Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Fare Kolon Mukozanın Mikrodisseksiyon için Cryosectioning Yöntemi

doi: 10.3791/53112 Published: July 12, 2015

Introduction

Kolon epitel ikamet kök hücreleri birkaç günde 1 doku Yenileyici ile son derece rejeneratif doku vardır. Rejenerasyon Bu işlem, bir proliferatif kök hücre bölmesinin bakım gerektirir. Zamanla, yeni üretilen kızı hücrelerinin çoğalma potansiyeli kaybeder ve bağırsak lümen yüzeyine doğru göç ederler. Göç ile tesadüf, progenitör hücrelerin olgun bariyer oluşturan enterositlerin veya mukoza üreten goblet hücrelerine farklılaşır. Bu farklılaşma programlarının başarısızlığı, iltihabik barsak hastalığı ve kolon kanseri 2,3 gözlenmiştir gibi epitelyal bariyer tehlikeye katkı düşünülmektedir.

Yukarıdaki işlemlerin detaylı bir çalışma kript-taban ve yüzey hücre popülasyonlarının izole edilmesi için metodolojileri gerektirecektir. Birden yöntemler benzersiz avantajlar ve dezavantajları, her biri mevcuttur. Intestinal epitelyal hücrelerin izolasyonu için güncel yöntemler, CHDeney koşulları, 4,5 göre, tüm kriptlerin, epitelyal levhalar, ya da tek hücreleri, izolasyonu ile sonuçlanarak elating maddeler ve mekanik ayrışma. Bu yüksek verim yöntemlerdir, fakat hücreler arası sinyal değişiklik doğal ortamından 6,7 temsil edebilir, bu koşullar altında rapor edilmiştir. Lazer yakalama mikrodiseksiyon mekansal farklı malzemenin toplanması için izin verir, ancak düşük molekül verim 8,9 ulaşır. İnsan kalın bağırsak dokusunda olarak, seri, yatay krio-bölümleme yöntemleri 10 geliştirilmiştir. Bununla birlikte, faregiller mukozal dokular, bu tekniğin, doğrudan dağıtımı ile ilgili bir engelleyici küçüktür. İnsanlarda, kolonda (kript-taban ve yüzey hücreleri arasındaki uzak) bağırsak crypt uzunlukları um 100-1000 ~ arasında 11 değişir. Farelerde, kript boyları um 50-300 ~ arasındaki (Şekil 1A bakınız). fare kript küçük boyutlu isola bir meydan okuma sunuyorMevcut protokolleri kullanarak, bu iki hücre popülasyonlarının yon.

Artık, düşük maliyetli, kript-baz izolasyonu için yüksek verimli bir yöntem tarif ve murin kolon dokusunda epitel hücre popülasyonu, yüzey. Bu şekilde hasat Doku daha sonra immünofloresan boyama, RT-PCR (Anlık-Polimeraz Zincir Reaksiyonu) ve western blotting de dahil olmak üzere, standart bir sonraki uygulamada, bir dizi analiz edilebilir.

Protocol

Deneyler, yaşlan 10 ile 12 hafta arasında, C57BL / 6 fareleri kullanılmıştır. Hayvanları kullanan tüm prosedürleri gözden ve Emory Üniversitesi Kurumsal Hayvan Bakım ve Kullanım Kurulu tarafından onaylanmış ve Sağlık kriterlerine National Institutes göre gerçekleştirilmiştir bulundu.

1. Deney Düzeneği

  1. Cryostat Kurma
    1. Mikrotom bıçak ve mandreller dahil, -20 ° C'ye Kriyostat dengelenmesi (bıçak etrafında aşırı dikkatli!).
    2. Ekim boş bir cryomold (Optimal Kesme Sıcaklık bileşik) doldurun ve -20 ° C (~ 30 dk) dengelenmesi. Kalıptan dondurulmuş Ekim çıkarın ve sıvı OCT ile aynasının üzerinde sabitleyin. Mikrotom kolunda blok / mandreni yerleştirin ve Ekim 10 dakika için ayarlamanızı sağlar.
    3. Bölüm başına 10 um Kriyostat ayarlayın ve düz olana kadar Ekim blok tıraş. Birkaç santimetre bıçaktan uzak mikrotom kolunu yedekleyin. Bu noktada exper kalanı için bıçak ya da Chuck ayarlamak yokşekli.
  2. Jilet hazırlayın: numune başına 2 Jilet hazırlayın. Metal dosyasını kullanarak, bıçakların sharped kenarı donuk. Sonra, forseps ile alüminyum flanşı çıkarın.
  3. Kuru buz üzerinde bir Pyrex çanak veya diğer düz bir yüzeye önceden soğuk.
  4. 10-15 diseksiyon pimleri ile diseksiyon çanak hazırlayın. Silikon ile dolu bir 10 cm'lik bir doku kültürü kabı% 50 yeterli olacaktır. Oda sıcaklığında Hanks tamponu içinde 5 ml.

Distal Kolon Doku 2. Diseksiyon

  1. Izofluran inhalasyonu ve servikal dislokasyon ile yerleştirin yalıtılmış bir bölmede fareler ve euthanize fareler, daha sonra karın ve göğüs 12 üzerine% 70 etanol sprey.
  2. Makas ile karın derisinde küçük bir kesi yapmak ve daha sonra bir kesi periton boşluğuna maruz olun. Benzer işlemler burada 12 tarif bulunabilir.
  3. Anal eşiğinde kalın bağırsak kesin ve kolon serbest kalıncaya kadar mezenter ayrı kızdırmak.
  4. Distal kolon tüketimanüsten 0 ve 6 cm arasında kademeli. Burada, kript derinliği ~ 150 mikron (Şekil 1B bakınız). Makas kullanarak boyuna kolon açın ve dışkı içeriğini kaldırmak kesmek.
  5. Mukoza yüzeyi yukarı bakacak şekilde diseksiyon çanak doku pin. Hanks tamponu bir silikon çanak doku kullanılarak diseksiyon işaretçilerine gerin ve RT (Şekil 1C) 10 dakika dinlendirin. Bu doku kıvrımlar kaldırır ve kas tabakaları dinlenmek için izin verir.

Kesit için Kriyostat 3. Montaj Doku

  1. Dokuda istenilen bölümünde bir jileti kaydırın ve ardından Hanks tampon dökünüz. Bir sandviç yapma, üstüne başka bir jilet ekleyin. Doku segmenti kesin ve işaretçilerine çıkarın. Kuru buz jilet / doku sandviç aktarın. (5-10 dk, Şekil 1D) doku dondurmak için izin verin.
  2. Jilet / doku sandviç Pick up ve üst bl üzerinde bir parmak koyarak hafifçe ısınmaya bırakınade (mukozal tarafı yukarı. Bu bazal kas tabakaları ilk kesitli böylece doku yönlendirir.). Sandviç ayırın ve doku segmentinin kenarlarda kesti. Bir doku bir bölümü yaklaşık olarak 0.5 cm x 1 cm kesilir. Kenar bölgeleri seri bölümleri birçok doku katmanları içeren neden kıvrılmaya bir eğilim vardır. Aşırı kesme altında kesim daha iyi olduğunu unutmayın, bu yüzden dikkatli bir tarafında err.
  3. Doku üstünde buz erimeye başlayana kadar doku ısınmasını bekleyin. Bu noktada hızlı ve dikkatli kriyostat OCT bloğa doku basın.
  4. Numune üzerinde parmağınızı koyarak bıçağını çıkarın. Isı transferi doku aksatmadan bıçağı çıkarmak için izin verecektir.
  5. Ceket Ekim doku ve 5 dakika için dengelenmeye. 10 mikron (Şekil 1E, F) bölümleri kesin. Kriptler görülür kadar gözle bölümleri inceleyin. 1.5 ml tüpler içinde veya slaytlar yerleştirin bölümleri.
  6. MRNA veya protein, bir yer t analizi için5 crypt-baz geçiş 5 ve tüp başına 5 yüzey bölümleri ile tüplerde o örnekleri. RNA toplanması için 1 ml ticari bir yalıtım reaktif ekleme ve 10 dakika için oda sıcaklığında inkübe edilir. Üreticinin talimatlarına uygun olarak, RNA saflaştırma gerçekleştirin. CDNA üretimi için toplam RNA 5-10 mikrogram kullanın.
  7. Protein Saflaştırma için, soğuk RIPA 0.5 ml 5 bölümden başına tampon (artı proteaz inhibitörleri), liziz ekleyin. Buz üzerinde,% 70'lik bir çevrim ile 3 kez sonikasyon.
    1. SDS-PAGE yükleme tamponu (Laemmli tamponu) numune ilave edin ve 10 dakika boyunca 100 ° C de inkübe edilir. SDS PAGE ve transfer tabi örnekleri, daha sonra 2 saat boyunca% 5 süt / PBS içinde bloke eder. (: 1: 500), 4 ° C'de, O / N Klf4 antikorlar ile kuluçkalandı ve ardından Western blot analizini gerçekleştirir.

Representative Results

Kolon doku kesitleri histolojik değerlendirme ve H & E 13 boyamak için işlenmiştir. Mukoza geleneksel kesit görünüşüdür Şekil 2A'da görülmektedir. Bazal alanlar ağırlıklı olarak dairesel muskularis oluşan muskularis eksterna, içerirler. Lümene doğru ilerleyerek, muscularis mukoza kript baz epitel hücreleri bitişik belirgindir, ara hücreleri doku ortasında, ve son olarak, yüzey hücre popülasyonları bağırsak lümenini karşı karşıyadır. Burada tarif edilen seri kesit yöntemi muscularis mukoza (Şekil 2C) ve ardından boyuna ve dairesel muscularis ilk (Şekil 2B) karşılaşılan şekilde bir yönlendirme korur. Görüntünün sol üst dışı kas interstisyel hücrelerin görünümünü unutmayın. Aşağı analiz aşağıda açıklanan için, kas bölümleri atılır. sonraki bölümlerde epitel hücreleri ve interstisyel doku içerirler (lamina propria), Kript baz hücreleri (Şekil 2D) ile başlanarak. Nedeniyle yakından paketlenmiş çekirdeklere koyu görünür kriptalarının, çoğunda merkezi lümenin olmadığına dikkat edin. Bu tabakalar, proliferatif bir bölme ihtiva etmektedir. geçiş hücreler sıkı belirgin santral lümen (Şekil 2E) ile bezlerini dolu görünür. Son olarak, yüzey hücre popülasyonları yüzü (Şekil 2F) tr inceledi epitel tek tabaka alanları ile, düzensiz bir yapıya sahiptir.

(Burada 14 tarif edildiği gibi), yukarıda tarif edildiği gibi seri bölümler, aynı zamanda immüno-floresan etiketlemesini ve konfokal mikroskopi için işlemden geçirilebilir. Şekil 2G çekirdekleri (mavi) ve hücre-hücre birleşme kısmı proteini zonula için boyanmış, daha sonra sabit ve% 100 metanol geçirgenleştirildi ve izole crypts gösterir occludens 1 (ZO-1, yeşil). Geleneksel kesit yönde, crypt ve yüzey hücre (Şekil 2G aynı anda izlenebilir (Şekil 2G) merkezinde, bir geçiş hücre popülasyonlarının seri kesit örneklerde görülebilir. Gelişmiş ZO-1 leke yüzey hücre popülasyonlarının (Şekil 2I ve J) görülür.

Çeşitli farklılaşma faktörleri kript-yüzey ekseni boyunca uzaysal bir şekilde ifade edilebilir olduğu bilinmektedir. Bu yüzey hücre popülasyonları açısından zenginleştirilmiş olduğu bilinen transkripsiyon faktörü Kruppel benzeri faktör 4 (Klf4) içerir. Geleneksel kesit yöntemleri kullanarak, Klf4 yüzeyi hücre popülasyonlarının (Şekil 2K) bakan lümeninin çekirdeğinde bulunan. Bu nedenle, Klf4 mRNA'nm temelde, yüzey hücresi popülasyonunda ifade edilir speküle etmişlerdir. Bunu test etmek için, seri kesitler toplanmış ve yüzey, geçiş ve kript-baz örneklerinin gruba ayrıldı. Subsequediğer yönden başkaları baskın, RNA, RNeasy kolonu ve DNAz muamelesi ile ek saflaştırma, standart Trizol ekstraksiyonu kullanılarak hasat edilmiştir. RNA örnek başına toplam RNA ug 5-10 arasındaki vermiştir 5 toplanmış ardışık kısmı, toplandı. Bu numuneler daha sonra Klf4 ve bir referans gen, TATA kutusu, bağlayıcı protein 1 (TBP-1) (Şekil 2 L) 14 hem de yarı-kantitatif gerçek zamanlı PCR tabi tutuldu. Şekil 2L gösterildiği gibi, TBP-1 normale döndükten sonra, yüzey hücreleri kript hücrelerde ifade edilir 8 kat Klf4 mRNA kadar ifade etmek için bulunmuştur. Benzer şekilde, Klf4 protein seviyeleri kript yüzeyi eksen boyunca mekansal düzenleme arzettiği bulunmuştur. 4 ° C'de 20 dakika süreyle liziz tamponu içinde, yukarıda tarif edilen ve daha sonra kuluçkaya yatırılır olarak seri bölümler havuzlandı. Bu örnek başına protein 200-250 mikrogram arasında vermiştir. Numuneler daha sonra, SDS-PAGE (Şekil 2 M) 15 analizler tabi tutulmuştur. Şekil 2M gösterildiği gibi, Klf4 srotein seviyeleri önemli ölçüde yüzey hücre popülasyonlarının daha yüksektir. Yukarıdaki bulgular kemirgen kolon mukozasından yüzey ve kript epitel hücrelerinin büyük miktarda izole etmek, bu protokolün yeteneğini göstermek.

Şekil 1
Şekil 1: (A) şematik gösteren fare kolon mukozası ve dış kas tabakaları. Bizim yöntemi seri cryosectioning (10 um her) tarafından ayrı yüzey hücre ve kript-baz hücre popülasyonlarının toplamayı hedefliyor. Dış kas tabakaları atılır. (B) kript yüksekliği kolon (kript-baz ve yüzey tabakalara arasındaki mesafe) uzunluğu boyunca değişir. Veri noktaları bireysel kript ölçümleri ve semboller biyolojik çoğaltır bildiren (n = 4). (C) Kolon bölümleri, toplanan ikiye, ve bir silikon diseksiyon çanak üzerine tutturulmuş. Se (d) bir dokuanüsten 3 cm kadar traş makinesi bıçaklara arasında sıkıştırılmış ve kuru buz üzerinde dondurulmuştur BÖLÜMLERE GÖRE R. (E) Doku daha sonra önceden tesviye Ekim blok üzerine monte edilir. (F) Cryosections kaldırıldı ve görsel denetlenir.

Şekil 2,
Şekil 2:. Örnek veriler dairesel muscularis (cm) gösteren enine kesitte hematoksilin-eosin ile boyandı (A), kalın bağırsak dokusunda, muscularis mukoza (mm), kript-nokta hücreleri, geçici hücre ve yüzey hücreleri. (B - C) kolon kas tabakası. (D) Crypt-baz hücreleri. Merkezi bir lümen olmadığına dikkat edin. (E) Geçiş hücreleri. (F) Yüzey hücreleri. İzole kolon kript (G) İmmünfloresan boyama. ZO-1 (yeşil) ve çekirdek (mavi) kesit olarak görülmektedir. (HI) ZO-1 ve geçiş ve yüzey hücrelerinde nükleer boyanma. (J) ZO-1 boyama büyütülmüş görünümü. (K) Klf4 (yeşil) yüzey hücre popülasyonlarında zenginleştirilmiştir. (L) üç bölmeleri arasında Klf4 mRNA seviyelerinin real-time PCR değerlendirmesi. (E) bu hücre popülasyonunda Klf4 proteini düzeylerinin Western blot analizleri.

Discussion

Kolon epitel hücre çoğalması ve farklılaşması katılan moleküler mekanizmalar tam olarak anlaşılamamıştır. Bu kolon epitel kriptlerin dibinde kök hücre bölmesinin hücresel sinyal ortamında anlayışımızda boşlukları içerir. Enterosit farklılaşmasını altında yatan süreçlerin artan bir ilgi vardır. Örneğin, in vivo farklılaşma anlayışı in vitro primer intestinal sistemleri 16 üretmeyi amaçlayan çalışmalar için bir kriter olarak gerekli arttı.

Yukarıdaki prosedür ekstra dikkat gerektiren çeşitli adımları içerir. Öncelikle, dondurulmuş doku segmentinde etrafında kenarları (bölüm 3.2'de anlatıldığı gibi) kaldırarak diseksiyon ve donma sırasında kıvrılma doku kenarları olarak gereklidir. Bu kenarları sonuçları taşımak için başarısızlık yüzeyi ve kript baz hücrelerinin karışık nüfusu. Önceden soğutulmuş, tesviye Ekim blokta doku montaj da esastır. Tonun protokolü her bir havuz bölümlerin sayısını değiştirerek distal kolon diğer alanlarda adapte edilebilir. Şekil 1B 'de gösterildiği gibi Örneğin, mukozal kript uzunluğu 150-300 um arasında değişir. Anüsten 4 cm 6 cm arasında bölgeyi incelemek Bu nedenle, bölme sayısı Önemlisi 30'a 15'e yükselmiştir gerektiğini, bu protokol proksimal kolon için tavsiye edilmez (7 cm 9 cm) nedeniyle kıvrımları ile ( Seri kesit ile ayrı yüzeyi ve kript-baz hücrelerine imkansız hale lümenine uzanan plika obliquae).

Seri kesit teknikleri kript-temel çalışma ve insanlarda epitel hücre popülasyonlarının yüzey kullanılmıştır. Ancak, bizim protokol nedeniyle fare doku küçük boyutu için gerekli olan ek adımlar ekler. Yukarıdaki protokol genetik uysal fare sistemlerinde kript tabanı ve yüzey epitel hücre popülasyonunun soruşturma sağlayacak öneriyorum. Gerçekten de, bir araya getirilmiş bölümler Yield yüksek kaliteli protein ve RNA uygun aşağı analizi. Gelecekteki uygulamalar, hücre sinyal yolları veya kromatin immunoprecipitation çalışma içerebilir. Bununla birlikte, yukarıda tarif edilen alternatif yöntemler birkaç gibi, elde edilen bölümler epitelial be interstitial lamina propriya hücrelerinin bir karışımını içeren, dikkat edilmelidir. Sonuç olarak, burada tarif edilen bir protokol murin kolon mukozası uzamsal olarak ayrı bölgelerde moleküler proseslerin analizi için hızlı, yüksek verimli bir yöntem temin etmektedir.

Materials

Name Company Catalog Number Comments
Microtome Leica Biosystems, Nussloch Germany CM 1510-3
MyiQ real time PCR detector BioRad
LSM 510  Carl Zeiss Confocal microscope
OCT Tissue-Tek, Sakura Finetek, Torrance CA 4583
cryo-mold Tissue-Tek, Sakura Finetek, Torrance CA 4557 25mmx20mmx5mm
High profile microtome blade Leica Biosystems, Nussloch germany 818
GEM industrial blades American Safety Razor Blades 62-0314
Sylgard silicon elastomere base Dow Corning, Midland MI 3097358
27 1/2 g needle Becton-Dickinson, Franklin Lakes, NJ 305109 pins for dissection
TRizol Life Technologies 15596018
Rneasy Qiagen 74104
DNAse Qiagen 79254
Antibody ZO-1 Invitrogen  187430
Antibody KLF4 Cell Signaling 4038S
Antibody mGAPDH Sigma G8795
Antibody Secondary Alexa conjugate Invitrogen A11034 488 anti-rabbit
Antibody Secondary HRP conjugate Jackson 111/115-001-003 rabbit/mouse 
Topro-3 Invitrogen T3605
HANKs balanced salt buffer Life Technologies 14025092
RIPA lysis buffer 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate
primer TBP 3' GGAATTGTACCGCAGCTTCAAA
primer TBP 5' GATGACTGCAGCAAATCGCTT
primer KLF4 3' TGTGACTATGCAGGCTGTGGCAAA
primer KLF4 5' ACAGTGGTAAGGTTTCTCGCCTGT

DOWNLOAD MATERIALS LIST

References

  1. Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
  2. Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
  3. Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
  4. Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
  5. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  6. Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
  7. Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
  8. Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
  9. Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
  10. Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
  11. Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
  12. Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. e4040 (2012).
  13. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  14. Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
  15. Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
  16. Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
Fare Kolon Mukozanın Mikrodisseksiyon için Cryosectioning Yöntemi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).More

Farkas, A. E., Gerner-Smidt, C., Lili, L., Nusrat, A., Capaldo, C. T. Cryosectioning Method for Microdissection of Murine Colonic Mucosa. J. Vis. Exp. (101), e53112, doi:10.3791/53112 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter