Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Le bm12 inductible modèle du lupus érythémateux disséminé (SLE) dans C57BL / 6

doi: 10.3791/53319 Published: November 1, 2015

Introduction

Le lupus érythémateux disséminé (SLE) est une maladie auto-immune complexe caractérisé prototypiquement par l'anticorps anti-nucléaire (ANA) et de la production glomérulonéphrite. De nombreux autres séquelles, y compris dermique, cardio-pulmonaire, et des lésions hépatiques sont associés à la maladie chez certains individus. Les estimations de prévalence aux États-Unis varient considérablement, de 1,2 150,000-1,500,000, avec incidence particulièrement élevée chez les femmes et les minorités 3. Bien que l'étiologie de la SLE a été difficile à discerner, il est pensé pour résulter de l'interaction de divers facteurs génétiques et environnementaux, qui culminent dans l'auto-immunité systémique.

De nombreux modèles animaux ont été utilisés pour étudier les facteurs menant à l'apparition et la progression de la maladie. Des modèles de souris classiques de SLE comprennent des souches de souris génétiquement prédisposées, y compris le modèle NZB x NZW F1 et ses dérivés NZM, la souche / lpr MLR, et la souche BXSB / Yaa et systèmes inductibles, tels que le pristane et la maladie chronique du greffon contre l'hôte (cGVHD) 4 modèles. Les premiers rapports de la production d'auto-anticorps dans des modèles de GVHD utilisés souches de souris différentes souches ou de hamster pour parent dans les transferts de F1 5 - 8; méthodes les plus courantes utilisées pour étudier la maladie lupique comprennent actuellement les DBA / 2 → parent (C57BL / 6 x DBA / 2) F1, et le modèle de transfert de bm12 décrit ici. Chaque modèle a ses propres mises en garde, mais ils partagent en général un ensemble commun de caractéristiques qui sont en corrélation avec des caractéristiques cliniques de la maladie humaine. Les paramètres les plus souvent rapportés chez les souris modèles comprennent une splénomégalie, lymphadénopathie, la néphrite, la production ANA, et au niveau cellulaire, l'expansion des cellules T folliculaires auxiliaires (TFH), germinales cellules centre (GC) de B et les cellules plasmatiques.

Le modèle BM12 inductible est réalisé par le transfert adoptif de lymphocytes à partir de IA BM12 B6 (C) - H2 - Ab1 BM12 / KhEgJ (BM12) chez la souris, une souche identical de souris C57BL / 6 à l'exception de 3 substitutions d'acides aminés sur le CMH de classe II, en IA b / 6 (B6) des souris C57BL. Alloactivation des donateurs cellules T CD4 par bénéficiaire APC conduit à cGVHD avec des symptômes ressemblant étroitement SLE. Plus précisément, ils comprennent l'expansion de Tfh donateurs dérivés, l'expansion des cellules B GC bénéficiaires dérivés et les cellules plasmatiques, et la production d'Anas y compris les anti-ADN double brin, anti-ADNsb, anti-chromatine, et des anticorps anti-RBC 9. Au fil du temps, les souris receveuses développent glomérulonéphrite associée à des dépôts d'IgG dans le glomérulaire, interstitielle, et les régions vasculaires des reins 10. Nous avons récemment montré que, comme dans la maladie humaine, il y a également un rôle critique pour les IFN de type I dans 11 ce modèle. Notamment, les critères de définition des SLE humaine incluent le développement de la néphrite compatible avec SLE en présence d'anticorps anti-ADN anticorps 12, qui sont tous deux traits saillants de ce modèle de souris.

Il n'y a en soisieurs avantages du modèle de bm12 sur les modèles spontanés. Modèles classiques qui développent des signes SLE spontanément reposent sur soit des souches de souris hybrides, des souches de souris consanguines pas sur le fond de B6, ou grande loci génétiques sur le fond de B6, qui font traversant au coup de grâce ou de souris autrement génétiquement modifié difficile et fastidieux. Avec le modèle inductible de bm12, des souris génétiquement modifiées peuvent servir soit donneur ou du receveur, qui permet une identification plus rapide du compartiment cellulaire dans lequel des gènes particuliers peuvent être importants pour la maladie. En outre, le développement de la maladie dans le modèle de bm12 est beaucoup plus rapide, ne nécessitant que deux semaines jusqu'à l'apparition d'Anas, contre plusieurs mois pour les modèles les plus spontanées. En outre, à la différence des modèles spontanés qui développent la maladie à différents points dans le temps, le début et la progression de la maladie dans le modèle d'→ B6 BM12 est fortement synchronisés. Cela permet la génération de cohortes de taille appropriée qui peut Be utilisé pour les stratégies d'intervention ou thérapeutiques à tout stade de développement de la maladie.

Ce qui suit est un protocole détaillé pour initier SLE auto-immunité par le transfert adoptif de lymphocytes BM12 dans souris C57BL / 6, ou des variantes génétiques sur le fond de B6. En outre, nous décrivons un protocole de coloration par cytométrie de flux pour dénombrer Tfh, GC cellules B, les cellules plasmatiques et les types de cellules associées à la maladie humaine. Fait important, ces protocoles peuvent également être utilisés pour caractériser la plupart des maladies dans les modèles murins de lupus et identifier Tfh, les cellules B GC et les cellules plasmatiques dans d'autres modèles de maladie.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Travaux d'animaux a été réalisée dans des conditions exemptes d'organismes pathogènes spécifiques conformément aux lignes directrices établies par l'Association pour l'évaluation et l'accréditation des animaux de laboratoire Care International et notre institutionnel de protection des animaux et l'utilisation Comité (IACUC).

NOTE: Incorporer des souris exprimant un marqueur congéniques CD45.1 tels que le donateur ou animaux receveurs si possible, car cela permet à la surveillance de l'efficacité de greffon du donneur et l'expansion spécifique de la population T CD4 de la cellule donneuse. Si vous envisagez l'utilisation de souris génétiquement modifiées autrement que donneurs ou des receveurs, assurer la souche est correctement rétrocroisé à l'arrière-plan de B6, ou cellules transférées peut être rejetée-ce sera abordée plus en détail dans les sections des résultats représentatifs et de discussion.

REMARQUE: Les procédures volumes suivants de détail pour la récolte 4 donateurs bm12 souris, qui devrait produire suffisamment de cellules pour injecter 12-16 souris. Sixà douze souris BM12 semaine-vieille produirait environ 100 à 140000000 lymphocytes avec environ 25% des cellules T CD4. Si le démarrage avec des nombres différents de souris, ou des souches de souris différentes, les volumes à l'échelle vers le haut ou vers le bas en conséquence. C57BL / 6 donnent généralement des rendements similaires avec près de 20% seulement des cellules T CD4.

REMARQUE: Effectuez toutes les étapes à la température ambiante et utiliser les médias RT pour éviter un choc de chaleur et de froid, qui peut nuire à la viabilité des lymphocytes à long terme. Effectuer tissu-récolte et des mesures de traitement des tissus dans une hotte de culture tissulaire en utilisant une technique aseptique. Tous les médias de ce protocole est IMDM avec 10% de FBS inactivé à la chaleur, sauf indication contraire, et sera appelée simplement "des milieux complets."

1. nouvelle méthode pour le génotypage bm12 Souris

REMARQUE: Un protocole basé sur digest brève restriction pour le génotypage est fourni ici, comme une alternative simple et peu coûteux de séquençage, qui est actuellement la seule méthode de génotypage publiépour ces souris.

  1. Isoler l'ADN génomique à partir de queues de souris. S'il vous plaît se référer à un article précédent JoVE pour les protocoles détaillés sur queue de souris écrêtage et la génération de l'ADNc de la queue digère 13.
  2. Effectuer une réaction en chaîne de polymérisation de la transcriptase inverse (PCR) 14 pour amplifier un fragment d'ADN de 474 pb commune du CMH-II b IA et IA bm12 utilisant des amorces et des conditions de thermocyclage énumérés dans le tableau 1.
  3. Effectuer digestion de restriction sur ~ 7 pl du produit PCR en utilisant l'enzyme PsuI, ou un de ses isoschizomères (BstX2I, BstYI, MflI ou XhoII), qui coupe IA b type sauvage, mais pas IA bm12 mutant. Suivre digérer protocole fourni par le fabricant, qui détermine un mélange d'eau, un tampon et de l'enzyme, et une incubation de 5 min. à plusieurs heures à 37 15 ° C.
  4. Chargez digérer produit et courir sur gel de polyacrylamide de 1% avec du bromure d'éthidium 14 pendant 30-45 min. au 150V-si paramètres de tension et de temps optimales varient en fonction de l'appareil de PCR gel utilisé. Visualiser les bandes d'ADN avec un illuminateur UV. Les résultats représentatifs sont présentés sur la figure 1.

Figure 1
Figure 1. Représentant bm12 résultats du génotypage.
Pour identifier les souris homozygotes pour IA bm12 / BM12, l'ADN de queue a été criblée pour bm12 par PCR / restriction digérer génotypage (étape 1). Type sauvage homozygote (IA b / b) l'ADN donne deux bandes à 227 et 247 pb (visualisés comme une bande épaisse à ~ 250 pb); bm12 homozygote (IA bm12 / BM12) rendements d'ADN d'une bande à 474 pb; et hétérozygote (IA bm12 / b) l'ADN donne deux bandes à ~ 250 et 474 pb. S'il vous plaît cliquez ici pour voir une version plus grande de cette figure.

2. récolte donateursCellules

  1. Souris Sacrifice donateurs utilisant institutionnel de protection des animaux et l'utilisation Comité (IACUC) CSEh méthodes d'euthanasie primaires et secondaires. Par exemple, des souris euthanasie par asphyxie au CO2, suivie par dislocation cervicale.
  2. En utilisant une technique aseptique, les rates de récolte et les ganglions lymphatiques (cervical superficiel, mandibulaire, brachiale, axillaires, mésentériques, et inguinal) en tubes de 15 ml contenant 10 ml de milieu complet en tant que 11 à 13.
    REMARQUE: Se reporter aux rapports précédents pour les protocoles noeud de dissection lymphatiques détaillée 16 - 18. Ce modèle est également réussie en utilisant des splénocytes de souris seulement pour le transfert, mais l'ajout de ganglions lymphatiques réduit de manière significative le nombre requis de souris donneuses.
  3. Générer une suspension monocellulaire en écrasant les tissus lymphoïdes collectés à l'étape 2.2 à 70 um tamis de cellules en utilisant le piston d'une seringue. Pour de meilleurs rendements, ne surchargez pas les crépines d'utilisation ~ 6 passoires pour toutes les 4souris traitées, et rincer crépines fréquemment pendant le traitement. Combinez les tissus à partir de 4 souris en deux tubes de 50 ml coniques, puis centrifuger les cellules pendant 5 min à 400 g et décanter le surnageant.
  4. Resuspendre les cellules des deux tubes coniques de 50 ml de médias complètes et transfert à nouveau tube conique. Gardez ce tube à température ambiante.
    REMARQUE: Fat adhère aux parois du tube, et si le tube est pas remplacé, les rendements cellulaires finales peut souffrir.

3. donateurs Décompte Cellulaire

NOTE: Pour préserver la viabilité lyse plus élevé, de globules rouges (RBC) de l'ensemble de l'échantillon est déconseillée.

  1. Mélanger suspension cellulaire unique de l'étape 2.4 ainsi, retirer 1 ml et le transférer à un 50 ml conique séparée. Mettez de côté restant, des cellules intactes (49 ml) à la température ambiante tout en comptant.
  2. Ajouter 3 ml d'un tampon de lyse des cellules de sang rouge à base de chlorure d'ammonium dans l'échantillon de 1 ml de cellules du donneur. Mélanger doucement pendant 1 min. en basculant, puis remplissez à 50 ml avec un milieu complet, une centrifuger pendant 5 min. à 400 g et le surnageant décanter.
  3. Resuspendre les cellules RBC-lysée dans 10 ml de médias complètes et compter (par exemple, avec du bleu trypan en utilisant un hémocytomètre). Multiplier le résultat par 49, tel est le nombre total de cellules restantes dans l'échantillon non-lysées qui a été mis de côté. Jeter cellules RBC-lysée.

4. donateurs cellulaire étiquetage et / ou de cellules T CD4 Purification

  1. Si vous le souhaitez, de purifier les cellules T CD4 à ce stade, bien que ce soit pas nécessaire. En outre, si on le souhaite, les cellules de l'étiquette avec CFSE, comme en 19, ou d'autres colorants de repérage de la cellule, dont un exemple est représenté sur la Figure 4 de la section des résultats représentatifs.
    NOTE: Pour la purification de cellules T CD4, la sélection magnétique négatif est recommandée, car elle peut atteindre une haute pureté et laisse intactes les cellules avec une viabilité élevée comme décrit dans 20. Il est important que les tampons exempt d'endotoxine sont utilisés; Par conséquent, au lieu de BSA, faire la séparation esprit tamponh 2% de FBS et de la concentration recommandée de l'EDTA.

5. L'injection de cellules de donneurs BM12

  1. Après avoir compté les lymphocytes du donneur à l'étape 3 (et purifiés ou étiquetés comme à l'étape 4, comme on le souhaite), les cellules de centrifugation pendant 5 min à 400 x g. Décanter cellules surnageant et remettre en PBS à 120 millions de lymphocytes par ml (ou 30 millions de cellules T CD4 purifiés par ml). Cellules de transfert à un stériles 5 ml de tubes à fond rond, ou autre tube stérile qui peut accueillir facilement une seringue de 1 ml munie d'une aiguille 13 x 27,5 mm. G
  2. Avant l'injection, mis de côté un petit échantillon de cellules du donneur de l'étape 5.1 à 4 ° C pour la coloration de flux pour déterminer le pourcentage de cellules T CD4 dans les échantillons de donneurs. Colorer ces échantillons comme décrit dans l'étape 8 à l'aide du panneau d'anticorps minimal (tableau 2).
    NOTE: Si les cellules de différentes souches de souris sont utilisés comme donneurs distincts, cela est une considération importante, et si les pourcentages de cellules T CD4 varient sensiblement, PURification peut être nécessaire.
  3. Mélanger doucement les cellules, mais complètement. Cela peut être fait par pipetage de haut en bas des cellules en utilisant une seringue de 1 ml sans aiguille attachée. Après le mélange, aspirez cellules dans la seringue de 1 ml. Fixer l'aiguille après avoir enlevé les bulles d'air. Garder l'aiguille hors tout en amorçant la seringue permet de maintenir la viabilité des cellules.
  4. Injecter 250 ul par souris (qui est égale à 30 millions de lymphocytes, ou de 7,5 million de cellules T CD4 purifiés par souris) par voie intraperitoneale, comme décrit dans 21.
    NOTE: Dans les expériences présentées ici et dans notre travail avant 11, chaque souris est injecté avec 30 millions de lymphocytes totaux de BM12 donateurs, plutôt que les 100 millions de splénocytes totaux traditionnellement utilisés. En données non publiées de notre laboratoire, aucune différence n'a été observée dans le sérum anti-ADN double brin au jour 14 après des injections de 30 ou 100 millions de lymphocytes par souris. Bien que cela réduit considérablement le nombre de souris nécessaires pour des expériences, le développement de la néphrite esprith ce nombre de cellules n'a pas été évaluée.

6. Déterminer efficacité de greffage

NOTE 1: Cette section décrit comment déterminer le degré de greffage de cellule donneuse chez le receveur au jour 3 afin d'identifier toutes les souris qui peuvent avoir reçu des injections sous-optimales (par exemple, la greffe chez une souris est <10% de celle observée dans toutes les autres souris du même groupe). Ces données peuvent également aider à déterminer si des cellules d'une souche de souris génétiquement modifiées sont rejetés aux points de temps plus tard (pour plus de détails, voir la section des résultats représentatifs, figure 6).

NOTE 2: Cette section est seulement possible si les donateurs et les bénéficiaires sont de souris sur les différents milieux congéniques, par exemple, lorsque vous utilisez les donateurs CD45.1 BM12 et CD45.2 C57BL / 6 destinataires, ou lorsque les cellules du donneur sont marqués avec un colorant de suivi de la cellule. Surtout, à 3 jours après l'injection, les cellules T CD4 ont connu une expansion minime (SEe représentant la section des résultats, Figure 4), de sorte différences observées dans les taux de greffage sont dues à la variabilité des injections, sans expansion.

  1. Anesthésier la souris avec 4% d'isoflurane ou autre méthode IACUC approuvé. Testez réflexes du pied arrière pour assurer la souris est correctement anesthésiés avant de procéder à la prise de sang.
  2. Récolte sang 100-200 pi en utilisant une méthode IACUC approuvé, comme la ponction rétro-orbitaire comme dans 22. Prélever le sang dans individuels 0,5 ml microtubes contenant un anti-coagulant, tels que les tubes de collecte de plasma référencés dans la table des matières, qui contiennent dipotassique lyophilisé EDTA. Après la collecte de sang, appliquer une légère pression à l'œil de la souris en utilisant une serviette stérile ou de gaze pour assurer l'arrêt du saignement, puis placez la souris en arrière dans sa cage où il restera jusqu'à la récolte finale de tissu (étape 7).
    REMARQUE: Ne laissez pas la souris sans surveillance jusqu'à ce que les souris ont repris conscience suffisante pourdécubitus ventral maintenir, et ne pas remettre les souris à la compagnie des autres jusqu'à guérison complète.
  3. Amener le volume de sang à 500 ul avec 21 ° C PBS et transfert à microtube conique-bas, puis underlay lentement 200 pi de 21 ° C la solution de séparation de cellules à haute densité avec un pl pipette 200, en prenant soin de minimiser le mélange entre les deux phases ( voir le tableau des matériaux pour les solutions recommandées). Centrifuger les cellules à 700 g pendant 20 min à 20-25 ° C avec frein de la centrifugeuse réglé trop bas.
  4. Retirer la couche supérieure contenant des lymphocytes avec une pipette de 1 ml et transférer dans un nouveau tube contenant 800 ul milieu complet froid. Vortexer doucement pour mélanger les cellules. Centrifuger les cellules à 700 g pendant 5 min à 4 ° C et le surnageant décanter.
  5. Resuspendre les cellules dans 200 pi de milieu complet, transfert à une plaque de 96 puits à fond en U, et détachants pour cytométrie de flux comme décrit à l'étape 8 en utilisant un panel d'anticorps minime (tableau 2) pour déterminer til abondance relative de la greffe de lymphocytes T CD4 en tant que pourcentage de cellules PBMC.

7. Récolte finale en tissu

REMARQUE: Les expériences décrites dans la section des résultats ont été récoltées 14 jours après l'injection de cellules du donneur (ou dans certains cas, moins de temps), car ils se concentrent sur le développement initial de cellules TFH et les cellules plasmatiques; Toutefois, étant donné que ce modèle est un modèle de GVHD chronique du SLE, de la maladie peut être contrôlée à des instants plus tard. Le délai optimal dépendra de la question de recherche posée dans chaque expérience.

  1. A un moment prédéterminé après l'injection de cellules du donneur BM12 (étape 5.4), sacrifier la souris utilisant un méthode d'euthanasie IACUC approuvé. Asphyxie au CO 2 suivie par exsanguination est recommandé. La dislocation cervicale peut fonctionner comme une méthode secondaire de l'euthanasie, mais cela peut réduire le rendement de prélèvement de sang.
  2. Mouillez l'abdomen de la souris légèrement avec un vaporisateur contenant 70%l'éthanol. Faire une petite incision superficielle avec des ciseaux chirurgicaux environ 1 cm au-dessus des organes génitaux. Reculer la peau de l'abdomen vers le sternum, en prenant soin de garder le fascia péritonéale intacte.
    REMARQUE: les souris malades présentent habituellement 0,5-3 ml ascite au jour 14, qui, même si elle n'a pas encore été bien caractérisée, peuvent être mesurés et analysés en tant que paramètre de la maladie supplémentaire.
  3. Monter une seringue de 5 ml avec une aiguille de 18 G. Insérez l'aiguille dans le quadrant inférieur droit de l'abdomen avec l'aiguille dirigée vers le haut vers la tête de l'animal et à l'angle de 15 ° par rapport au plan de l'aponévrose. Positionner la pointe de l'aiguille à proximité du cæcum pour aider à prévenir l'aiguille ne se bouche intestin tout en aspirant ascite.
  4. Tournez délicatement la souris sur le côté, puis dessiner lentement ascite dans la seringue. Une fois que l'ascite a été récupéré, enlever la seringue et d'enregistrer le volume d'aspiration, sur la base des marquages ​​de volumétrie sur le côté de la SyriESN.
  5. Ascite de rejet dans un tube à fond rond de 5 ml et conserver dans la glace pour un traitement ultérieur.
  6. Récolte par tirage au sang de la veine cave inférieure (VCI) essentiellement comme dans 22. En utilisant des pinces ternes, déplacez doucement les intestins sur le côté gauche de la souris, en découvrant la VCI. Insérez une aiguille de 27,5 G monté sur une seringue de 1 ml dans la veine cave inférieure et tirer lentement 400-500 pi de sang.
  7. Pour minimiser l'hémolyse, injecter lentement sang dans un tube de 0,5 ml de sérum à centrifuger ou collecte de plasma. Pour l'analyse du sérum tard d'Anas par ELISA, empêcher le sang sur la glace.
  8. Disséquer et d'obtenir plus pertinents tissus (rate et, si désiré, les ganglions lymphatiques et les reins, en particulier si la collecte des points et glomérulonéphrite de temps plus tard, sera marqué). Retirer la rate en plaçant délicatement les intestins en arrière vers le côté droit de l'animal, et en tirant sur le pancréas, qui est le tissu conjonctif primaire de la rate.
  9. Retirez tout le pancréas restant, puis peserrates sur une balance de haute précision immédiatement après la dissection, comme splénomégalie brute est un paramètre fréquemment rapportés dans des modèles murins de lupus érythémateux disséminé. Placez les tissus lymphoïdes dans individuels 1,5 ml tubes remplis avec 1 ml milieu complet sur la glace. Fixer reins dans 10% du formol tamponné neutre ou snap geler les reins pour l'histologie tard que dans 23.
  10. Centrifugeuse de sang dans les 2 heures de la collecte pendant 3 min. 10 000 xg à 4 ° C (). Retirer le sérum et conserver à -80 ° C pour une analyse ultérieure de l'ANA par ELISA. Reportez-vous aux rapports précédents pour les protocoles détaillés Ana Elisa 24,25. Conserver le sérum dans de multiples 10-20 aliquotes pour minimiser les cycles de gel / dégel, et permettre à un plus grand nombre de tests futurs.
  11. Centrifugeuse ascite 400 xg pendant 5 min. Retirer le surnageant avec une pipette de 1 ml et aliquote dans plusieurs tubes 0,5 ml. Congeler le surnageant à -80 ° C pour des analyses ultérieures d'anticorps anti-nucléaires (Anas) ou d'autres médiateurs inflammatoires solubles.
  12. Fract cellulaire Resuspendre ION à environ 1 ml de milieu complet et transférer 200 pl sur une plaque à 96 puits à fond en U pour la coloration d'écoulement (comme à l'étape 8).
  13. Écraser chaque rate à travers 70 um crépines de cellules dans des tubes séparés et rincer avec les médias complets. Remettre en suspension les splénocytes avec 1 ml de tampon de lyse RBC froid pendant 1 min. et mélanger doucement à bascule. Amener le volume à 10 ml avec un milieu complet froid et centrifuger pendant 5 min à 400 g et décanter le surnageant.
  14. Culot cellulaire Remettre en suspension dans 5 ml de milieu complet et compte en utilisant un hémocytomètre. Régler le volume de telle sorte que 200 pi de milieu complet contient 1-3 millions de cellules. Commencer la coloration pour la cytométrie de flux (étape 8) au moyen d'un panneau d'extension (tableau 2) pour quantifier la différenciation des donateurs CD4 des cellules T et des cellules B et destinataire expansion.
    REMARQUE: Selon ce laser, tubes photomultiplicateurs (PMT), et de jeux de filtres combinaisons sont disponibles, en séparant le panneau d'analyse de cellules T et B en plusieurs panneaux peut être nécessaire.
ve_title "> 8. La coloration de débit

  1. Transfert 1-3 millions splénocytes dans 200 pi milieu complet dans différents tubes de 5 ml à fond rond, ou dans des puits individuels d'une plaque de 96 puits à fond en U.
    NOTE: L'utilisation d'une plaque de 96 puits est un moyen efficace pour colorer plusieurs échantillons, mais prenez garde à l'assiette des échantillons dans tous les autres puits afin de prévenir la contamination croisée. Une plaque de 96 puits peut donc contenir 24 échantillons.
  2. Plaque de centrifuger à 500 g pendant 3 min., Puis surnageant film de plaque dans (Biohazard) récipient approprié.
  3. Remettre en suspension les culots cellulaires avec 100 ul de tampon d'écoulement (1% de FBS dans du PBS) contenant un colorant de viabilité peut être fixé à la concentration recommandée par le fabricant et purifié anti-CD16 / anti-CD32 antibody cocktail à 1 ug / ml. Incuber pendant 10 min à 20-25 ° C, puis ajouter 100 pi de milieu complet froides pour étancher la viabilité colorant.
    REMARQUE: splénocytes de souris malades contiennent généralement un nombre relativement élevé de cellules mortes ou mourantes;Par conséquent, l'inclusion d'un colorant de viabilité est recommandé d'éviter l'étiquetage des anticorps non-spécifique de cellules qui meurent, entraînant propres données, plus fiables. De même, le cocktail anti-CD16 / anti-CD32 est inclus pour bloquer anticorps marqué par fluorescence liaison non spécifique par les récepteurs Fc.
  4. Plaque de centrifuger à 500 g pendant 3 min., Puis surnageant film de la plaque en container prévu. Resuspendre les cellules dans 200 pi de tampon de flux. Plaque de centrifuger à 500 g pendant 3 min., Puis surnageant film de la plaque en container prévu.
  5. Resuspendre les cellules dans du tampon de flux 50 ul contenant un cocktail d'anticorps (Tableau 2). Incuber pendant 20 min à 4 ° C, puis ajouter 150 tampon de flux de pi. Répétez l'étape de lavage 8.4.
  6. Resuspendre les cellules avec 100 pi de paraformaldehyde à 2% dans du PBS. Incuber pendant 30 min à 4 ° C, puis ajouter tampon de 100 flux de pl. Plaque de centrifuger à 500 g pendant 3 min., Puis surnageant film de la plaque en container prévu.
  7. Resuspee dans 200 tampon de flux ul, transférer à l'écoulement des inserts ou des tubes d'écoulement standard, ajouter un tampon de flux 100-200 pi supplémentaires, et conserver à 4 ° C dans l'obscurité jusqu'à l'acquisition sur cytomètre de flux.
  8. Acquérir sur un cytomètre de flux équipé avec les lasers et PMT appropriées pour les panneaux d'anticorps choisis au sein de plusieurs jours de coloration. Enregistrement Avance largeur et / ou la hauteur de dispersion, en plus de transmettre la zone de dispersion, zone de dispersion latérale, et la surface des paramètres fluorescentes utilisées. Pour des résultats fiables, acquérir ≥1,000 cellules du donneur dans chaque échantillon WT, ou un nombre équivalent de lymphocytes totaux chez les souris manipulées génétiquement modifiés ou non qui montrent l'expansion minimale de cellules du donneur, où la collecte de tant d'événements peut ne pas être faisable.
    NOTE: La cytométrie en flux analyses sont décrits en détail dans la section des résultats représentatifs (figures 3 - 6).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Souris malades développent une splénomégalie en aussi peu que 14 jours, présentant les rates 2-3 fois la taille de souris saines en termes de masse et de la cellularité (Figure 2).

Les splénocytes sont séquentiellement débloqué diffusion de la lumière (FSC-A par SSC-A), l'élimination des doublets (FSC-W ou -H par le FSC-A), les cellules viables (faible coloration de la viabilité colorant) et CD4 + TCRβ + (Figure 3A). Les cellules donneuses sont distingués des cellules receveuses basé sur CD45.1 et CD45.2 (figure 3B, en bas à gauche). Les cellules donneuses adoptent essentiellement un T helper folliculaire (Tfh) phénotype cellulaire, caractérisé en ce que la régulation à la hausse de PD-1, CXCR5, Bcl-6, et ICOS (figure 3B, C). Une partie de la population de lymphocytes T CD4 cellule receveuse différencie également en Tfh (figure 3B, en bas à droite). Après un die-off initiale et / ou la migration des cellules transférées, l'expansion de Tfh donateurs dérivé est logarithmique, rENSEIGNEMENT 10-20 millions de cellules dans les rates de souris 14 jours après l'injection (Figure 3D).

CFSE-étiquetage des lymphocytes transférés démontré que les cellules T CD4 donateurs se différencient en Tfh tôt après activation; essentiellement toutes les cellules divisées observés aux jours 3, 7 et 14 régulés à la hausse CXCR5 et PD-1 (Figure 4). Les profils de pointe de la prolifération suggèrent également qu'un pourcentage relativement faible de cellules T CD4 donateurs subi alloactivation et la division. Au jour 14, la plupart des cellules du donneur détectables sont ceux qui ont divisé au-delà du nombre maximum de divisions mesurables par CFSE.

L'expansion de Tfh donateurs dérivé est accompagné d'une accumulation correspondant des cellules B GC endogène et des cellules plasmatiques (Figure 5A). L'accumulation de cellules de plasma dans la rate est retardée par rapport à celle de Tfh, ne présentant aucune augmentation par rapport à jour sur les animaux naïfs 3 ou 7 (figure 5B). Accordicivile intéressent, des anticorps anti-nucléaires ne sont pas facilement détectables avant 9 jours (données non présentées), mais peuvent être quantifiées de façon fiable sur 14 jours 11.

Grâce à l'utilisation de marqueurs congéniques, nous avons observé le rejet des cellules de donneurs dans de multiples souches. Bien que ce soit un problème commun lorsque les souris ne sont pas suffisamment rétrocroisées C57BL / 6 fond, nous avons également observé le rejet lorsque les cellules BM12 ont été transférés dans un B6.PL- Thy1 / CYJ (CD90.1) les souris qui sont généralement considérés comme pleinement rétrocroisés. Par conséquent, les souris sont régulièrement projetés à jour ~ 3 par des échantillons de sang de coloration de flux pour évaluer l'efficacité de la greffe initiale de lymphocytes T CD4; nous savons à partir d'expériences CFSE de prolifération qui greffés cellules ont élargi très peu à ce point de temps au début. Ces résultats sont ensuite comparés aux résultats obtenus à partir de la récolte de 14 jours. Dans un exemple cas de rejet, les 30 millions de CD45.1 + BM12 lymphocytes ont été transférés dans Cardif - / - Souris qui avaient été rétrocroisées de souris C57BL / 6 pendant 12 générations. Au jour 5, toutes les souris affichent greffage équivalent (2-3% de lymphocytes T CD4 circulants), mais par 14 jour, BM12 cellules donneuses ont été complètement éliminés du destinataire génétiquement modifié (figure 6).

Figure 2
Figure 2. cinétique de croissance de la rate après l'injection de lymphocytes BM12. Rates ont été pesés sur une balance de haute précision directement après l'excision (à gauche). Les nombres de cellules vivantes ont été déterminés par comptage avec un hémocytomètre en utilisant du bleu trypan pour exclure les cellules mortes (à droite). Les résultats sont représentés en moyenne ± SEM, où n = 9, 4, 3, et 6, respectivement. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

jpg "/>
Figure 3. Analyse de l'expansion des cellules T helper folliculaire dans le modèle BM12 de SLE. CD45.1 + BM12 lymphocytes ont été transférés dans des souris C57BL / 6 destinataires et les rates ont été analysées 14 jours plus tard. (A) la stratégie de déclenchement Représentant montrant "lymphocytes" (premier panneau), "cellules individuelles" (deuxième panneau), «cellules vivantes» (troisième panneau), et de "cellules T CD4" (quatrième panneau). (B) Les cellules donneuses sont distingués des bénéficiaires cellules T CD4 par CD45.1 et CD45.2 coloration et analysés pour l'expression de PD-1 et CXCR5. Des cellules (C) de donneurs adoptent Tfh phénotype, comme indiqué par la régulation à la hausse de plusieurs protéines communément associés à Tfh. (D) Les résultats typiques montrant l'expansion de Tfh donateurs dérivé (défini comme CD4 + CD45.1 + PD-1 + cellules vivantes CXCR5 +) aux jours 3, 7 et 14 après le transfert. Les résultats sont représentés uns moyenne ± SEM, n = 5, 4, 3, et 6, respectivement. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 4
Figure 4. PD-1 sont régulés à la hausse et CXCR5 sur les cellules en division. BM12 cellules ont été marquées avec CFSE avant l'injection dans des souris C57BL / 6 destinataires. Parcelles de flux représentatifs sont présentés pour les cellules T CD4 donateurs à 3, 7 et 14 jours après l'injection. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 5
Figure 5. Expansion des cellules plasmatiques et les cellules spléniques GC B. (A) représentatifs parcelles d'écoulement de la rate de souris naïves, ou ceux dessouris 14 jours après CD45.1 + bm12 transfert. Les cellules plasmatiques sont définis comme CD138 + CD19 faibles cellules vivantes (top panneaux). GC cellules B sont un sous-ensemble de cellules B CD19 +, qui expriment GL-7 et FAS (panneaux inférieurs). Données (B) Quantitave montrant l'accumulation de plasmocytes spléniques au fil du temps. Les résultats sont représentés en moyenne ± SEM, n = 5, 4, 3, et 6, respectivement. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 6
Figure 6. BM12 greffes sont rejetées par certains des souris receveuses génétiquement modifiés. CD45.1 + BM12 lymphocytes ont été transférés soit dans des souris génétiquement modifiées (top panneaux) ou / 6 (panneaux inférieurs) souris receveuses C57BL. Souris ont été saignées à post-injection de 5 jours et évaluées pour l'efficacité de la greffe. Splénocytes à partir des mêmes souris ont été analysés 14 jours plus tard. S'il vous plaît cliquez ici pour voir une version plus grande de cette figure.

Nom Primer Séquence (5 '- 3') Température recuit
Bm12F CGTGGTCCCCGCTGTCCCCC * 65 ° C
Bm12R GGGCAGAGGGCAGAGGTGAG
Segment Nombre de cycles Température Durée
1 1 95 ° C 2 min.
2 40 95 ° C 15 sec.
* 65 à 0,5 ° C / étape 15 sec.
72 ° C 45 sec.
3 1 72 ° C 10 min.

Tableau 1:. Les amorces et les conditions de thermocyclage pour le génotypage BM12 conditions de thermocyclage optimale dépendra des réactifs exactes et les instruments utilisés. Ces conditions ont été optimisés pour un thermocycleur capable de changer la température de recuit à chaque étape, si le protocole peut également fonctionner avec une température de recuit statique.

Tableau 2
Tableau 2:. Panneaux anticorps pour splénique Tfh, GC B et l'identification de cellules de plasma par cytométrie de flux présentés sont des panneaux, nous avons utilisé avec succèspour évaluer l'efficacité de la greffe au jour 3 (à gauche) et l'analyse des cellules T et B au jour 14 après bm12 injection de cellules (au milieu). Ceux-ci ont été optimisés pour une LSRII avec 5 lasers (355, 405, 488, 561 et 640 nm). Jeux de filtres recommandés pour chaque fluorochrome sont listés (à droite), si ceux-ci peuvent ne pas être la meilleure option pour chaque machine. Selon ce laser, PMT, et les combinaisons de jeux de filtres sont disponibles, en séparant le panneau d'analyse de cellules T et B en plusieurs panneaux peut être nécessaire.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Le modèle inductible de BM12 est un moyen relativement simple et efficace pour étudier les processus cellulaires et moléculaires de SLE. L'activation chronique des cellules T CD4 par transfert adoptif dirigés contre les antigènes du soi conduit à l'accumulation de Tfh, GC cellules B, les cellules plasmatiques et qui peut être mesurée par cytométrie en flux, comme décrit ici. Les futures études utilisant ce modèle peut rapidement et facilement interroger le rôle des gènes candidats et de nouvelles thérapies dans les processus de centre germinatif auto-immunes qui ressemblent à ceux observés chez les patients atteints de LED, et, finalement, régissent l'accumulation pathologique d'auto-anticorps. En outre, l'analyse par cytométrie de flux décrit ici peut être utilisé pour étudier des modèles de souris supplémentaires qui impliquent le développement d'immunoglobulines, y compris, mais ne se limite pas à l'auto-immunité, une infection, et l'allergie.

Comme tous les modèles animaux de la maladie humaine, ce modèle a aussi ses limites. Compte tenu de la rapidité avec laquelle la maladie develops et son ampleur, tous les gènes impliqués dans le développement de LED ne sont pas susceptibles d'être nécessaires pour pouvoir pathogène dans ce modèle. En outre, des précautions doivent être prises afin d'éliminer le rejet de greffe lorsque les données suggèrent l'expansion minimale de Tfh chez les receveurs génétiquement modifiés. Congéniques marqueurs doivent être utilisés pour confirmer la présence de cellules du donneur à la récolte d'autant plus que les cellules réceptrices peuvent également se différencier en Tfh (figure 3B), qui, autrement, pourraient masquer l'absence de cellules du donneur. En utilisant des marqueurs congéniques, nous avons observé une élimination complète des cellules du donneur qui hébergeaient évidemment antigènes de rejet par jour 14 (Figure 6). Nous avons utilisé avec succès CD45.1 + BM12 et BM12 CD45.2 + souris en tant que donateurs, et CD45.1 + BoyJ (B6.SJL- PTPRC un pepC b / BoyJ) et CD45.2 + souris C57BL / 6 en tant que bénéficiaires (figures 3, 6, 7, et des données non publiées). Cependant, de type sauvage congéniqueCD90.1 + cellules de la B6.PL- Thy1 une souche de souris / CYJ ne se greffent pas bien, ni ne CD90.2 + BM12 cellules du greffon bien dans un CD90.1 + bénéficiaires (données non publiées), un phénomène qui est évidemment pas unique à ce modèle 26.

Soit C57BL / 6 ou BM12 souris peuvent servir de donneur ou le receveur, comme initialement rapporté par Morris et al. 9 Cependant, dans notre laboratoire, nous trouvons le transfert de cellules BM12 dans des souris B6 produit expansion plus cohérente des lymphocytes T et des cellules B populations à jour 14. En outre, donateurs et bénéficiaires souris de différents groupes devraient être du sexe et du même âge. Bien que les expériences rapportées dans la première description du modèle bm12 trouvé aucune différence significative dans tous les paramètres de la maladie entre les hommes → mâles et femelles transferts femmes → 9, → transferts femmes hommes ne sont pas conseillés, comme antigène mâle (HY) exprimés par les cellules T CD4 transférés peut induire greffe Rejection dans 27 femmes bénéficiaires.

Lors du choix d'anticorps et pour les marqueurs fluorochromes congéniques, il convient de noter que les cellules de donneurs deviennent positifs pour le marqueur de congénique bénéficiaire à des degrés divers, tels qu'un CD45.2 - porte ne constituerait pas l'ensemble CD45.1 + greffe. Le phénomène est clairement illustré dans une comparaison de l'expression de CD45.2 par CD45.1 + naïfs, CD45.1 + donateur, et CD45.2 + lymphocytes T CD4 bénéficiaires (figure 7). Notamment, les cellules du donneur semblent également réguler positivement l'expression de leur propre marqueur congéniques, par rapport aux témoins naïfs (figure 7). Des résultats similaires sont également observées avec CD45.2 + bm12 transfert dans des souris CD45.1 + BoyJ (données non présentées). Vraisemblablement, l'acquisition des résultats de CD45 bénéficiaire de trogocytose 28 par les cellules T CD4 activées suit interactions avec les cellules destinataire B répété. En fait, le mode BM12l peut se révéler un outil utile pour étudier le processus de trogocytose in vivo.

Figure 7
Figure 7. Les cellules donneuses acquérir destinataire CD45 marqueur congénique. CD45.1 + BM12 lymphocytes ont été transférés dans CD45.2 + C57BL / 6 destinataires. Donneurs, des receveurs, et naïf (CD45.1 +) des lymphocytes T CD4 sont évalués pour CD45.1 et d'expression de CD45.2 14 jours après le transfert. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Il a été montré que le transfert de cellules T CD4 purifiés BM12 dans des souris C57BL / 7 souris est suffisante pour amorcer la 29 maladie; cependant, la maladie se développe lorsque les lymphocytes équivalent entiers sont transférées, et la purification ne doit pas nécessairement pour étudier la dépendance à la maladie sur T thisll-intrinsèque expression génique. Eisenberg et ses collaborateurs, ont montré clairement que la cellule productrice d'anticorps dans le modèle BM12 est presque exclusivement d'origine de destination 30. En outre, l'exigence de bénéficiaires cellules T CD4 10 est limitée à la "nourricière" de cellules B au cours de leur développement, qui peut être compensée par l'addition exogène d'IL-4 31, bien que nos données indiquent que le destinataire lymphocytes T peuvent participer un peu dans la réponse du centre germinatif, comme certains d'entre eux ne développent un phénotype Tfh (figure 3B, en bas à droite).

Une décision cruciale qui doit être faite pour chaque expérience bm12 est quand récolter des tissus pour des analyses. Bien sûr, la décision dépend exactement quels facteurs sont importants pour l'étude en cours, qui peut varier. Les expériences décrites ici prennent jusqu'à 14 jours, car ils se concentrent sur le développement initial de cellules TFH et les cellules plasmatiques; Toutefois, étant donné que ce modèle est une maladie chroniqueModèle de GVHD de SLE, la maladie peut être contrôlée beaucoup plus longtemps. En fait, certaines caractéristiques cliniques de SLE, y compris la glomérulonéphrite, développer plus tard. La protéinurie a été détecté au plus tôt deux semaines après l'injection, mais atteignent leur pic à 4-8 semaines après l'injection 10,31. En outre, la cytométrie de flux décrit ci-analyses ont été optimisées pour des expériences de 2 semaines. Nous trouvons un nombre considérable de cellules GC B et les cellules plasmatiques à ce point de temps; bien que, en raison du temps supplémentaire, un grand pourcentage des cellules plasmatiques sécrétant ANA peut résider dans la moelle osseuse 32. En outre, les cellules plasmatiques identifiés par ce groupe de coloration de flux probables comprennent également plasmoblastes-afin de distinguer entre ces deux types de cellules, des anticorps supplémentaires seraient nécessaires. L'expansion Tfh atteint vraisemblablement un pic à un certain moment après la fenêtre de 14 jours sur laquelle nous nous sommes concentrés. Cependant, à notre connaissance, aucune étude n'a rapporté bm12 nombre de cellules du donneur au-delà de 2 semaines, ou à l'utilisationd marqueurs congéniques pour suivre les cellules adoptive transférés.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
B6.SJL-Ptprca Pepcb/BoyJ The Jackson Laboratory 001162 CD45.1+ BoyJ mouse strain
B6(C)-H2-Ab1bm12/KhEgJ The Jackson Laboratory 001162 Bm12 mouse strain
FastDigest PsuI Life Technologies FD1554 Restriction digest enzyme for genotyping
1X RBC Lysis Buffer eBioscience 00-4333-57
IMDM GE Healthcare SH30228.01
Plasma Separation Tube (PST) BD 365974 Blood collection tube with Dipotassium EDTA
Serum Separation Tube (SST) BD 365967 Blood collection tube with Clot activator / SST Gel
Ficoll GE Healthcare 17-1440-02  High density cell separation solution
Lympholyte-M Cedarlane CL5030 High density cell separation solution
GL-7-biotin eBioscience 13-5902-82 
Streptavidin-BUV395 BD 564176
CD138-BV421 BioLegend 142508
CD4-BV510 BioLegend 100559
TCRβ-BV605 BD 562840
CD45.1-BV711 BioLegend 110739
CD45.2-FITC BioLegend 109806
PD-1-PE BioLegend 135206
CD19-PerCP BioLegend 115532
Fas-PE-Cy7 BD 557653
CXCR5-APC BioLegend 145506
Fixable Viability Dye ef780 eBioscience 65-0865-18
CD4-BV421 BioLegend 100443
1.2 ml FACS tube inserts, racked USA Scientific 1412-1400
BD Falcon™ Round-Bottom Tubes BD 352017

DOWNLOAD MATERIALS LIST

References

  1. Helmick, C. G., Felson, D. T., et al. Part I. Arthritis Rheum. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).
  2. Lupus Foundation of America Web Site. Available from: http://www.lupus.org/answers/entry/what-is-lupus (2015).
  3. Somers, E. C., Marder, W., et al. Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program. Arthritis and Rheumatol. 66, 369-378 (2014).
  4. Perry, D., Sang, A., Yin, Y., Zheng, Y. -Y., Morel, L. Murine models of systemic lupus erythematosus. J Biomed Biotechnol. 2011, 271694 (2011).
  5. Lindholm, L., Rydberg, L., Strannegård, O. Development of host plasma cells during graft-versus-host reactions in mice. Eur J Immunol. 3, (8), 511-515 (1973).
  6. Fialkow, P. J., Gilchrist, C., Allison, A. C. Autoimmunity in chronic graft-versus-host disease. Clin Exp Immunol. 13, 479-486 (1973).
  7. Streilein, J. W., Stone, M. J., Duncan, W. R. Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease. J Immunol. 114, (1), 255-260 (1975).
  8. Gleichmann, E., Gleichmann, H. Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia. Eur J Immunol. 6, (12), 899 (1976).
  9. Morris, S., Cohen, P. L., Eisenberg, R. Experimental induction of systemic lupus erythematosus by recognition of foreign Ia. Clin Immunol Immunopathol. 57, (2), 263-273 (1990).
  10. Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease. J Immunol. 161, (11), 5880-5885 (1998).
  11. Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells. J Immunol. 193, 6124-6134 (2014).
  12. Petri, M., Orbai, A. -M., et al. Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum. 64, (8), 2677-2686 (2012).
  13. Zangala, T. Isolation of genomic DNA from mouse tails. J Vis Exp. (6), e246 (2007).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  15. Product information: Thermo Scientific FastDigest PsuI. Thermo Scientific. Available from: https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf (2012).
  16. Matheu, M. P., Parker, I., Cahalan, M. D. Dissection and 2-photon imaging of peripheral lymph nodes in mice. J Vis Exp. (7), e265 (2007).
  17. Harrell, M. I., Iritani, B. M., Ruddell, A. Lymph node mapping in the mouse. J Immunol Methods. 332, (1-2), 170-174 (2008).
  18. Covelli, V. Chapter 3, Internal examination. Guide to the necroscopy of the mouse. Available from: http://eulep.pdn.cam.ac.uk/Necropsy_of_the_Mouse/index.php?file=Chapter_3.html (2009).
  19. Quah, B. J. C., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. J Vis Exp. (44), e2259 (2010).
  20. Matheu, M. P., Cahalan, M. D. Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification. J Vis Exp. (9), e53319 (2007).
  21. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual Restraint and Common Compound Administration Routes in Mice and Rats. J Vis Exp. (67), e2771 (2012).
  22. Hoff, J. Methods of Blood Collection in the Mouse. Lab Animal. 29, (10), 47-53 (2000).
  23. Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution. J Vis Exp. (67), e3928 (2012).
  24. Cohen, P. L., Maldonado, M. A. Animal models for SLE. Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).
  25. Seavey, M. M., Lu, L. D., Stump, K. L. Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery. Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).
  26. McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells. J Leukoc Biol. 89, (2), 291-300 (2011).
  27. Scott, D. M., Ehrmann, I. E., et al. Identification of a mouse male-specific transplantation antigen H-Y. Nature. 376, 695-698 (1995).
  28. Joly, E., Hudrisier, D. What is trogocytosis and what is its purpose. Nat Immunol. 4, (9), 815 (2003).
  29. Brown, D. R., Calpe, S., et al. Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity. J Immunol. 187, (1), 21-25 (2011).
  30. Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease. J Immunol. 144, (3), 916-922 (1990).
  31. Choudhury, A., Cohen, P. L., Eisenberg, R. A. B cells require “nurturing” by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus. Clin Immunol. 136, (1), 105-115 (2010).
  32. Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. Humoral immunity due to long-lived plasma cells. Immunity. 8, (3), 363-372 (1998).
Le bm12 inductible modèle du lupus érythémateux disséminé (SLE) dans C57BL / 6
Play Video
PDF DOI

Cite this Article

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).More

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter