Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Cryosectioning Метод микродиссекции мышиной слизистой оболочки толстой кишки

doi: 10.3791/53112 Published: July 12, 2015

Introduction

Ободочной эпителия подкладка высоко регенеративного ткани, с резидентов стволовые клетки пополнения ткани через каждые несколько дней 1. Этот процесс регенерации требует поддержания пролиферативного стволовых клеток отсеке. Со временем, вновь полученные дочерние клетки теряют пролиферативным потенциалом и мигрируют к поверхности просвета кишечника. Одновременно с миграцией, клетки-предшественники дифференцируются в зрелые барьерных формирования энтероцитов или слизистых бокаловидных клеток, продуцирующих. Отказ эта дифференциация программы, как полагают, внести свой ​​вклад в угрозу эпителиальный барьер, таких как наблюдается при воспалительных заболеваниях кишечника и рака толстой кишки 2,3.

Детальное изучение этих процессов потребует методологии выделения крипт-базы и поверхности клеточной популяции. Существуют различные методы, каждый со своими уникальными преимуществами и недостатками. Современные методы выделения эпителиальных клеток кишечника включают CHelating агенты и механические диссоциации, в результате изоляции целых склепы, эпителиальных листов, или одиночных клеток, в зависимости от условий эксперимента. 4,5 Эти методы дают высокие, но изменения в межклеточной сигнализации сообщалось в этих условиях, которые не могут представлять родную среду 6,7. Лазерная захвата микродиссекции позволяет для сбора пространственной отдельного материала, но достигает низкой молекулярной 8,9 текучести. В человеческой толстой ткани, последовательные горизонтальные методы cryosectioning были разработаны 10. Тем не менее, мышиные слизистой ткани чрезмерно мал для непосредственного присвоения этой техники. В людях, длина кишечника склеп (отдаленные между склепа базы и поверхностных клеток) в толстой кишке колеблется от ~ 100-1000 мкм 11. У мышей, склеп длины между ~ 50-300 мкм (рис 1А). Небольшой размер мышиных склепов представляет проблему для Изолации этих двух клеточных популяций с использованием существующих протоколов.

Опишем низкую стоимость, метод высокого урожая для изоляции склепа базы и поверхности эпителиальных клеток мышиной населения в толстой ткани. Ткань собирали таким образом, может затем быть проанализированы с помощью ряда стандартных последующих применений, в том числе иммунофлуоресценции окрашивания, RT-PCR (в реальном времени полимеразной цепной реакции) или Вестерн-блоттинга.

Protocol

Эксперименты использованы мышей C57BL / 6 от 10 до 12-недельного возраста. Все процедуры с использованием животных были рассмотрены и утверждены университета Институциональная комитета Эмори Уход за животными и использование и были выполнены в соответствии с национальными институтами здравоохранения критериев.

1. Экспериментальная установка

  1. Настройка криостат
    1. Равновесие криостат до -20 ° С, в том числе лезвия микротома и патронов (проявлять особую осторожность вокруг лезвия!).
    2. Заполните пустой cryomold с октября (оптимальное температуры резания соединение) и уравновешивают до -20 ° С (~ 30 мин). Удалить замороженного октября из формы и закрепить его на патроне с жидким октября Поместите блок / патрон в микротома руку и позволяют ОКТ установить в течение 10 мин.
    3. Установите криостат до 10 мкм на секции и бриться блок октябре, пока он не является плоской. Назад микротоме руку подальше от ножа на несколько сантиметров. На данный момент не отрегулировать лезвие или патрон для оставшейся части Experiment.
  2. Подготовка бритвенных лезвий: Подготовка 2 лезвия на образец. Использование металла файл, скучно обостряла край лезвия. Затем удалите алюминия фланец с щипцами.
  3. Предварительно охладить блюдо Pyrex или другой плоской поверхности на сухом льду.
  4. Подготовка рассечение блюдо с 10-15 булавки рассечение. 10 см культуре ткани блюдо 50% заполнены кремния хватит. Добавляют 5 мл буфера Хенкса при комнатной температуре.

2. Препарирование дистальной ободочной ткани

  1. Место мышей в герметичной камере и усыпить мышей ИФ ингаляции и шейных позвонков, затем спрей 70% этанола на животе и грудной клетки 12.
  2. Сделайте небольшой надрез в коже живота с ножницами, а затем сделать разрез, чтобы обнажить брюшную полость. Аналогичные процедуры могут быть найдены описано здесь 12.
  3. Вырезать толстую кишку на грани анального и дразнить друг от друга брыжейки толстой кишки до не свободен.
  4. Акцизный дистальный толстой кишкиСегмент между 0 и 6 см от заднего прохода. Здесь глубина крипт составляет ~ 150 мкм (см фиг.1В). Разрежьте продольно толстой кишки с помощью ножниц и удалить содержимое фекальные.
  5. Прикрепите ткань к рассечение блюдо с поверхности слизистой оболочки вверх. Стретч ткани с помощью булавки рассечение на кремниевой блюдо в Хэнкс буфера и оставьте на 10 мин при комнатной температуре (рис 1в). Это устраняет складки из ткани и позволяет мышечные слои, чтобы расслабиться.

3. Установите ткани на криостат для секционирования

  1. Слайд лезвие под нужный раздел ткани, а затем вылейте буфер Хэнкса. Добавить еще лезвие к вершине, делает бутерброд. Вырезать сегмент ткани и удалить штифты. Перевести бутерброд лезвие / тканей к сухим льдом. Разрешить ткани, чтобы заморозить (5-10 мин, рис 1D).
  2. Возьмите бритвы бутерброд / ткани и дайте ему прогреться слегка касаясь пальцем на верхнем блADE (слизистой стороной вверх. Это ориентирует ткани так, что базальные слои мышц подразделяются в первую очередь.). Отдельные бутерброд и вырезать вокруг краев сегмента ткани. Вырезать сегмент ткани примерно 0,5 см х 1 см. Краевые участки имеют тенденцию к скручиванию, в результате чего серийные срезы содержат много слоев ткани. Обратите внимание, что более-резки лучше, чем под резки, так ошибаться в сторону осторожности.
  3. Разрешить ткани, чтобы нагреть, пока лед в верхней части ткани не начинает плавиться. В этот момент быстро и тщательно нажать ткани в блоке октября в криостате.
  4. Удалить лезвие, расположив пальцы по образцу. Теплопередачи позволит вам удалить лезвие, не нарушая ткани.
  5. Пальто ткани с октября до равновесия в течение 5 мин. Сокращение на секции 10 мкм (рис 1E, F). Осмотрите секции до тех пор, склепы не видел. Место участки в 1,5 мл пробирки или на слайдах.
  6. Для анализа мРНК или белка, место тон пробует в трубах с 5 склепа базы, 5 переходный и 5 участков поверхности в трубке. Для сбора РНК добавить 1 мл реагента коммерческой изоляции и инкубировать при комнатной температуре в течение 10 мин. Выполните очистку РНК в соответствии с инструкциями изготовителя. Использование 5-10 мкг общей РНК для генерации кДНК.
  7. Для очистки белка, добавить 0,5 мл холодного буфера для лизиса RIPA (плюс ингибиторы протеазы) за 5 разделов. Разрушать ультразвуком 3 раза по 70% цикла, на льду.
    1. Добавить примеры для SDS-PAGE загрузки буфера (буфера Лэммли) и инкубируют при 100 ° С в течение 10 мин. Предметные образцы в ДСН-ПААГ и передачи, то блок, в 5% молоке / PBS в течение 2 часов. Выполнение Вестерн-блоттинга с последующей инкубацией с Klf4 антител (1: 500) O / N при 4 ° С.

Representative Results

Разделы толстой кишки ткани были обработаны для гистологического оценки и Н & Е окрашивания 13. Традиционный разрез слизистой оболочки видно на фиг.2А. Базальные области содержат наружный мышечный, состоит в основном из круговых мышечной. Исходя сторону просвета, мышечной слизистой очевидно, прилегающих к Crypt-база эпителиальных клеток, переходные клетки находятся в середине ткани, и, наконец, популяции клеточной поверхности сталкиваются просвета кишечника. Последовательный метод секционирования описано здесь сохраняет ориентацию таким образом, чтобы продольные и круговые мышечной встречаются первый (фиг.2В), а затем в мышечной слизистой (фиг.2с). Обратите внимание на внешний вид немышечных интерстициальных клеток в верхнем левом углу изображения. Для анализа на выходе описано ниже, участки мышц, отбрасываются. Последующие разделы содержат эпителиальные клетки и интерстициальной ткани (собственная пластинка), Начиная с склеп-базовых элементов (рис 2D). Обратите внимание на отсутствие центрального просвета в наиболее склепы, которые темнее из-за плотно упакованных ядер. Эти слои содержат пролиферативную отсек. Переходные клетки появляются, как плотно железы с выдающимися центральных люмен (рис 2E). Наконец, население клеточной поверхности имеют неправильную структуру, с участками эпителия монослоя смотреть анфас (рис 2F).

Серийные срезы, как описанные выше, также могут быть обработаны для иммунофлуоресцентного маркировки и конфокальной микроскопии (как описано здесь, 14). Рисунок показывает 2G изолированные крипты фиксированные и проницаемыми в 100% метанола, а затем окрашивали в течение ядер (синий) и клетка-клетка соединительной белка блокатора малой зоны Occludens 1 (ZO-1, зеленый). В традиционной ориентации срезов, склеп и клеточной поверхности можно рассматривать одновременно (рис 2G (рис 2G). Расширенные ZO-1 пятно видно в популяциях поверхность клеток (рис 2I и J).

Несколько факторов дифференциации, как известно, выражается в пространственно-временной моды вдоль оси крипта-поверхность. Это включает транскрипционный фактор Kruppel-подобный фактор 4 (Klf4), который, как известно, обогащенный популяций клеточной поверхности. При использовании традиционных способов секционирования, KLF4 находится в ядрах просвет, стоящих население поверхности клетки (рис 2K). Поэтому мы предположили, что KLF4 мРНК будет преимущественно экспрессируется в популяциях поверхности клеток. Чтобы проверить это, серийные срезы были собраны и сгруппированы в поверхностные, в переходный период, и склеп-базовых образцов. Subsequently, РНК собирали при помощи стандартного извлечение тризола, с дополнительным Очистка колоночной RNeasy и лечения ДНКазы. РНК была получена из 5 объединенных последовательных секций, которые дали между 5-10 мкг общей РНК в образце. Эти образцы были затем подвергнуты полуколичественный ПЦР в реальном времени и для KLF4 и контрольного гена, ТАТА-блок связывающего белка 1 (ТБФ-1) (рис 2 л) 14. Как показано на рисунке 2 л, после нормализации до ТБФ-1, на поверхности клетки экспрессируют вплоть до 8 раз KLF4 мРНК, что выражается в клеток крипт. Аналогичным образом, уровень белка KLF4 было обнаружено обладают пространственной регулирование вдоль оси крипты поверхности. Серийные срезы были объединены, как описано выше, а затем инкубировали в буфере для лизиса в течение 20 мин при 4 ° С. Это давало между 200-250 мкг белка в образце. Затем образцы подвергали анализу с помощью SDS-PAGE (рис 2М) 15. Как показано на рисунке 2М, KLF4 рУровни rotein являются значительно выше в популяциях клеточной поверхности. Вышеуказанные результаты показывают способность этого протокола, чтобы изолировать большое количество поверхности и эпителиальных клеток крипт из мышиного слизистой оболочки толстой кишки.

Фигура 1
Рисунок 1: () Схематическое изображение мышиный слизистой оболочки толстой кишки и внешние слои мышц. Наш метод направлен на сбор отдельные группы клеточной поверхности и склеп-базовые сотовые последовательным cryosectioning (10 мкм каждый). Внешние слои мышц, отбрасываются. Высота (В) Crypt изменяется вдоль длины ободочной кишки (расстояние между крипт-базовых и поверхностных слоев). Точки данных указывают отдельные измерения склеп и символы указывают на биологические повторов (N = 4). (C) сегментов толстой кишки собирают, пополам, и удержал на кремниевую рассекает блюдо. (D) тканей себеgment примерно 3 см от заднего прохода нажата между ними, чтобы бритвенных лезвий и замораживали на сухом льду. (Е) ткани затем монтируется на предварительно выровнена блока Октябрь. (F) криосрезах удаляют и визуально.

Рисунок 2
Рисунок 2:. Представительные данные () толстой ткани окрашивали гематоксилин-эозином в поперечном сечении, показывающий циклические мышечной (см), мышечной слизистой (мм), крипты-Базовые элементы, переходные клетки, и поверхностные клетки. - С) толстой слои мышц. (D) Склеп-базовые клетки. Обратите внимание на отсутствие центрального просвета. (Е) Переходные клетки. (F) поверхности клетки. (G), иммунофлуоресценции окрашивание изолированных кишечных крипт. ZO-1 (зеленый) и ядра (синий) наблюдаются в поперечном сечении. (HI) ZO-1 и ядерного окрашивание в переходных и поверхностных клеток. (J), увеличенный вид ZO-1 окрашивания. (К) KLF4 (зеленый) обогащен населения клеточной поверхности. (L), ПЦР в реальном времени оценка уровня мРНК KLF4 между тремя отделениями. (М) Вестерн-блот-анализ уровней белка Klf4 в этих клеточных популяций.

Discussion

Молекулярные механизмы, участвующие в толстой пролиферации эпителиальных клеток и дифференцировки плохо изучены. Это включает в себя пробелы в нашем понимании клеточной среде передачи сигналов из стволовых клеток отсеке в основании ободочной эпителиальных криптах. Существует также растущий интерес к процессам, которые лежат в основе дифференциации энтероцитов. Например, более глубокое понимание дифференциации в естественных условиях требуется в качестве ориентира для исследований, направленных на производство в пробирке первичных кишечных систем 16.

Выше процедура состоит из нескольких шагов, которые требуют особого внимания. Во-первых, удаление ребра вокруг замерзшего участка ткани (как описано в разделе 3.2) требуется как ткани краев скручиваться во время вскрытия и замерзания. Несоблюдение этих краях двигаться результатов является смешанное население наземных и склеп базовых клеток. Монтаж ткани на предварительно охлажденной, сравняли октября блок также имеет важное значение. Тего протокол может быть адаптирован для других областей дистального отдела толстой кишки, изменяя количество секций в каждом пуле. Например, как показано на фиг.1В, через слизистую оболочку длина крипт варьирует между 150-300 мкм. Таким образом, при изучении область между 4 см-6 см от заднего прохода, количество секций должна быть увеличена с 15 до 30. Важно отметить, что этот протокол не предложил для проксимального двоеточия (7 см-9 см) из-за складок ( смятия obliquae), которые проходят в полость делает невозможным отдельных поверхностных и крипт-базовых клеток путем последовательного секционирования.

Последовательные методы срезов были исследованы Crypt-базу и поверхности эпителиальных клеточных популяций в организме человека. Тем не менее, наш протокол добавляет дополнительные шаги, которые необходимы из-за небольшого размера мышиного ткани. Мы полагаем, что выше протокол позволит расследования склепа базы и населения поверхность эпителиальных клеток генетически послушными систем мыши. Действительно, объединенные разделы YieLD белок высокого качества и РНК подходит вниз анализ. Будущие приложения могут включать в себя изучение сигнальных путей клетки или иммунопреципитации хроматина. Тем не менее, следует отметить, что, как и некоторые из альтернативных методов, описанных выше, в результате участки содержат смесь эпителиальных и интерстициальных клеток собственной пластинки. В заключение, протокол, описанный здесь, обеспечивает быстрое, высокую урожайность метод для анализа молекулярных процессов в пространственно отдельных регионах мышиного слизистой оболочки толстой кишки.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Cryosectioning Метод микродиссекции мышиной слизистой оболочки толстой кишки
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter