Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Cryosectioning Förfarande för Microdissection av murin kolonslemhinna

doi: 10.3791/53112 Published: July 12, 2015

Introduction

Den kolon epitelbeklädnaden är en mycket regenerativ vävnad, med inhemska stamceller påfyllning vävnaden med några dagars mellanrum 1. Denna process av förnyelse kräver upprätthållandet av en proliferativ stamcellsmaterialet. Med tiden de nyproducerade dotterceller förlorar sin proliferativ potential och migrera mot den luminala ytan i tarmen. I samband med migration, progenitorceller differentierar till mogna barriärbildande enterocyter eller slem producerande bägarceller. Fel på denna differentiering programmet är tänkt att bidra till att äventyras epitelbarriär såsom observeras vid inflammatorisk tarmsjukdom och tjocktarmscancer 2,3.

Detaljerad studie av ovanstående processer kommer att kräva metoder för att isolera crypt-bas och ytan cellpopulationer. Flera metoder finns, var och en med unika fördelar och nackdelar. Nuvarande metoder för isolering av intestinala epiteliala celler innefattar lmelating medel och mekanisk disassociation, vilket resulterar i isolering av hela kryptor, epiteliala ark eller enstaka celler, beroende på experimentella betingelser 4,5. Dessa är höga metoder avkastning, men förändringar i inter signalering har rapporterats under dessa betingelser som inte kan representera den ursprungliga miljö 6,7. Laser fånga microdissection möjliggör insamling av rumsliga distinkta material, men ger låg molekyl utbyte 8,9. I human kolonvävnad, har serie horisontella cryosectioning metoder utvecklats 10. Emellertid murina slemhinnevävnader är oöverkomligt små för direkt anslag på denna teknik. Hos människor, tarm crypt längder (den avlägsna mellan kryptan-bas och hudceller) i tjocktarmen varierar mellan ~ 100-1000 pm 11. Hos möss, krypta längder mellan ~ 50-300 m (se figur 1A). Den lilla storleken av murina kryptor utgör en utmaning för isolation av dessa två cellpopulationer med hjälp av befintliga protokoll.

Vi beskriver nu en låg kostnad, hög avkastning metod för isolering av kryptan-bas och yta epitelceller befolkning i murin kolonvävnad. Tissue skördats på detta sätt kan sedan analyseras av ett antal applikationer standard nedströms, inklusive immunofluorescensfärgning, RT-PCR (Real Time-Polymerase Chain Reaction) eller western blotting.

Protocol

Experiment används C57BL / 6-möss mellan 10 och 12 veckors ålder. Alla procedurer som använder djur har granskats och godkänts av Emory University Institutional Animal Care och användning kommittén och utfördes enligt National Institutes of Health kriterier.

1. Försöksinställning

  1. Ställa in Kryostat
    1. Jämvikta kryostat till -20 ° C, inklusive mikrotomen bladet och chuckar (mycket försiktig runt bladet!).
    2. Fyll en tom cryomold med oktober (Optimal Cutting Temperature-förening) och jämvikta till -20 ° C (~ 30 min). Ta bort den frusna oktober från formen och sätt den på chucken med vätska oktober Placera blocket / chucken i mikrotomen armen och låt ULT att ställa i 10 minuter.
    3. Ställ in kryostat till 10 mikrometer per avsnitt och raka ULT blocket tills det är plant. Tillbaka mikrotomen armen bort från bladet med flera centimeter. Vid denna punkt inte justerar bladet eller chuck för återstoden av expertisiment.
  2. Förbered rakblad: Förbered 2 rakblad per prov. Med hjälp av en metall-fil, tråkig sharped kanten av blad. Nästa bort aluminiumflänsen med pincett.
  3. Pre-chill en Pyrex maträtt eller annan plan yta på torris.
  4. Förbered en dissektion skålen med 10-15 dissektion stift. En 10 cm vävnadsodlingsskål 50% fylld med kisel räcker. Tillsätt 5 ml Hanks buffert vid RT.

2. Dissektion av Distal kolonvävnad

  1. Placera möss i en sluten kammare och avliva möss genom isofluran inandning och cervikal dislokation, sedan spraya 70% etanol på buken och bröstkorgen 12.
  2. Gör ett litet snitt i huden på buken med sax och därefter göra ett snitt för att exponera bukhålan. Liknande procedurer kan hittas beskrivs här 12.
  3. Skär tjocktarmen vid anal gränsen och retas isär tarmkäxet tills kolon är gratis.
  4. Excidera en distal kolonsegmentet mellan 0 och 6 cm från anus. Här är kryptadjup ~ 150 ^ m (se figur 1B). Klipp upp tjocktarmen i längdled med hjälp av en sax och ta avförings innehållet.
  5. Pin vävnaden till dissektion skålen med slemhinneytan vänd uppåt. Sträck vävnaden med användning dissektion stift på en kisel skålen i Hanks buffert och låt vila i 10 min vid RT (Figur 1C). Detta tar bort veck från vävnaden och möjliggör muskelskikten att slappna av.

3. Montera Tissue på kryostat för snitt

  1. Skjut ett rakblad enligt önskat avsnitt av vävnad och häll sedan bort Hanks buffert. Lägg till ett rakblad till toppen, att göra en smörgås. Skär mjukpapper och ta bort stiften. Överför rakblad / vävnads smörgås till torris. Låt vävnaden att frysa (5-10 min, figur 1D).
  2. Plocka upp rakhyveln / vävnads smörgås och låt den värmas något genom att placera ett finger på den övre blade (slemhinnesidan uppåt. Detta orienterar vävnaden så att de basala muskelskikten sektione först.). Separera den sandwich och skär runt kanterna på mjukpapper. Skär ett mjukpapper ungefär 0,5 cm x 1 cm. Kantområden har en tendens att böja sig, vilket får seriesektioner för att innehålla många tissueskikt. Observera att överskärning är bättre än underskärning, så missta sig på sidan av försiktighet.
  3. Låt vävnaden värmas tills isen ovanpå vävnaden börjar smälta. Vid denna punkt snabbt och tryck försiktigt vävnaden i ULT block i kryostaten.
  4. Ta bladet genom att placera ett finger över provet. Värmeöverföringen kan du ta bort bladet utan att störa vävnaden.
  5. Coat vävnaden med oktober och jämvikt under 5 min. Skär sektioner på 10 m (Figur 1E, F). Inspektera avsnitten tills kryptor ses. Placera avsnitt i en 1,5 ml rör eller på diabilder.
  6. För analys av mRNA eller protein, plats than prov i rör med 5 crypt-bas, 5 övergångs och 5 ytsektioner per rör. För RNA-samling tillsätt 1 ml kommersiell isoleringsreagens och inkubera vid RT i 10 min. Utför RNA-rening enligt tillverkarens instruktioner. Använd 5-10 pg av totalt RNA för cDNA generation.
  7. För proteinrening, tillsätt 0,5 ml kall RIPA lysbuffert (plus proteashämmare) per 5 sektioner. Sonikera tre gånger vid en 70% cykel, på is.
    1. Lägg prover för SDS PAGE-laddningsbuffert (Laemmli-buffert) och inkubera vid 100 ° C under 10 minuter. Angående prover för SDS PAGE och överföring, blocket i 5% mjölk / PBS under 2 h. Utför western blot-analys, följt av inkubering med Klf4 antikroppar (1: 500) O / N vid 4 ° C.

Representative Results

Kolon vävnadssektioner behandlades för histologisk bedömning och H & E-färgning 13. En traditionell tvärsnittsvy av slemhinnan ses i figur 2A. Basala områden innehåller muscularis externa, huvudsakligen bestående av de cirkulära muscularis. Fortsätter mot lumen är muscularis slemhinna uppenbar intill crypt-bas epitelceller, övergångs celler i mitten av vävnaden, och slutligen, yta cellpopulationer möta tarmlumen. Den seriella snittningsmetoden som beskrivs här bibehåller en orientering så att de längsgående och cirkulära muscularis påträffas först (fig 2B), följt av muscularis slemhinna (figur 2C). Notera förekomsten av icke-muskelceller interstitiella celler i det övre vänstra hörnet av bilden. För beskrev nedströms analys nedan, muskel sektioner kasseras. De följande avsnitten innehåller epitelceller och interstitiell vävnad (lamina propria), Med början i kryptan-bascellerna (Figur 2D). Notera avsaknaden av en central lumen i de flesta av de kryptor, som verkar mörkare på grund av de tätt packade kärnor. Dessa skikt innehåller den proliferativa utrymmet. Övergångs celler verkar så tätt packade körtlar med framstående centrala lumen (Figur 2E). Slutligen, yta cellpopulationer har en oregelbunden struktur, med delar av epitel mono sett en face (Figur 2F).

Serie sektioner som beskrivits ovan kan också behandlas för immunofluorescens märkning och konfokalmikroskopi (som beskrivs här 14). Figur 2G visar isolerade kryptor fasta och permeabilized i 100% metanol och därefter färgade för kärnor (blå) och cell-cell junction protein zonula occludens 1 (ZO-1, grön). I den traditionella snittorientering, kan crypt och yta cell ses samtidigt (Figur 2G (figur 2G). Förbättrad ZO-1 fläck ses i ytan cellpopulationer (figur 2I och J).

Flera differentieringsfaktorer är kända för att uttryckas i en spatiotemporal sätt längs kryptan-mot-yta-axeln. Detta innefattar transkriptionsfaktorn Kruppel-liknande faktor 4 (Klf4), som är känd att vara anrikad på ytan cellpopulationer. Med traditionella sektionemetoder är Klf4 hittas i kärnan av lumen vända ytan cellpopulationer (figur 2K). Vi spekulerade därför att Klf4 mRNA skulle främst uttryck i ytliga cellpopulationer. För att testa detta, var seriesnitt samlas in och grupperas i ytan, övergångs och crypt baserade prover. Subsequently ades RNA skörd användning av standard Trizol extraktion, med en ytterligare rening genom RNeasy-kolonn och DNas-behandling. RNA samlades från 5 poolade rad sektioner, som gav mellan 5-10 pg av totalt RNA per prov. Dessa prov utsattes därefter för semikvantitativ realtids-PCR för både Klf4 och en referens gen, TATA-box-bindande protein 1 (TBP-1) (fig 2L) 14. Såsom visas i figur 2L, efter normalisering mot TBP-1, var ytceller visade sig uttrycka upp till 8 gånger den Klf4 mRNA som uttrycks i kryptceller. På samma sätt var Klf4 proteinnivåer befanns uppvisa rumslig reglering längs kryptan-ytan axeln. Seriella sektioner poolades såsom beskrivits ovan och inkuberades sedan i lys-buffert under 20 min vid 4 ° C. Detta gav mellan 200-250 mikrogram protein per prov. Proverna utsattes sedan analys med SDS-PAGE (fig 2M) 15. Såsom visas i fig 2 M, Klf4 protein nivåer är dramatiskt högre i ytan cellpopulationer. Ovanstående resultat visar förmågan hos detta protokoll för att isolera stora mängder av ytan och crypt epitelceller från mus kolonslemhinnan.

Figur 1
Figur 1: (A) Schematisk visning murin kolonslemhinna och yttre muskelskikten. Vår metod är att samla diskreta ytan cell- och krypta baserade cellpopulationer genom serie cryosectioning (10 pm vardera). De externa muskelskikten kasseras. (B) Crypt höjd varierar längs längden av tjocktarmen (avståndet mellan crypt-bas- och ytskikten). Datapunkter anger enskilda crypt mätningar och symboler indikerar biologiska replikat (n = 4). (C) kolonsegment samlas, genomskärs, och satte på en kisel dissekera maträtt. (D) En vävnads segment ca 3 cm från anus pressas mellan till rakblad och frysta på torr is. (E) Tissue monteras sedan på en pre-planat oktober blocket. (F) Kryosnitt avlägsnas och visuellt.

Figur 2
Figur 2:. Representativa data (A) kolonvävnad färgades med Hematoxylin-Eosin i tvärsnitt som visar de cirkulära muscularis (cm), muscularis mucosa (mm), crypt-basceller, övergångsceller och hudceller. (B - C) kolonmuskelskikt. (D) Crypt-basceller. Notera avsaknaden av en central lumen. (E) Övergångs celler. (F) Surface celler. (G) Immunofluorescens färgning av isolerade kolon kryptor. ZO-1 (grön) och kärnor (blå) observeras i tvärsnitt. (HEJ) ZO-1 och nukleär färgning i övergångs- och hudceller. (J) förstorad bild av ZO-1 färgning. (K) Klf4 (grön) är anrikad på ytan cellpopulationer. (L) Realtids-PCR bedömning av Klf4 mRNA-nivåer mellan de tre facken. (M) Western blot-analys av Klf4 proteinnivåer i dessa cellpopulationer.

Discussion

De molekylära mekanismer som är involverade i kolon epitelial cellproliferation och differentiering är dåligt kända. Detta inkluderar brister i vår förståelse av cellulära signalerings miljö stamcells på basen av kolon epitelceller kryptor. Det finns också ett ökat intresse för de processer som ligger bakom enterocyten differentiering. Till exempel, ökad förståelse för in vivo differentiering krävs som ett riktmärke för studier som syftar till att producera in vitro primära tarmsystem 16.

Ovanstående procedur innehåller flera steg som kräver extra uppmärksamhet. För det första, att ta bort kanterna runt frusna vävnadssegment (vilket diskuteras i avsnitt 3.2) krävs som vävnadskanterna curl under dissekering och frysning. Underlåtenhet att flytta dessa kanter resultat är en blandad population av yt- och krypta basceller. Montering av vävnad på en pre-kyld, planat oktober blocket är också viktigt. Thans protokoll kan anpassas till andra områden i den distala kolon genom att ändra antalet sektioner i varje pool. Till exempel, som visas i figur 1B, varierar mucosal crypt längd mellan 150-300 nm. Därför, när man studerar området mellan 4 cm 6 cm från anus, bör ökas antalet sektioner från 15 till 30. Det är viktigt att detta protokoll inte föreslagits för proximala kolon (7 cm 9 cm) på grund av veck ( plicae obliquae) som sträcker sig in i lumen gör det omöjligt att separata yt- och krypta-basceller från seriesnittning.

Seriella sektione tekniker har använts för att studera crypt-bas och ytan epiteliala cellpopulationer hos människor. Men våra protokoll lägger till ytterligare åtgärder som krävs på grund av den begränsade storleken på murin vävnad. Vi föreslår att ovanstående protokoll gör det möjligt för utredning av kryptan-bas och ytan epitelceller befolkningen i genetiskt överskådliga mussystem. I själva verket, poolade sektioner Yield högkvalitativt protein och RNA lämplig nedströms analys. Framtida tillämpningar kan omfatta studier av cellsignaleringsvägar eller kromatin immunoprecipitation. Emellertid bör det noteras att, liksom flera av de alternativa metoder som beskrivits ovan, de resulterande sektionerna innehåller en blandning av epitel- och interstitiella lamina propria-celler. Sammanfattningsvis, det protokoll som beskrivs här ger en snabb, hög metod utbyte för analys av molekylära processer i rums distinkta regioner av mus kolonslemhinnan.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Cryosectioning Förfarande för Microdissection av murin kolonslemhinna
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter