Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Método cryosectioning para microdisección de murino mucosa colónica

doi: 10.3791/53112 Published: July 12, 2015

Introduction

El revestimiento epitelial del colon es un tejido altamente regenerativa, con células madre residentes reponer el tejido cada pocos días 1. Este proceso de regeneración requiere el mantenimiento de un compartimento de células madre proliferativa. Con el tiempo, las células hijas recién producidos pierden su potencial proliferativo y migran hacia la superficie luminal del intestino. Coincidiendo con la migración, las células progenitoras se diferencian en enterocitos barrera formadora maduros o mucosas células caliciformes productoras. Fracaso de este programa de diferenciación se cree que contribuyen a la barrera epitelial comprometida tal como se observa en la enfermedad inflamatoria intestinal y cáncer de colon 2,3.

Estudio detallado de los procesos anteriores requerirá metodologías para aislar cripta-base y los teléfonos superficie poblaciones. Existen métodos múltiples, cada uno con sus ventajas y desventajas únicas. Los métodos actuales para el aislamiento de células epiteliales intestinales incluyen chagentes elating y disociación mecánica, lo que resulta en el aislamiento de criptas enteras, láminas epiteliales o células individuales, dependientes de las condiciones experimentales 4,5. Estos son los métodos de alto rendimiento, sin embargo, los cambios en la señalización intercelular se han reportado en estas condiciones que pueden no representar el entorno nativo de 6,7. Captura de microdisección láser permite la recolección de material distinto espacial, pero logra bajo 8,9 rendimiento molecular. En el tejido del colon humano, métodos cryosectioning horizontales de serie se han desarrollado 10. Sin embargo, los tejidos mucosos murinos son prohibitivamente pequeño para la apropiación directa de esta técnica. En los seres humanos, las longitudes de cripta intestinal (la distancia entre la cripta-base y células de la superficie) en el colon varía entre 100-1.000 micras ~ 11. En ratones, las longitudes de las criptas son entre ~ 50-300 micras (ver Figura 1A). El pequeño tamaño de las criptas murinos presenta un desafío a la isolación de estas dos poblaciones celulares utilizando protocolos existentes.

Ahora describir un bajo costo, método de alto rendimiento para el aislamiento de la cripta-base y la superficie de la población de células epiteliales en el tejido del colon murino. Tejido recogido de esta manera puede entonces ser analizada por un número de aplicaciones posteriores estándar, incluyendo la tinción de inmunofluorescencia, RT-PCR (Reacción en Cadena de la Polimerasa en Tiempo Real-) o el Western Blot.

Protocol

Los experimentos utilizaron ratones C57BL / 6 entre 10 y 12 semanas de edad. Todos los procedimientos que utilizan los animales fueron revisados ​​y aprobados por el Comité de Cuidado y Uso de Emory Universidad Institucional Animal y se llevaron a cabo de acuerdo con los Institutos Nacionales de Salud criterios.

1. Configuración Experimental

  1. Configuración del criostato
    1. Equilibrar criostato a -20 ° C, incluyendo la hoja microtomo y mandriles (tener mucho cuidado alrededor de la hoja!).
    2. Llenar un vacío con criomolde octubre (compuesto óptimo de corte de la temperatura) y equilibrar a -20 ° C (~ 30 min). Retire la congelada octubre del molde y fijarla en el plato con OCT líquido. Coloque el bloque / tirada en el brazo microtomo y permitir que los PTU se asiente durante 10 min.
    3. Ajuste el criostato a 10 micras por sección y afeitar el bloque de octubre hasta que es plana. Copia el brazo microtomo lejos de la hoja por varios centímetros. En este punto, no ajuste la cuchilla o tenazas para el resto de la experiment.
  2. Preparar las hojas de afeitar: Prepare 2 hojas de afeitar por muestra. Usando una lima de metal, sin brillo el borde afilado de cuchillas. A continuación, retire la brida de aluminio con unas pinzas.
  3. Pre-enfriar un plato de Pyrex u otra superficie plana en hielo seco.
  4. Preparar un plato de disección con 10-15 pines de disección. Un 10 cm placa de cultivo tisular de 50% lleno de silicio será suficiente. Añadir 5 ml de tampón de Hanks a TA.

2. Disección de colon distal de Tejidos

  1. Coloque los ratones en una cámara sellada y la eutanasia a los ratones por inhalación de isoflurano y dislocación cervical, y luego rociar etanol al 70% en el abdomen y el tórax 12.
  2. Haga una pequeña incisión en la piel del abdomen con unas tijeras y luego hacer una incisión para exponer la cavidad peritoneal. Procedimientos similares se pueden encontrar aquí descrito 12.
  3. Cortar el intestino grueso en el borde anal y desmenuzar el mesenterio hasta que el colon es gratuita.
  4. Extirpar un colon distalsegmento entre 0 y 6 cm del ano. Aquí, la profundidad de las criptas es de ~ 150 micras (véase la Figura 1B). Corte abierto el colon longitudinalmente con unas tijeras y retire los contenidos fecales.
  5. Pin el tejido para el plato de disección con la superficie de la mucosa hacia arriba. Estire los tejidos utilizando pasadores de disección en un plato de silicio en tampón Hanks y dejar reposar durante 10 minutos a temperatura ambiente (Figura 1C). Esto elimina los pliegues del tejido y permite que las capas de músculo se relaje.

3. Monte de Tejidos en el criostato de seccionamiento

  1. Deslizar una hoja de afeitar en la sección deseada de tejido y luego verter fuera el tampón de Hanks. Añadir otra hoja de afeitar para la parte superior, haciendo un sandwich. Cortar el segmento de tejido y quitar los pasadores. Transferir el sándwich cuchilla de afeitar / tejido para hielo seco. Permitir que el tejido se congele (5-10 min, la Figura 1D).
  2. Recoge la navaja / sándwich de tejidos y deje que se caliente un poco colocando un dedo en el bl superiorade (lado de la mucosa hacia arriba. Esto orienta el tejido de modo que las capas musculares basales se seccionan primero.). Separar el sándwich y cortar alrededor de los bordes del segmento de tejido. Cortar un segmento de tejido aproximadamente, 0,5 cm x 1 cm. Zonas de borde tienen una tendencia a curvarse, haciendo que las secciones en serie a contienen muchas capas de tejido. Tenga en cuenta que el exceso de corte es mejor que bajo el corte, por lo que errar por el lado de la precaución.
  3. Deje que el tejido se caliente hasta que el hielo en la parte superior del tejido comienza a derretirse. En este punto de forma rápida y con cuidado presione el tejido en el bloque de octubre en el criostato.
  4. Retire la hoja colocando un dedo sobre la muestra. La transferencia de calor le permitirá quitar la cuchilla sin alterar el tejido.
  5. Escudo del tejido con octubre y equilibre durante 5 min. Cortar secciones a las 10 micras (Figura 1E, F). Inspeccione visualmente las secciones hasta que se ven las criptas. Coloque las secciones en unos tubos de 1,5 ml o en las diapositivas.
  6. Para el análisis de ARNm o proteína, lugar tél muestras en tubos con 5 cripta-base, 5 de transición y 5 secciones de superficie por tubo. Para la recolección de ARN añadir 1 ml de reactivo aislamiento comercial e incubar a TA durante 10 min. Realizar la purificación del ARN según las instrucciones del fabricante. Utilice 5-10 g de ARN total para la generación de ADNc.
  7. Para la purificación de proteínas, añadir 0,5 ml de tampón de lisis frío RIPA (más inhibidores de la proteasa) por 5 secciones. Sonicar 3 veces en un ciclo de 70%, en hielo.
    1. Añadir muestras a SDS buffer de carga de la página (tampón Laemmli) e incubar a 100 ° C durante 10 minutos. Muestras sujetas a SDS PAGE y transferencia, a continuación, en el bloque 5% de leche / PBS durante 2 horas. Realizar análisis de transferencia Western seguido de incubación con anticuerpos KLF4 (1: 500) O / N a 4 ° C.

Representative Results

Secciones de tejido del colon se procesaron para la evaluación histológica y H & E tinción 13. Una vista en sección transversal tradicional de la mucosa se ​​ve en la Figura 2A. Áreas basales contienen la muscular externa, compuesta principalmente de la capa muscular circular. Procediendo hacia el lumen, la muscularis mucosa es evidente adyacente a las células epiteliales de las criptas-base, células de transición están en el medio del tejido, y, finalmente, las poblaciones celulares superficie de la cara la luz intestinal. El método de seccionamiento en serie descrito aquí mantiene una orientación tal que la capa muscular longitudinal y circular se encuentran primero (Figura 2B), seguido por la muscularis mucosa (Figura 2C). Tenga en cuenta la aparición de células intersticiales no musculares en la parte superior izquierda de la imagen. Para el análisis de aguas abajo se describe a continuación, las secciones musculares se descartan. Las secciones siguientes contienen células epiteliales y del tejido intersticial (lámina propia), A partir de las células de las criptas-base (Figura 2D). Nótese la ausencia de un lumen central en la mayoría de las criptas, que aparecen más oscuro debido a los núcleos estrechamente empaquetados. Estas capas contienen el compartimento proliferativo. Las células transicionales parecen tan apretujada glándulas con lúmenes centrales prominentes (Figura 2E). Por último, las poblaciones de células de superficie tienen una estructura irregular, con zonas de la monocapa epitelial visto en face (Figura 2F).

Serial secciones descritas anteriormente también pueden ser procesados ​​para el etiquetado de inmunofluorescencia y microscopía confocal (como se describe aquí 14). Figura 2G muestra criptas aislados fijos y permeabilized en el 100% de metanol y posteriormente teñidas para núcleos (azul) y la proteína de unión célula-célula zonula occludens 1 (ZO-1, verde). En la orientación de corte tradicional, células de la cripta y la superficie se puede ver simultáneamente (Figura 2G (Figura 2G). Enhanced ZO-1 mancha se ve en las poblaciones de células de superficie (Figura 2I y J).

Varios factores de diferenciación son conocidos por ser expresado de una manera espaciotemporal a lo largo del eje cripta-a-superficie. Esto incluye el factor de factor de transcripción Kruppel-like 4 (KLF4), que es conocido por ser enriquecido en poblaciones de células de superficie. El uso de métodos tradicionales de seccionamiento, KLF4 se encuentra en los núcleos de lumen que enfrentan las poblaciones de células de superficie (Figura 2K). Por lo tanto, especuló que KLF4 ARNm se expresa predominantemente en las poblaciones de células superficiales. Para probar esto, se recogieron y se agrupan en muestras superficiales, de transición, y la cripta a base de secciones en serie. Subsequently, el ARN se cosechó utilizando Trizol extracción estándar, con una purificación adicional por la columna RNeasy y tratamiento con ADNasa. ARN se recogió de 5 secciones consecutivas agrupados, que arrojó entre 5-10 g de ARN total por muestra. Estas muestras se sometieron entonces a la PCR en tiempo semi-cuantitativa real para ambos KLF4 y un gen de referencia, caja TATA proteína de unión 1 (TBP-1) (Figura 2L) 14. Como se muestra en la Figura 2L, después de la normalización a TBP-1, se encontraron células de la superficie para expresar hasta 8 veces el ARNm KLF4 que se expresa en células de las criptas. Del mismo modo, se encontraron niveles de proteína KLF4 para exhibir regulación espacial a lo largo del eje cripta-superficie. Las secciones seriadas se agruparon como se describe anteriormente y luego se incubaron en tampón de lisis durante 20 min a 4 ° C. Esto produjo entre 200 a 250 g de proteína por muestra. Las muestras se sometieron entonces el análisis por SDS-PAGE (Figura 2 M) 15. Como se muestra en la Figura 2 M, p KLF4niveles rotein son dramáticamente más alta en las poblaciones de células de la superficie. Los resultados anteriores demuestran la capacidad de este protocolo para aislar grandes cantidades de células epiteliales de las criptas de la superficie y de la mucosa del colon murino.

Figura 1
Figura 1: (A) que muestra esquemática murino mucosa colónica y las capas musculares externas. Nuestro método tiene como objetivo recoger las células de la superficie y la cripta de base poblaciones celulares discretas por cryosectioning serie (10 m cada uno). Las capas musculares externas se descartan. Altura (B) Cripta varía a lo largo de la longitud del colon (distancia entre las criptas-base y la superficie capas). Los puntos de datos indican las mediciones de las criptas individuales y símbolos indican réplicas biológicas (n = 4). (C) segmentos de colon recogen, se bisecaron, y puestas en una placa de silicio de disección. (D) Un tejido segment aproximadamente 3 cm del ano se presiona entre dos hojas de afeitar y el congelado en hielo seco. (E) El tejido se monta en un bloque de octubre pre-nivelado. (F) criosecciones se retiran y se inspeccionó visualmente.

Figura 2
Figura 2:. Los datos representativos (A) tejido colónico se tiñeron con hematoxilina-eosina en sección transversal que muestra la capa muscular circular (cm), la muscularis mucosa (mm), células de las criptas-base, las células de transición, y las células de la superficie. (B - C) capas musculares del colon. (D) células de las criptas-base. Nótese la ausencia de un lumen central. (E) Las células de transición. (F) las células superficiales. Tinción (G) de inmunofluorescencia de las criptas del colon aisladas. ZO-1 (verde) y núcleos (azul) se observan en sección transversal. (HOLA) ZO-1 y la tinción nuclear en las células de transición y de superficie. (J) vista ampliada de ZO-1 tinción. (K) KLF4 (verde) se enriquece en las poblaciones de células de superficie. (L) La evaluación de PCR en tiempo real de los niveles de ARNm KLF4 entre los tres compartimentos. (M) Análisis de transferencia Western de los niveles de proteína KLF4 en estas poblaciones de células.

Discussion

Los mecanismos moleculares implicados en la proliferación de células epiteliales del colon y la diferenciación son poco conocidos. Esto incluye lagunas en nuestra comprensión del entorno de señalización celular del compartimento de células madre en la base de las criptas epiteliales del colon. También hay un creciente interés en los procesos que subyacen a la diferenciación enterocito. Por ejemplo, el aumento se requiere la comprensión de la diferenciación in vivo como un punto de referencia para los estudios destinados a la producción de sistemas intestinales primarias in vitro 16.

El procedimiento anterior contiene varios pasos que requieren una atención especial. En primer lugar, se requiere la eliminación de los bordes de todo el segmento de tejido congelado (como se discutió en la sección 3.2), como los bordes de tejido rizo durante la disección y la congelación. Si no se mueve estos bordes resultados es una población mixta de células de la superficie de base y cripta. Montaje del tejido en un bloque de pre-enfriado, nivelado octubre también es esencial. Tsu protocolo puede ser adaptado a otras áreas del colon distal alterando el número de secciones en cada piscina. Por ejemplo, como se muestra en la Figura 1B, la longitud de la cripta mucosal varía entre 150-300 micras. Por lo tanto, en el estudio de la región entre los 4 cm de 6 cm del ano, el número de secciones debería aumentarse de 15 a 30. Es importante destacar que este protocolo no se sugiere para el colon proximal (7 cm 9 cm) debido a los pliegues ( plicas obliquae) que se extienden hacia la luz por lo que es imposible de superficie y la cripta-base celdas separadas por seccionamiento de serie.

Técnicas de seccionamiento en serie se han utilizado para estudiar cripta-base y la superficie poblaciones de células epiteliales en los seres humanos. Sin embargo, nuestro protocolo añade pasos adicionales que se requieren debido al pequeño tamaño de tejido murino. Proponemos que el protocolo anterior permitirá la investigación de la cripta-base y la población de células epiteliales superficiales en sistemas de ratón genéticamente manejables. De hecho, las secciones agrupados Yield proteínas de alta calidad y el ARN análisis de aguas abajo adecuado. Las futuras aplicaciones podrían incluir el estudio de las vías de señalización celular o inmunoprecipitación de la cromatina. Sin embargo, debe tenerse en cuenta que, al igual que varios de los métodos alternativos descritos anteriormente, las secciones resultantes contienen una mezcla de células de la lámina propia epiteliales e intersticiales. En conclusión, el protocolo descrito aquí proporciona un método rápido rendimiento, alta para el análisis de los procesos moleculares en regiones espacialmente distintas de la mucosa del colon murino.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Método cryosectioning para microdisección de murino mucosa colónica
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter