियस के लिए cryostat संतुलित करना (ब्लेड के आसपास अत्यधिक सावधानी बरतें!)।
    2. अक्टूबर के साथ एक खाली cryomold (इष्टतम काटने तापमान मिश्रित) भरें और -20 डिग्री सेल्सियस (~ 30 मिनट) को संतुलित करना। मोल्ड से जमे हुए अक्टूबर निकालें और तरल अक्टूबर के साथ चक पर यह तय कर लो। सूक्ष्म हाथ में ब्लॉक / चक प्लेस और अक्टूबर 10 मिनट के लिए निर्धारित करने की अनुमति देते हैं।
    3. खंड के अनुसार 10 माइक्रोन के लिए cryostat का सेट और यह सपाट है जब तक अक्टूबर ब्लॉक दाढ़ी। कई सेंटीमीटर से दूर ब्लेड से सूक्ष्म हाथ वापस। इस बिंदु पर अनुभव के शेष के लिए ब्लेड या चक समायोजित नहीं हैमेरा मतलब था।
  2. रेज़र ब्लेड तैयार: नमूना प्रति 2 रेज़र ब्लेड तैयार करें। एक धातु फ़ाइल का उपयोग करना, ब्लेड के sharped धार कुंठित। इसके बाद, संदंश के साथ एल्यूमीनियम निकला हुआ किनारा हटा दें।
  3. सूखी बर्फ पर एक pyrex पकवान या अन्य सपाट सतह प्री-ठंडा।
  4. 10-15 विच्छेदन पिन के साथ एक विच्छेदन पकवान तैयार करें। सिलिकॉन के साथ भरा एक 10 सेमी टिशू कल्चर पकवान 50% पर्याप्त होगा। आरटी पर हैंक्स बफर के 5 मिलीलीटर जोड़ें।

दूरस्थ Colonic ऊतक 2. विच्छेदन

  1. Isoflurane साँस लेना और गर्भाशय ग्रीवा अव्यवस्था द्वारा जगह एक सील कक्ष में चूहों और euthanize चूहों, तो पेट और छाती 12 पर 70% इथेनॉल स्प्रे।
  2. कैंची के साथ पेट की त्वचा में एक छोटा सा चीरा और फिर एक चीरा peritoneal गुहा को बेनकाब करने के लिए बनाते हैं। इसी तरह की प्रक्रियाओं यहां 12 में वर्णित पाया जा सकता है।
  3. गुदा कगार पर बड़ी आंत कट और पेट के लिए स्वतंत्र है, जब तक अन्त्रपेशी के अलावा तंग।
  4. एक बाहर का पेट के आबकारीगुदा से 0 और 6 सेमी के बीच खंड। इधर, तहखाना गहराई ~ 150 माइक्रोन (चित्रा 1 बी देखें)। कैंची का उपयोग अनुलंबीय पेट के लिए खुला है और मल सामग्री को हटा काटा।
  5. Mucosal सतह का सामना करना पड़ के साथ विच्छेदन डिश के लिए ऊतक पिन। हैंक्स बफर में एक सिलिकॉन डिश पर ऊतक का उपयोग विच्छेदन पिन बढ़ाकर और आर टी (चित्रा 1C) पर 10 मिनट के लिए आराम करते हैं। इस ऊतक से सिलवटों को निकालता है और मांसपेशियों की परतों आराम करने के लिए अनुमति देता है।

सेक्शनिंग के लिए cryostat पर 3. माउंट ऊतक

  1. ऊतक के वांछित खंड के अंतर्गत एक रेजर ब्लेड स्लाइड और फिर हैंक्स बफर बंद डालना। एक सैंडविच बनाने, शीर्ष करने के लिए एक और धार जोड़ें। ऊतक खंड कट और पिन को हटा दें। सूखी बर्फ को धार / ऊतक सैंडविच स्थानांतरण। (5-10 मिनट, चित्रा -1) ऊतक फ्रीज करने की अनुमति दें।
  2. उस्तरा / ऊतक सैंडविच लेने और यह शीर्ष बीएल पर उंगली रखकर थोड़ा गर्म करने की अनुमतिएडीई (श्लैष्मिक तरफ ऊपर। यह बेसल मांसपेशी परतों पहले sectioned हैं इतना है कि ऊतक orients।)। सैंडविच अलग और ऊतक खंड के किनारों के आसपास काटा। एक ऊतक खंड लगभग 0.5 सेमी एक्स 1 सेमी काटें। एज क्षेत्रों धारावाहिक वर्गों कई ऊतक परतों को शामिल करने के लिए कारण, कर्ल करने की प्रवृत्ति है। से अधिक के काटने के तहत काटने से बेहतर है कि ध्यान दें, इसलिए सावधानी की ओर गलती।
  3. ऊतक के शीर्ष पर बर्फ पिघला करने के लिए शुरू होता है जब तक ऊतक गर्म करने के लिए अनुमति दें। इस बिंदु पर जल्दी से और ध्यान से cryostat अक्टूबर ब्लॉक में ऊतक दबाएँ।
  4. नमूना पर एक उंगली रखकर ब्लेड निकालें। गर्मी हस्तांतरण आप ऊतक में बाधा पहुँचा के बिना ब्लेड दूर करने के लिए अनुमति देगा।
  5. कोट अक्टूबर के साथ ऊतक और 5 मिनट के लिए संतुलित करना। 10 माइक्रोन (चित्रा 1E, एफ) में वर्गों में कटौती। तहखाने में देखा जाता है जब तक नेत्रहीन वर्गों का निरीक्षण किया। एक 1.5 मिलीलीटर ट्यूब में या स्लाइड्स पर प्लेस वर्गों।
  6. MRNA या प्रोटीन, जगह टी के विश्लेषण के लिए5 तहखाना-बेस के साथ, संक्रमणकालीन 5, और ट्यूब प्रति 5 सतह वर्गों के साथ ट्यूबों में वह नमूने हैं। शाही सेना के संग्रह के लिए 1 मिलीलीटर वाणिज्यिक अलगाव अभिकर्मक जोड़ने के लिए और 10 मिनट के लिए आरटी पर सेते हैं। निर्माता के निर्देशों के अनुसार शाही सेना शुद्धि प्रदर्शन करते हैं। सीडीएनए पीढ़ी के लिए कुल शाही सेना के 5-10 माइक्रोग्राम का प्रयोग करें।
  7. प्रोटीन शुद्धि के लिए, ठंड RIPA के 0.5 मिलीलीटर 5 वर्गों प्रति बफर (प्लस प्रोटीज इनहिबिटर्स) lysis जोड़ें। बर्फ पर, एक 70% चक्र में 3 बार Sonicate।
    1. एसडीएस पृष्ठ लोडिंग बफर (Laemmli बफर) के लिए नमूने जोड़ें और 10 मिनट के लिए 100 डिग्री सेल्सियस पर सेते हैं। एसडीएस पृष्ठ और हस्तांतरण के अधीन रहते हुए नमूने, तो 2 घंटे के लिए 5% दूध / पीबीएस में ब्लॉक। (: 500 1) 4 डिग्री सेल्सियस पर हे / एन KLF4 एंटीबॉडी के साथ ऊष्मायन द्वारा पीछा पश्चिमी धब्बा विश्लेषण करते हैं।

Representative Results

Colonic ऊतक वर्गों ऊतकीय मूल्यांकन और एच एंड ई 13 धुंधला करने के लिए प्रोसेस किया गया। म्यूकोसा के एक परंपरागत पार अनुभाग देखें 2A चित्रा में देखा जाता है। बेसल क्षेत्रों में मुख्य रूप से परिपत्र पेशीय से बना बाह्य पेशीकला, होते हैं। लुमेन की ओर आगे बढ़ने से, पेशीय म्यूकोसा तहखाना आधार उपकला कोशिकाओं से सटे स्पष्ट है, संक्रमणकालीन कोशिकाओं ऊतक के बीच में हैं, और अंत में, सतह सेल आबादी आंत लुमेन सामना करते हैं। यहाँ वर्णित धारावाहिक सेक्शनिंग विधि पेशीय म्यूकोसा (चित्रा -2) द्वारा पीछा अनुदैर्ध्य और परिपत्र पेशीय पहले (चित्रा 2 बी) सामना कर रहे हैं कि इस तरह के एक अभिविन्यास, रखता है। छवि के ऊपर छोड़ दिया में गैर पेशी मध्य कोशिकाओं की उपस्थिति पर ध्यान दें। बहाव के विश्लेषण के नीचे वर्णित के लिए, मांसपेशियों वर्गों खारिज कर रहे हैं। आने वाले खंड उपकला कोशिकाओं और मध्य ऊतक होते हैं (लामिना propria), तहखाना आधार कोशिकाओं (चित्रा 2 डी) के साथ शुरू। कारण बारीकी से भरे नाभिक को गहरे रंग दिखाई देते हैं जो तहखाने, के अधिकांश में एक केंद्रीय लुमेन के अभाव ध्यान दें। इन परतों प्रफलन डिब्बे होते हैं। संक्रमणकालीन कोशिकाओं के रूप में कसकर प्रमुख केंद्रीय lumens (चित्रा 2 ई) के साथ ग्रंथियों पैक दिखाई देते हैं। अन्त में, सतह सेल आबादी चेहरा (चित्रा 2 एफ) एन देखा उपकला monolayer के क्षेत्रों के साथ, एक अनियमित संरचना है।

(यहां 14 में वर्णित के रूप में) से ऊपर वर्णित के रूप में धारावाहिक वर्गों भी immunofluorescence लेबलिंग और confocal माइक्रोस्कोपी के लिए कार्रवाई की जा सकती है। चित्रा 2 जी नाभिक (नीला) और सेल सेल जंक्शन प्रोटीन Zonula के लिए दाग बाद में तय की और 100% मेथनॉल में permeabilized और पृथक तहखाने से पता चलता है Occludens 1 (ZO-1, हरा)। पारंपरिक सेक्शनिंग ओरिएंटेशन में, तहखाना और सतह सेल (चित्रा 2 जी एक साथ देखा जा सकता है (चित्रा 2 जी) के केंद्र में, संक्रमणकालीन सेल आबादी के धारावाहिक sectioned नमूनों में देखा जा सकता है। बढ़ी ZO-1 दाग सतह सेल आबादी (चित्रा 2I और जे) में देखा जाता है।

कई भेदभाव कारकों तहखाना-से-सतह अक्ष के साथ एक spatiotemporal फैशन में व्यक्त किया जा करने के लिए जाना जाता है। इस सतह सेल आबादी में समृद्ध होने के लिए जाना जाता है जो प्रतिलेखन कारक Kruppel-जैसे कारक 4 (KLF4) शामिल हैं। पारंपरिक सेक्शनिंग विधियों का प्रयोग, KLF4 सतह सेल आबादी (चित्रा 2K) का सामना करना पड़ लुमेन के नाभिक में पाया जाता है। इसलिए हम KLF4 mRNA के मुख्य रूप से सतह सेल आबादी में व्यक्त किया जाएगा कि अनुमान लगाया। इस परीक्षण के लिए, धारावाहिक वर्गों एकत्र की है और सतह, संक्रमणकालीन, और तहखाना आधार नमूने में बांटा गया था। Subsequently, शाही सेना RNeasy स्तंभ और DNase उपचार द्वारा एक अतिरिक्त शुद्धि के साथ, मानक Trizol निकासी का उपयोग कर काटा गया था। शाही सेना के नमूने के अनुसार कुल शाही सेना के माइक्रोग्राम 5-10 के बीच जो झुकेंगे 5 जमा लगातार वर्गों से एकत्र किया गया था। ये नमूने तो KLF4 और एक संदर्भ जीन, टाटा बॉक्स बाध्यकारी प्रोटीन 1 (TBP-1) (चित्रा 2L) 14 दोनों के लिए अर्द्ध मात्रात्मक वास्तविक समय पीसीआर के अधीन थे। चित्रा 2L में दिखाया गया है, TBP-1 को सामान्य बनाने के बाद, सतह कोशिकाओं तहखाना कोशिकाओं में व्यक्त किया है कि 8 बार KLF4 mRNA के लिए ऊपर व्यक्त करने के लिए पाए गए। इसी तरह, KLF4 प्रोटीन का स्तर तहखाना-सतह अक्ष के साथ स्थानिक विनियमन प्रदर्शन करने के लिए पाए गए। 4 डिग्री सेल्सियस पर 20 मिनट के लिए lysis बफर में ऊपर वर्णित है और फिर incubated के रूप में धारावाहिक वर्गों जमा थे। यह नमूना प्रति प्रोटीन की 200-250 माइक्रोग्राम के बीच मिले। नमूने तो एसडीएस पृष्ठ (चित्रा 2 एम) 15 से विश्लेषण किए थे। चित्रा 2 एम में दिखाया गया है, KLF4 पीrotein के स्तर में नाटकीय सतह सेल आबादी में ज्यादा हैं। ऊपर दिए गए निष्कर्षों murine colonic म्यूकोसा से सतह और तहखाना उपकला कोशिकाओं की बड़ी मात्रा को अलग-थलग करने के लिए इस प्रोटोकॉल की क्षमता प्रदर्शित करता है।

चित्र 1
चित्रा 1: (ए) योजनाबद्ध दिखा murine colonic mucosa और बाहरी मांसपेशी परतों। हमारे विधि धारावाहिक cryosectioning (10 माइक्रोन प्रत्येक) द्वारा असतत सतह सेल और तहखाना आधार सेल आबादी को इकट्ठा करना है। बाहरी मांसपेशी परतों खारिज कर रहे हैं। (बी) तहखाना ऊंचाई कॉलन (तहखाना-आधार है और सतह परतों के बीच की दूरी) की लंबाई के साथ बदलता रहता है। डेटा बिंदुओं व्यक्ति तहखाना माप और प्रतीकों जैविक प्रतिकृति का संकेत संकेत मिलता है (एन = 4)। (सी) पेट के क्षेत्रों, एकत्र bisected, और एक सिलिकॉन विदारक पकवान पर टिकी है। एसई (डी) एक ऊतकगुदा से लगभग 3 सेमी रेज़र ब्लेड के बीच दबाया और सूखी बर्फ पर जमे हुए है gment। (ई) ऊतक तो एक पूर्व लगाए अक्टूबर ब्लॉक पर मुहिम शुरू की है। (एफ) cryosections हटा दिया है और नेत्रहीन निरीक्षण कर रहे हैं।

चित्र 2
चित्रा 2:। प्रतिनिधि डेटा परिपत्र पेशीय (सेमी) दिखा पार अनुभाग में Hematoxylin-eosin के साथ दाग (ए) Colonic ऊतक, पेशीय म्यूकोसा (मिमी), तहखाना आधार कोशिकाओं, संक्रमणकालीन कोशिकाओं, और सतह कोशिकाओं। (बी - सी) colonic मांसपेशी परतों। (डी) तहखाना आधार कोशिकाओं। एक केंद्रीय लुमेन के अभाव ध्यान दें। (ई) संक्रमणकालीन कोशिकाओं। (एफ) सतह कोशिकाओं। पृथक colonic तहखाने (G) immunofluorescence धुंधला। ZO -1 (हरा) और नाभिक (नीला) के पार अनुभाग में मनाया जाता है। (नमस्ते) ZO-1 और संक्रमणकालीन और सतह कोशिकाओं में परमाणु धुंधला हो जाना। (जे) ZO-1 धुंधला की आवर्धित दृश्य। (कश्मीर) KLF4 (हरा) सतह सेल आबादी में समृद्ध है। (एल) के तीन डिब्बों के बीच KLF4 mRNA स्तर की वास्तविक समय पीसीआर आकलन। (एम) इन सेल आबादी में KLF4 प्रोटीन के स्तर के पश्चिमी धब्बा विश्लेषण।

Discussion

colonic उपकला कोशिका प्रसार और भेदभाव में शामिल आणविक तंत्र खराब समझ रहे हैं। इस colonic उपकला तहखाने के आधार पर स्टेम सेल डिब्बे के सेलुलर संकेत पर्यावरण के बारे में हमारी समझ में अंतराल भी शामिल है। Enterocyte भेदभाव कायम करना है कि प्रक्रियाओं में एक बढ़ती रुचि भी है। उदाहरण के लिए, vivo में भेदभाव की समझ में इन विट्रो प्राथमिक आंतों सिस्टम 16 निर्माण करने के उद्देश्य के अध्ययन के लिए एक बेंचमार्क के रूप में की आवश्यकता है वृद्धि हुई है।

उपरोक्त प्रक्रिया अतिरिक्त ध्यान देने की जरूरत है कि कई चरणों में हैं। सबसे पहले, जमे हुए ऊतक खंड के चारों ओर किनारों (धारा 3.2 में चर्चा के रूप में) को हटाने के विच्छेदन और ठंड के दौरान कर्ल ऊतक किनारों के रूप में की आवश्यकता है। इन किनारों परिणामों को स्थानांतरित करने में विफलता सतह और तहखाना आधार कोशिकाओं के एक मिश्रित आबादी है। एक पूर्व ठंडा, समतल अक्टूबर ब्लॉक पर ऊतक बढ़ते भी आवश्यक है। टीउसकी प्रोटोकॉल प्रत्येक पूल में वर्गों की संख्या बदलकर बाहर का बृहदान्त्र के अन्य क्षेत्रों के लिए अनुकूलित किया जा सकता है। चित्रा 1 बी में दिखाया गया है उदाहरण के लिए, श्लैष्मिक तहखाना लंबाई 150-300 माइक्रोन के बीच होती है। गुदा से 4 सेमी-6 सेमी के बीच इस क्षेत्र का अध्ययन इसलिए, जब वर्गों की संख्या महत्वपूर्ण बात यह 30. 15 से वृद्धि की जानी चाहिए, इस प्रोटोकॉल के समीपस्थ पेट के लिए नहीं सुझाव दिया है (7 सेमी-9 सेमी) के कारण सिलवटों को ( धारावाहिक सेक्शनिंग से अलग सतह और तहखाना आधार कोशिकाओं के लिए यह असंभव बना लुमेन में विस्तार जो plicae obliquae)।

सीरियल सेक्शनिंग तकनीक तहखाना आधार का अध्ययन करने और मानव में उपकला सेल आबादी सतह के लिए इस्तेमाल किया गया है। हालांकि, हमारे प्रोटोकॉल की वजह से murine ऊतक के छोटे आकार के लिए आवश्यक हैं कि अतिरिक्त कदम कहते हैं। हम ऊपर प्रोटोकॉल आनुवंशिक रूप से विनयशील माउस प्रणालियों में तहखाना-आधार है और सतह उपकला सेल की आबादी की जांच के लिए अनुमति देगा कि प्रस्ताव। दरअसल, जमा वर्गों Yieएलडी उच्च गुणवत्ता वाले प्रोटीन और आरएनए उपयुक्त बहाव के विश्लेषण। भविष्य अनुप्रयोगों सेल संकेत दे रास्ते या chromatin immunoprecipitation का अध्ययन शामिल हो सकते हैं। हालांकि, यह ऊपर वर्णित वैकल्पिक तरीकों के कई तरह, जिसके परिणामस्वरूप वर्गों उपकला और मध्य लामिना propria कोशिकाओं का एक मिश्रण होते हैं, कि ध्यान दिया जाना चाहिए। अंत में, यहाँ वर्णित प्रोटोकॉल murine colonic mucosa के स्थानिक अलग क्षेत्रों में आणविक प्रक्रियाओं के विश्लेषण के लिए एक तेजी से, उच्च उपज तरीका प्रदान करता है।

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Murine Colonic म्यूकोसा के microdissection के लिए Cryosectioning विधि
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter