Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

O Inducible Modelo BM12 de Lúpus Eritematoso Sistêmico (LES) em camundongos C57BL / 6

doi: 10.3791/53319 Published: November 1, 2015

Introduction

O lúpus eritematoso sistêmico (LES) é uma doença auto-imune caracterizada complexo prototipicamente pelo anticorpo anti-nuclear (ANA) produção e glomerulonefrite. Numerosas outras sequelas, incluindo dérmica, cardio-pulmonar, lesões hepáticas e estão associados com a doença em alguns indivíduos. As estimativas de prevalência em os EUA variam muito, desde 150,000-1,500,000 1,2, com particular incidência em alta mulheres e minorias 3. Embora a etiologia do LES tem sido difícil de discernir, pensa-se que surgem a partir da interação de vários fatores genéticos e ambientais, que culminam na auto-imunidade sistêmica.

Inúmeros modelos animais têm sido empregados para fatores que levam ao início da doença e progressão estudar. Modelos clássicos de rato de SLE incluem estirpes de ratos geneticamente predispostos incluindo o NZB x NZW F1 modelo e os seus derivados, o NZM MLR / lpr estirpe, e a estirpe BXSB / Yaa e os sistemas indutíveis, tais como o pristane e modelos 4 doença crônica do enxerto-versus-hospedeiro (DECHc). Os primeiros relatórios de produção de autoanticorpos em modelos de GVHD usado várias linhagens de camundongos ou estirpes de hamster para pai em transferências F1 5 - 8; métodos mais comuns utilizados para estudar a doença de lúpus incluem atualmente o pai DBA / 2 → (C57BL / 6 x DBA / 2) F1, eo modelo de transferência BM12 descrito aqui. Cada modelo tem suas próprias advertências, mas eles geralmente compartilham um conjunto comum de características que se correlacionam com características clínicas da doença humana. Os parâmetros mais frequentemente reportados em modelos de murganho incluem esplenomegalia, linfadenopatia, nefrite, produção ANA, e ao nível celular, a expansão de células T helper (foliculares TFH), ao centro (GC), as células B e células germinais, de plasma.

O modelo BM12 indutível é conseguida pela transferência adoptiva de linfócitos a partir de IA BM12 B6 (C) - H2 - Ab1 BM12 / KhEgJ (BM12) ratinhos, uma estirpe identical para murganhos C57BL / 6 com excepção de 3 substituições de aminoácidos no MHC de classe II, em IA b C57BL / 6 (B6) ratinhos. Aloactivação de doadores células T CD4 por destinatário APCs leva a cGVHD com sintomas muito semelhantes LES. Especificamente, estas incluem a expansão do derivado do doador TFH, a expansão das células B GC derivada do receptor e as células de plasma, e a produção de ANA incluindo anti-ADNcd e anti-ssDNA, anti-cromatina, e anticorpos anti-RBC 9. Ao longo do tempo, ratinhos receptores desenvolver glomerulonef rite associada com depósitos de IgG no glomerular, intersticial, e regiões vasculares dos rins 10. Mostrámos recentemente que, semelhante à doença humana, também há um papel crítico para o IFN tipo I neste modelo 11. Notavelmente, os critérios de definição para SLE humano incluem o desenvolvimento de nefrite compatível com SLE, na presença de anti-dsADN os anticorpos 12, ambos os quais são características proeminentes deste modelo de ratinho.

Existem SEveral vantagens do modelo BM12 ao longo dos modelos espontâneos. Modelos clássicos que desenvolvam sinais LES-like espontaneamente dependem tanto linhagens de camundongos híbridos, linhagens puras não no fundo B6, ou grande loci genéticos no fundo B6, que fazem que cruzam a nocaute ou camundongos geneticamente modificado de outra forma difícil e demorado. Com o modelo indutível BM12, ratos geneticamente modificados podem servir quer como dador ou do receptor, permitindo a identificação mais rápida do compartimento celular em que os genes específicos podem ser importantes para a doença. Além disso, o desenvolvimento da doença no modelo BM12 é muito mais rápido, necessitando apenas de 2 semanas até ao aparecimento de ANA, em comparação a vários meses para os modelos mais espontâneas. Além disso, em contraste com os modelos espontâneos que desenvolvem a doença em diferentes pontos de tempo, o aparecimento e progressão da doença no modelo B6 BM12 → é altamente sincronizadas. Isto permite a geração de coortes de tamanho adequado que pode bE utilizada para estratégias de intervenção ou terapêuticos em qualquer fase do desenvolvimento da doença.

O que se segue é um protocolo detalhado para iniciar a auto-imunidade de LES como pela transferência adoptiva de linfócitos BM12 em ratinhos C57BL / 6, ou variantes genéticas no fundo B6. Além disso, descreve-se um protocolo de coloração de citometria de fluxo para enumerar TFH, GC células B, células do plasma e os tipos de células associadas com a doença humana. Mais importante, estes protocolos podem também ser utilizados para caracterizar doença na maioria dos modelos de rato de SLE e identificar TFH, GC células B e as células de plasma em outros modelos de doenças.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Trabalho animal foi realizada em condições livres de patógenos específicos de acordo com diretrizes estabelecidas pela Associação de Avaliação e Acreditação do Laboratório Animal Care Internacional e nossa Animal Care Institucional e Comitê de Uso (IACUC).

NOTA: Incorporar camundongos que expressam um marcador congénica como CD45.1 de cada doador ou animais receptores, se possível, porque isso permite a monitorização da eficiência doador do enxerto e expansão específica do doador população de células T CD4. Se considerando o uso de camundongos geneticamente modificados como outra forma de doadores ou beneficiários, garantir a tensão está devidamente retrocruzadas ao fundo B6, ou células transferidas pode ser rejeitado-isso será abordado em pormenor nos resultados representativos e seções de discussão.

NOTA: As seguintes volumes detalhe os procedimentos para a recolha de 4 doador BM12 ratos, os quais devem produzir células suficientes para injetar camundongos 12-16. Seisa doze semanas de idade, ratinhos BM12 produzir cerca de 100-140 milhões de linfócitos com cerca de 25% de células T CD4. Se começando com números diferentes de ratos, ou diferentes linhagens de camundongos, volumes escala cima ou para baixo em conformidade. Murganhos C57BL / 6 geralmente dão rendimentos similares com mais perto de apenas 20% das células T CD4.

NOTA: Execute todas as etapas na RT e usar a mídia RT para evitar o calor eo frio choque, o que pode prejudicar a viabilidade dos linfócitos longo prazo. Execute-colheita de tecidos e etapas de processamento de tecido em uma capa de cultura de tecidos utilizando uma técnica asséptica. Todos os meios de comunicação neste protocolo é IMDM com 10% de FBS, a menos que indicado de outra forma, e será referida simplesmente como inactivado pelo calor "meio completo".

1. novo método para genotipagem BM12 Mice

NOTA: Um protocolo breve restrição baseada em digestão para genotipagem é fornecido aqui, como uma alternativa simples e barata de seqüenciamento, que é actualmente o único método de genotipagem publicadopara estes ratinhos.

  1. Isolar DNA genômico de rabos de rato. Por favor, referir-se a um artigo anterior JoVE para protocolos detalhados no recorte da cauda do rato e a geração de cDNA a partir de cauda digere 13.
  2. Executar uma transcriptase reversa reacção em cadeia polimerizada (PCR), 14 para amplificar um fragmento de ADN 474 bp comum de MHC-II IA b e BM12 IA utilizando os iniciadores e as condições de ciclos térmicos listados na Tabela 1.
  3. Realizar digestão de restrição em ~ 7 ul do produto de PCR, utilizando a enzima PsuI, ou um dos seus isosquizômeras (BstX2I, BstYI, MflI, ou XhoII), que corta tipo selvagem IA b, mas não IA BM12 mutante. Siga digerir protocolo fornecido pelo fabricante, que irá indicar uma mistura de água, tampão e enzima, e uma incubação de 5 min. a várias horas a 37 ° C 15.
  4. Carregar digerir produto e executar em 1% de gel de poliacrilamida com brometo de etídio 14 durante 30-45 min. em 150V-embora configurações óptimas de voltagem e de tempo irá variar, dependendo do aparelho de gel de PCR utilizado. Visualize as bandas de ADN com um iluminador UV. Os resultados representativos são mostrados na Figura 1.

figura 1
Figura 1. Representante BM12 resultados de genotipagem.
Para identificar os ratinhos homozigóticos para IA BM12 / BM12, ADN da cauda foi rastreada para BM12 por PCR / restrição digerir genotipagem (Passo 1). Tipo selvagem homozigoto (IA b / b) DNA produz duas bandas em 227 e 247 bp (visualizado como uma banda de espessura em ~ 250 pb); BM12 homozigoto (IA BM12 / BM12) rendimentos de ADN uma banda a 474 pb; e heterozigotos (IA BM12 / b) DNA produz duas bandas em ~ 250 e 474 pb. Por favor clique aqui para ver uma versão maior desta figura.

2. A colheita de DoadoresCélulas

  1. Sacrifício camundongos doadores usando Institutional Animal Care e Use Committee (IACUC) -aprovado métodos de eutanásia primárias e secundárias. Por exemplo, ratinhos eutanásia por asfixia com CO 2, seguida por deslocação cervical.
  2. Utilizando uma técnica asséptica, baços de colheita e de gânglios linfáticos (cervical superficial, mandibular, braquial, axilar, mesentérica, e inguinal) em 15 ml tubos contendo 10 ml de mídia completo como em 11-13.
    NOTA: Consulte a relatórios anteriores para linfáticos detalhada protocolos nó dissecação 16 - 18. Este modelo também é bem sucedido usando apenas para a transferência de esplenócitos de ratinho, mas a adição de gânglios linfáticos reduz significativamente o número necessário de ratinhos dadores.
  3. Gerar uma suspensão de uma única célula triturando tecidos linfóides recolhidas no passo 2.2 a 70 uM filtros celulares utilizando o êmbolo de uma seringa. Para melhor rendimento, não sobrecarregue coadores de uso ~ 6 filtros para cada 4camundongos tratados, e enxaguar filtros com freqüência durante o processamento. Combinar tecidos a partir de 4 ratos em dois tubos cónicos de 50 ml, em seguida, as células de centrifugação durante 5 min a 400 xg e decantar o sobrenadante.
  4. Ressuspender as células de ambos os tubos cônicos de 50 ml de mídia completas e transferências para novo tubo cônico. Mantenha este tubo à temperatura ambiente.
    NOTA: Gordura adere aos lados do tubo, e se o tubo não está substituído, os rendimentos celulares finais podem sofrer.

3. Doador de Contagem de Células

NOTA: Para preservar a lise maior viabilidade, de glóbulos vermelhos (RBC) de toda a amostra não é recomendado.

  1. Misture a suspensão de células isoladas a partir do passo 2.4 bem, remover 1 ml e transferi-lo para um 50 ml cónico separado. Retiradas restantes, células intactas (49 ml) à temperatura ambiente durante a contagem.
  2. Adicionar 3 ml de um tampão de lise de glóbulos vermelhos à base de cloreto de amónio à amostra de 1 ml de células do doador. Misture delicadamente por 1 min. balançando, em seguida, preencha a 50 ml com meio completo, umND centrifugar durante 5 min. a 400 xg e sobrenadante decantado.
  3. Ressuspender as células RBC-lisadas em 10 ml de mídia completo e contagem (por exemplo, com azul de tripano utilizando um hemocitómetro). Resultado multiplicar por 49 este é o número total de células remanescentes na amostra não-lisadas, que foi posto de lado. Rejeitar células RBC-lise.

4. doador da célula rotulagem e / ou CD4 T Purificação celular

  1. Se desejado, purificar as células T CD4, nesta fase, embora isso não seja necessário. Além disso, se desejado, células de etiqueta com CFSE, como em 19, ou outros corantes de rastreamento de células, um exemplo dos quais é mostrado na Figura 4 da secção de resultados representativos.
    NOTA: Para CD4 T purificação de células, é recomendável selecionar magnético negativo, pois ele pode atingir uma alta pureza e deixa as células intactas com alta viabilidade, conforme descrito no 20. É importante que os tampões livres de endotoxinas são utilizados; portanto, em vez de BSA, fazer a separação sagacidade tampãoh 2% de FBS e a concentração recomendada de EDTA.

5. Injeção de células do doador BM12

  1. Após a contagem de linfócitos do doador na etapa 3 (e purificada ou rotulado como no passo 4, se for o caso), as células de centrifugação durante 5 min a 400 x g. Decantar células sobrenadante e ressuspender em PBS a 120 milhões de linfócitos por ml (ou 30 milhões de células T CD4 + purificadas por ml). Células transferência para um estéreis 5 ml de tubos de fundo redondo, ou outro tubo estéril que acomoda facilmente uma seringa de 1 ml equipado com um 27,5 G x 13 mm agulha.
  2. Antes da injecção, anular uma pequena amostra de células do dador a partir do passo 5.1 a 4 ° C para a coloração de fluxo para determinar a percentagem de células T CD4 + dentro das amostras dadoras. Mancha estas amostras, conforme descrito no Passo 8, utilizando o painel de anticorpo mínimo (Tabela 2).
    NOTA: Se as células a partir de diferentes estirpes de ratinho são utilizados como dadores separados, esta é uma consideração importante, e se as percentagens de células T CD4 variar substancialmente, purificação pode não ser necessária.
  3. Misture delicadamente as células, mas completamente. Isto pode ser feito por pipetando as células para cima e para baixo usando uma seringa de 1 ml, sem uma agulha ligada. Após a mistura, desenhar células na seringa de 1 ml. Anexar agulha depois de remover as bolhas de ar. Mantendo a agulha fora enquanto aprontar a seringa ajuda a manter a viabilidade celular.
  4. Injectar 250 jil por ratinho (que é igual a 30 milhões de linfócitos, ou 7,5 milhões de células T CD4 + purificadas por murganho) por via intraperitoneal, como descrito em 21.
    NOTA: Em experiências mostradas aqui e em nosso trabalho anterior 11, cada rato é injetado com 30 milhões de linfócitos totais de BM12 doadores, em vez dos 100 milhões de esplenócitos totais tradicionalmente utilizados. Em dados não publicados do nosso laboratório, nenhuma diferença foi observada em anti-dsDNA soro no dia 14, após as injecções de 30 ou 100 milhões de linfócitos por rato. Enquanto isto reduz significativamente o número de ratinhos necessários para as experiências, o desenvolvimento de nefrite with não foi avaliado esse número de células.

6. Determinar Enxertia Eficiência

NOTA 1: Esta secção descreverá como para determinar o grau de enxertamento célula do dador no receptor no dia 3, a fim de identificar quaisquer ratinhos que podem ter recebido injecções sub-óptimas (por exemplo, o enxerto de um rato é <10% do que a observada em Todos os outros ratinhos do mesmo grupo). Esses dados também podem ajudar a determinar se as células de uma estirpe de ratinhos geneticamente modificados forem rejeitadas em momentos posteriores (para detalhes, veja a seção de resultados representativos, Figura 6).

NOTA 2: Esta secção só é possível se doadores e receptores são de ratos em diferentes formações congênitas, por exemplo, ao utilizar doadores CD45.1 BM12 e CD45.2 C57BL / 6 destinatários, ou quando as células doadoras são marcados com um corante de rastreamento de pilha. Importante, aos 3 dias pós-injecção, as células T CD4 + foram sujeitas a expansão mínima (SEe secção representativa resultados, Figura 4), ​​de modo diferenças observadas no grau de enxertamento se devem a variabilidade em injecções, não expansão.

  1. Anestesiar ratos com 4% de isoflurano ou outro método IACUC-aprovado. Testar os reflexos do pé traseiros para assegurar o mouse está devidamente anestesiados antes de prosseguir para a coleta de sangue.
  2. Colheita de sangue 100-200 ul usando um método IACUC-aprovado, como retro-orbital punção como em 22. Recolha de sangue em tubos de microcentrífuga de 0,5 ml individuais contendo um anti-coagulante, tal como os tubos de recolha de plasma referenciados na tabela de materiais, que contêm EDTA dipotássico liofilizada. Após a coleta de sangue, aplique uma leve pressão no olho do rato usando uma toalha ou gaze estéril para garantir o sangramento parar, em seguida, coloque o mouse de volta em sua gaiola onde permanecerá até a colheita tecido final (Passo 7).
    NOTA: Não deixe ratos autônoma até ratos recuperou a consciência suficiente paradecúbito ventral manter, e não retornam ratos para a companhia de outras pessoas até que esteja totalmente recuperado.
  3. Levar o volume de sangue de 500 ul com 21 ° C, PBS e transferir para um tubo de microcentrífuga cónica de fundo, em seguida, underlay lentamente 200 ul de 21 ° C uma solução de separação de células de alta densidade com um pi pipeta de 200, tendo o cuidado de minimizar a mistura entre as duas fases ( veja Materiais tabela de soluções recomendadas). Células centrifugar a 700 xg durante 20 min a 20-25 ° C com travão de centrifugação ajustado para baixo.
  4. Remover a camada de topo contendo linfócitos com uma pipeta de 1 ml e transferência para um novo tubo de microcentrifugação de 800 ul contendo meio completo frio. Gentilmente vórtice para misturar as células. Células centrifugar a 700 xg durante 5 min a 4 ° C e o sobrenadante decantado.
  5. Ressuspender as células em 200 ul de meio completo, a transferência para uma placa de 96 poços de fundo em U, e mancha de citometria de fluxo, conforme descrito no Passo 8, utilizando um painel de anticorpos mínimo (Tabela 2) para determinar tele abundância relativa do enxerto de células T CD4 + como uma percentagem de PBMCs.

7. final em tecido Colheita

NOTA: Os experimentos descritos na seção resultados foram colhidas 14 dias após a injeção de células do doador (ou em alguns casos menos tempo), como eles se concentrar no desenvolvimento inicial de células TFH e células plasmáticas; no entanto, uma vez que este modelo é um modelo GVHD crônica de LES, doença pode ser controlada em tantos pontos de tempo posteriores. O prazo óptimo dependerá da questão de pesquisa em cada experiência individual.

  1. Num ponto de tempo predeterminado após a injecção de células dadoras BM12 (passo 5.4), sacrificar os ratinhos utilizando um método IACUC-aprovado de eutanásia. Asfixia com CO2, seguido por sangria é recomendado. Deslocamento cervical pode funcionar como um método secundário da eutanásia, mas isto pode reduzir o rendimento de colheita de sangue.
  2. Molhar o abdômen do mouse levemente com um frasco de spray contendo 70%etanol. Faça uma pequena incisão, superficial com uma tesoura cirúrgica aproximadamente 1 cm acima da genitália. Chamar de volta a pele do abdômen em direção ao esterno, tendo o cuidado de manter a fáscia peritoneal intacta.
    NOTA: ratinhos enfermas normalmente apresentam-se com 0,5-3 ml de ascite No dia 14, o qual, embora ainda não tenha sido bem caracterizados, podem ser medidos e analisados ​​como um parâmetro adicional da doença.
  3. Encaixe uma seringa de 5 ml com uma agulha de 18 G. Inserir a agulha no quadrante inferior direito do abdómen com a agulha dirigida para cima para a cabeça do animal e a 15 ° de ângulo em relação ao plano do painel de instrumentos. Posicione a ponta da agulha perto do ceco para ajudar a evitar que a agulha fique entupido com intestino enquanto aspiração ascite.
  4. Gire cuidadosamente o mouse de lado, em seguida, desenhar lentamente ascite dentro da seringa. Uma vez ascite foi recuperado, remover a seringa e registrar o volume aspirado, com base nas marcações volumétricas no lado do syriESL.
  5. Ascite descarga para um tubo de 5 ml de fundo redondo e armazenar em gelo para posterior processamento.
  6. Colheita de sangue através de sorteio a partir da veia cava inferior (VCI), essencialmente como em 22. Utilizando uma pinça sem brilho, mova suavemente intestinos para o lado esquerdo do mouse, descobrindo o IVC. Inserir uma agulha 27,5 g adequado para uma seringa de 1 ml para a VCI e desenhar lentamente 400-500 mL de sangue.
  7. Para minimizar a hemólise, injectar lentamente sangue para um tubo de microcentrífuga de 0,5 ml de soro ou de recolha de plasma. Para a análise do soro depois de ANAs por ELISA, manter o sangue no gelo.
  8. Dissecar e obter adicional tecidos relevantes (baço e, se desejado, rins e gânglios linfáticos, especialmente se recolha em pontos de tempo posteriores e glomerulonefrite serão marcados). Remover baço por suavemente colocando os intestinos de volta para o lado direito do animal, e puxar sobre o pâncreas, o qual é um tecido conjuntivo primário do baço.
  9. Remova qualquer pâncreas restante, em seguida, pesarbaços em uma balança de alta precisão imediatamente após a dissecação, como esplenomegalia bruta é um parâmetro comumente relatada em modelos de ratos com LES. Coloque tecidos linfóides individuais em tubos de 1,5 ml cheios com 1 ml de meio completo em gelo. Corrigir rins em 10% formalina tamponada neutra ou tirar congelar rins para histologia mais tarde, como em 23.
  10. Centrífuga de sangue dentro de 2 horas de coleta para 3 min. a 10.000 xg (4 ° C). Remover soro e armazenar a -80 ° C para posterior análise da ANA por ELISA. Consulte a relatórios anteriores para protocolos Ana Elisa detalhados 24,25. Armazenar o soro em 10-20 mL alíquotas múltiplas para minimizar a ciclos de congelamento / descongelamento, e permitir que um maior número de ensaios futuros.
  11. Centrifugar ascite 400 xg durante 5 min. Remover o sobrenadante com uma pipeta de 1 ml e alíquotas de 0,5 ml em vários tubos. Congelar sobrenadante a -80 ° C para posterior análise de anticorpos anti-nucleares (ANA) ou outros mediadores inflamatórios solúveis.
  12. Fract celular Ressuspender ião positivo em cerca de 1 ml de meio completo e transferir 200 ul de uma placa de 96 poços de fundo em U para a coloração de fluxo (tal como no Passo 8).
  13. Amasse cada baço através de 70 mm filtros de células em tubos separados e enxágüe com meio completo. Ressuspender esplenócitos com 1 ml de tampão de lise de RBC frio durante 1 min. e misture delicadamente balançando. Levar o volume até 10 ml com meio completo frio e centrifugar durante 5 min a 400 xg e decantar o sobrenadante.
  14. Ressuspender pellet celular em 5 ml de mídia completo e contagem usando um hemocitômetro. Ajustar o volume tal que 200 mL de mídia completo contém 1-3 milhões de células. Iniciar a coloração por citometria de fluxo (Passo 8) utilizando um painel alargado (Tabela 2) para quantificar dador de células T CD4 e o receptor da célula B diferenciação e expansão.
    NOTA: Dependendo do que laser, tubo fotomultiplicador (PMT), e conjuntos de filtros combinações estão disponíveis, separando painel de análise de células T e B em vários painéis podem ser necessários.
ve_title "> 8. Fluxo Coloração

  1. Transferência de 1-3 milhões de esplenócitos em 200 ul de meio completo para tubos individuais de 5 ml de fundo redondo, ou em cavidades separadas de uma placa de 96 poços com fundo em U.
    NOTA: Usando uma placa de 96 cavidades é uma maneira eficiente para corar amostras múltiplas, mas tomar cuidado para chapear amostras bem em todos os outros, a fim de evitar a contaminação cruzada. Uma placa de 96 poços pode, por conseguinte realizar 24 amostras.
  2. Placa centrifugar a 500 xg durante 3 min., Em seguida, sobrenadante filme de placa em um recipiente (Biohazard) apropriado.
  3. Ressuspender as peletes de células com 100 ul de tampão de fluxo (1% de FBS em PBS) contendo um corante de viabilidade fixável a uma concentração recomendada pelo fabricante e purificados anti-CD16 / anti-CD32 anticorpo coquetel a 1 ug / ml. Incubar durante 10 minutos a 20-25 ° C, depois adicionar 100 ul de meio completo frias para suprimem corante de viabilidade.
    NOTA: Os esplenócitos de ratos doentes geralmente contêm um número relativamente elevado de células mortas ou a morrer;portanto, a inclusão de um corante de viabilidade é recomendado para evitar a rotulagem anticorpo não específico de morte de células, resultando em dados mais limpas, mais fiáveis. Da mesma forma, o cocktail anti-CD16 / anti-CD32 é incluído para bloquear o anticorpo fluorescentemente marcado a ligação não específica por receptores Fc.
  4. Placa centrifugar a 500 xg durante 3 min., Em seguida, sobrenadante filme de placa em um recipiente de risco biológico. Ressuspender as células em 200 ul tampão fluxo. Placa centrifugar a 500 xg durante 3 min., Em seguida, sobrenadante filme de placa em um recipiente de risco biológico.
  5. Ressuspender as células em 50 ul de tampão de fluxo contendo cocktail de anticorpos (Tabela 2). Incubar durante 20 min a 4 ° C, depois adicionar 150 ul de tampão de fluxo. Repita o passo de lavagem 8.4.
  6. Ressuspender as células com 100 ul de 2% de paraformaldeído em PBS. Incubar durante 30 min a 4 ° C, depois adicionar 100 ul de tampão de fluxo. Placa centrifugar a 500 xg durante 3 min., Em seguida, sobrenadante filme de placa em um recipiente de risco biológico.
  7. ResuspeND em 200 ul de tampão de fluxo, transferir a fluir inserções do tubo ou tubos de fluxo padrão, adicionar um tampão de fluxo adicional de 100-200 uL, e armazenar a 4 ° C no escuro até adquirir no citómetro de fluxo.
  8. Adquirir num citómetro de fluxo equipado com lasers e os PMTs adequadas para os painéis de anticorpos escolhidos dentro de alguns dias de coloração. Grave largura dispersão para a frente e / ou altura, além de transmitir a área de dispersão, área de dispersão lateral, ea área dos parâmetros fluorescentes utilizadas. Para obter resultados confiáveis, adquirir ≥1,000 células do doador em cada amostra WT, ou um número equivalente de linfócitos totais em ratos manipulados geneticamente modificados ou não que mostram expansão mínima de células do doador, onde a recolha de tantos eventos pode não ser viável.
    NOTA: As análises de citometria de fluxo são descritos em detalhe na secção de resultados representativos (Figuras 3 - 6).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ratinhos doentes desenvolvem esplenomegalia em menos de 14 dias, apresentando os baços 2-3 vezes o tamanho dos ratinhos saudável em termos de massa e celularidade (Figura 2).

Os esplenócitos são sequencialmente fechado na dispersão de luz (FSC-SSC-A por A), a eliminação de dupletos (FSC-W ou -H pelo FSC-A), células viáveis ​​(baixa coloração do corante de viabilidade) e CD4 + TCRβ + (Figura 3A). Células dadoras são distinguidas das células receptoras com base em CD45.1 e CD45.2 (Figura 3B, canto inferior esquerdo). Células dadoras adoptar predominantemente um ajudante T folicular (TFH) fenótipo da célula, tal como caracterizado pela regulação positiva de DP-1, CXCR5, Bcl-6, e ICOS (Figura 3B, C). Uma porção da população do receptor de células T CD4 + também se diferencia em TFH (Figura 3B, canto inferior direito). Após uma mortandade inicial e / ou migração de células transferidas, a expansão do derivado do doador TFH é logarítmica, reaching 10-20 milhões de células nos baços de ratinhos 14 dias após a injecção (Figura 3D).

CFSE-rotulagem de linfócitos transferidos doador demonstrou que células T CD4 diferenciar em TFH início após a ativação; essencialmente todas as células divididas observada nos dias 3, 7, e 14 upregulated CXCR5 e DP-1 (Figura 4). Os perfis de pico proliferação também sugerem que uma percentagem relativamente baixa de doadores células T CD4 sofreu aloactivação e divisão. Ao dia 14, a maioria das células do dador detectáveis ​​são aqueles que têm dividido para além do número máximo de divisões mensuráveis ​​por CFSE.

A expansão do derivado do doador TFH é acompanhado por um correspondente acumulação de células B GC endógena e células plasmáticas (Figura 5A). Acumulação de células de plasma no baço está atrasado em comparação com a de TFH, não exibindo aumento sobre os animais naive nos dias 3 e 7 (Figura 5B). Accordingly, anticorpos anti-nucleares não são facilmente detectáveis ​​antes do dia 9 (dados não mostrados), mas pode ser quantificada fiavelmente no dia 14 11.

Através do uso de marcadores congénicos, temos observado rejeição de células do dador em várias estirpes. Embora isto seja um problema comum quando os ratos não são suficientemente retrocruzadas com C57BL / 6 de fundo, que também observado rejeição quando BM12 células foram transferidas para um B6.PL- Thy1 / CYJ (CD90.1) ratos que são geralmente consideradas como inteiramente retrocruzadas. Portanto, os ratinhos são rotineiramente rastreados no dia ~ 3 por amostras de sangue de coloração de fluxo para avaliar a eficácia do enxerto de células T CD4 inicial; sabemos por experiências de proliferação CFSE células enxertadas que se expandiram muito pouco nesta altura cedo. Estes resultados são, então, comparados com os resultados obtidos a partir da colheita dia 14. Em um exemplo de caso de rejeição, 30 milhões de CD45.1 + BM12 linfócitos foram transferidos para Cardif - / - Ratos que tinham sido retrocruzados com ratinhos C57BL / 6 durante 12 gerações. No dia 5, todos os ratinhos exibida enxertia equivalente (2-3% de células T CD4 + circulantes), mas no dia 14, BM12 células dadoras foram completamente eliminados do receptor geneticamente modificada (Figura 6).

Figura 2
Figura 2. cinética de crescimento do baço depois da injecção de linfócitos BM12. Os baços foram pesados ​​numa balança de alta precisão directamente após a excisão (esquerda). O número de células vivas foi determinado pela contagem com um hemocitômetro utilizando azul de tripano para excluir as células mortas (à direita). Os resultados estão representados como média ± SEM, onde n = 9, 4, 3, e 6, respectivamente. Por favor clique aqui para ver uma versão maior desta figura.

jpg "/>
Figura 3. Análise de T auxiliar folicular expansão celular no modelo de LES. BM12 CD45.1 + BM12 linfócitos foram transferidos para receptores C57BL / 6 e os baços foram analisados ​​14 dias mais tarde. (A) a estratégia gating Representante mostrando "linfócitos" (primeiro painel), "células individuais" (segundo painel), "células vivas" (terceiro painel), e "células T CD4" (quarto painel). (B) As células doadoras distinguem-se dos receptores de células T CD4 + por CD45.1 e CD45.2 coloração e analisadas quanto à expressão de DP-1 e CXCR5. Células (C) Doadores adoptar TFH fenótipo, tal como indicado pela regulação positiva de várias proteínas vulgarmente associados com TFH. (D) Os resultados típicos que mostram a expansão dos derivados do doador TFH (definida como CD4 + CD45.1 + PD-1 + CXCR5 + células vivas) nos dias 3, 7 e 14 após transferência. Os resultados estão representados ums média ± SEM, onde n = 5, 4, 3, e 6, respectivamente. Por favor clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4. DP-1 e CXCR5 são regulados positivamente em células em divisão. BM12 células foram marcadas com CFSE, antes da injecção em ratinhos C57BL / 6 receptores. Parcelas de fluxo representativos são mostrados para doadores células T CD4 aos 3, 7 e 14 dias após a injeção. Por favor clique aqui para ver uma versão maior desta figura.

Figura 5
Figura 5. Expansão de células plasmáticas e células esplênicas GC B. (A) parcelas de fluxo representativos de baços ingênuos rato, ou aqueles deratinhos 14 dias após CD45.1 + BM12 transferência. As células plasmáticas são definidos como CD138 + CD19 células vivas baixas (painéis superiores). GC células B são um subconjunto de células B CD19 +, as quais expressam GL-7 e Fas (painéis inferiores). De dados (B) quantitativo, que mostra a acumulação de células plasmáticas esplénicas ao longo do tempo. Os resultados estão representados como média ± SEM, onde n = 5, 4, 3, e 6, respectivamente. Por favor clique aqui para ver uma versão maior desta figura.

Figura 6
Enxertos Figura 6. BM12 são rejeitadas por alguns ratinhos receptores geneticamente modificados. CD45.1 + BM12 linfócitos foram transferidos para ambos camundongos geneticamente modificados (painéis superiores) ou C57BL / 6 (painéis inferiores) ratos destinatário. Os ratinhos foram sangrados a 5 dias após a injecção e avaliados quanto à eficiência de enxerto. Esplen�itos dos mesmos ratos foram analisados ​​14 dias mais tarde. Por favor clique aqui para ver uma versão maior desta figura.

Nome do iniciador Sequência (5 '- 3') Temperatura de recozimento
Bm12F CGTGGTCCCCGCTGTCCCCC * 65 ° C
Bm12R GGGCAGAGGGCAGAGGTGAG
Segmento Número de ciclos Temperatura Duração
1 1 95 ° C 2 min.
2 40 95 ° C 15 seg.
* 65-0,5 ° C / step 15 seg.
72 ° C 45 seg.
3 1 72 ° C 10 min.

Tabela 1:. Os iniciadores e as condições de ciclos térmicos para BM12 genotipagem condições óptimas termociclagem dependerá dos reagentes e instrumentos utilizados exactas. Estas condições foram optimizadas para um termociclador capaz de mudar a temperatura de recozimento em cada etapa, embora o protocolo pode também funcionar usando uma temperatura de recozimento estático.

Tabela 2
Tabela 2:. Painéis de anticorpos para splenic TFH, GC B e identificação de células plasmáticas por citometria de fluxo Apresentado são painéis que têm usado com sucessopara avaliar a eficiência do enxerto no dia 3 (à esquerda) ea análise de células T e B no dia 14 após BM12 injeção de células (meio). Estes foram otimizados para uma LSRII com 5 lasers (355, 405, 488, 561 e 640 nm). Recomendado conjuntos de filtros para cada fluorocromo são listados (à direita), embora estes não pode ser a melhor opção para cada máquina. Dependendo do laser que, PMT, e combinações de conjuntos de filtros estão disponíveis, que separa o painel de análise de células T e B nos vários painéis podem ser necessários.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

O modelo induzível BM12 é uma maneira relativamente fácil e eficiente para estudar os processos celulares e moleculares do LES. A activação crónica de células T CD4 adoptivamente transferidos dirigidos contra auto-antigénios conduz à acumulação de TFH, GC células B, e células de plasma que pode ser medido por citometria de fluxo, tal como descrito aqui. Estudos futuros utilizando este modelo pode rapidamente e facilmente interrogar o papel dos genes candidatos e novas terapias nos processos centros germinativos auto-imunes que se assemelham àquelas que ocorrem em pacientes com LES, e, finalmente governam a acumulação patológica de auto-anticorpos. Além disso, a análise de citometria de fluxo aqui descritos pode ser usado para estudar os modelos de ratinho adicionais que envolvem o desenvolvimento de imunoglobulinas, incluindo, mas não se limitando a auto-imunidade, infecção, alergia e.

Como todos os modelos animais de doenças humanas, este modelo também tem suas limitações. Dada a velocidade com que devel doençaPO e a sua magnitude, nem todos os genes envolvidos no desenvolvimento do LES é provável que sejam necessários para a patogenicidade neste modelo. Além disso, deve-se tomar cuidado para descartar a rejeição do enxerto quando os dados sugerem expansão mínima de TFH em receptores geneticamente modificados. Marcadores cong�icas deve ser usado para confirmar a presença de células do doador no momento da colheita, especialmente uma vez que as células receptoras, também se podem diferenciar em TFH (Figura 3B), que de outro modo poderia mascarar a ausência de células do dador. Utilizar marcadores congénicos, observou-se a completa eliminação de células dadoras que evidentemente abrigavam antigénios de rejeição ao dia 14 (Figura 6). Temos utilizado com sucesso CD45.1 + BM12 e CD45.2 + BM12 ratos como doadores, e CD45.1 + BoyJ (B6.SJL- Ptprc um PEPC b / BoyJ) e CD45.2 + camundongos C57BL / 6 como destinatários (Figuras 3, 6, 7, e dados não publicados). No entanto, tipo selvagem congénicaCélulas CD90.1 + do B6.PL- Thy1 a / ​​CYJ rato estirpe não enxertar bem, nem CD90.2 + BM12 células do enxerto bem em um CD90.1 + destinatário (dados não publicados), um fenômeno que não é, evidentemente, exclusivo para este modelo 26.

Ou C57BL / 6 ou BM12 ratinhos pode servir como o dador ou do receptor, tal como inicialmente relatado por Morris et al. 9, No entanto, no nosso laboratório, encontramos a transferência de células BM12 em ratinhos B6 produz expansão mais consistente de células T e células B populações no dia 14. Além disso, doadores e receptores camundongos de diferentes grupos devem ser pareados por gênero e idade. Embora experiências relatadas na primeira descrição do modelo BM12 não encontraram nenhuma diferença significativa em nenhum parâmetro doença entre os sexos masculino → femininos → transferências do sexo feminino 9 do sexo masculino e, transferências femininos → masculinos não são aconselhados, como antígeno masculino (HY) expresso por células T CD4 transferidos pode induzir reje enxertocção nas receptoras 27.

Ao escolher anticorpos e marcadores fluorocromos para congénicos, deve notar-se que as células doadoras tornar-se positivo para o marcador congénica receptor em diferentes graus, de tal modo que um CD45.2 - portão não constituem o CD45.1 + enxerto. O fenómeno é claramente ilustrado numa comparação de expressão CD45.2 por CD45.1 + naïve, CD45.1 + doador, e CD45.2 + receptores das células T CD4 (Figura 7). Notavelmente, células doadoras também parecem regular a expressão do seu próprio marcador congénica, em comparação com controlos sem tratamento prévio (figura 7). Resultados semelhantes são também observados com CD45.2 + BM12 transferência em ratinhos CD45.1 + BoyJ (dados não mostrados). Presumivelmente, a aquisição de resultados CD45 receptor de trogocytosis 28 por células T CD4 activadas seguintes interacções com células B destinatário repetido. Na verdade, o modo BM12l pode ser uma ferramenta útil no estudo do processo de trogocytosis in vivo.

Figura 7
Figura 7. As células dadoras adquirir receptor CD45 marcador congénica. CD45.1 + BM12 linfócitos foram transferidos para CD45.2 + C57BL / 6 receptores. Dador, receptor, e ingênuo (CD45.1 +) células T CD4 são avaliados para CD45.1 e expressão CD45.2 14 dias após a transferência. Por favor clique aqui para ver uma versão maior desta figura.

Demonstrou-se que a transferência das células T CD4 + purificadas BM12 em ratinhos C57BL / 7 ratinhos é suficiente para iniciar a doença 29; No entanto, quando se desenvolve a doença equivalente linfócitos inteiras são transferidas, e a purificação não é necessariamente requerida para estudar a dependência da doença sobre o t cell-intrínseca expressão gênica. Eisenberg e colegas, demonstraram claramente que a célula produtora de anticorpos no modelo BM12 é quase exclusivamente de origem receptor 30. Além disso, o requisito para receptores de células T CD4 10 é limitada para o 'carinho' de células B durante o seu desenvolvimento, o que pode ser compensado por meio da adição de IL-4 31, embora os nossos dados indicam que o receptor de células T podem participar um pouco na resposta centro germinal, como alguns deles para fazer desenvolver um fenótipo TFH (Figura 3B, canto inferior direito).

Uma decisão crítica que deve ser feita para cada experimento BM12 é quando colher tecidos para análises. É claro que a decisão final depender exatamente quais fatores são importantes para o estudo atual, que pode variar. As experiências descritas aqui levar até 14 dias, como eles se concentrar no desenvolvimento inicial de células TFH e células plasmáticas; No entanto, uma vez que este modelo é uma doença crônicaGVHD modelo de LES, a doença pode ser monitorizada por muito mais tempo. De fato, certas características clínicas do LES, incluindo glomerulonefrite, desenvolver mais tarde. Proteinúria foi detectado tão cedo como 2 semanas após a injecção, mas atinge níveis de pico a 4-8 semanas após a injecção 10,31. Além disso, a citometria de fluxo análises descritas aqui foram optimizados para experiências com duração de 2 semanas. Nós encontramos um número considerável de células GC B e células plasmáticas, neste ponto do tempo; embora, com o tempo adicional, uma grande percentagem de células plasmáticas secretoras de ANA podem residir na medula óssea 32. Além disso, as células de plasma identificados por este painel de coloração fluxo provavelmente também incluir-plasmablasts para distinguir entre estes dois tipos de células, anticorpos adicionais seriam necessários. Expansão TFH presumivelmente atinge um pico em algum momento após a janela de 14 dias em que temos focado. No entanto, a nosso conhecimento, não há estudos têm relatado BM12 número de células de doadores para além de 2 semanas, ou usod marcadores cong�icas para rastrear as células transferidas adoptivamente.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
B6.SJL-Ptprca Pepcb/BoyJ The Jackson Laboratory 001162 CD45.1+ BoyJ mouse strain
B6(C)-H2-Ab1bm12/KhEgJ The Jackson Laboratory 001162 Bm12 mouse strain
FastDigest PsuI Life Technologies FD1554 Restriction digest enzyme for genotyping
1X RBC Lysis Buffer eBioscience 00-4333-57
IMDM GE Healthcare SH30228.01
Plasma Separation Tube (PST) BD 365974 Blood collection tube with Dipotassium EDTA
Serum Separation Tube (SST) BD 365967 Blood collection tube with Clot activator / SST Gel
Ficoll GE Healthcare 17-1440-02  High density cell separation solution
Lympholyte-M Cedarlane CL5030 High density cell separation solution
GL-7-biotin eBioscience 13-5902-82 
Streptavidin-BUV395 BD 564176
CD138-BV421 BioLegend 142508
CD4-BV510 BioLegend 100559
TCRβ-BV605 BD 562840
CD45.1-BV711 BioLegend 110739
CD45.2-FITC BioLegend 109806
PD-1-PE BioLegend 135206
CD19-PerCP BioLegend 115532
Fas-PE-Cy7 BD 557653
CXCR5-APC BioLegend 145506
Fixable Viability Dye ef780 eBioscience 65-0865-18
CD4-BV421 BioLegend 100443
1.2 ml FACS tube inserts, racked USA Scientific 1412-1400
BD Falcon™ Round-Bottom Tubes BD 352017

DOWNLOAD MATERIALS LIST

References

  1. Helmick, C. G., Felson, D. T., et al. Part I. Arthritis Rheum. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).
  2. Lupus Foundation of America Web Site. Available from: http://www.lupus.org/answers/entry/what-is-lupus (2015).
  3. Somers, E. C., Marder, W., et al. Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program. Arthritis and Rheumatol. 66, 369-378 (2014).
  4. Perry, D., Sang, A., Yin, Y., Zheng, Y. -Y., Morel, L. Murine models of systemic lupus erythematosus. J Biomed Biotechnol. 2011, 271694 (2011).
  5. Lindholm, L., Rydberg, L., Strannegård, O. Development of host plasma cells during graft-versus-host reactions in mice. Eur J Immunol. 3, (8), 511-515 (1973).
  6. Fialkow, P. J., Gilchrist, C., Allison, A. C. Autoimmunity in chronic graft-versus-host disease. Clin Exp Immunol. 13, 479-486 (1973).
  7. Streilein, J. W., Stone, M. J., Duncan, W. R. Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease. J Immunol. 114, (1), 255-260 (1975).
  8. Gleichmann, E., Gleichmann, H. Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia. Eur J Immunol. 6, (12), 899 (1976).
  9. Morris, S., Cohen, P. L., Eisenberg, R. Experimental induction of systemic lupus erythematosus by recognition of foreign Ia. Clin Immunol Immunopathol. 57, (2), 263-273 (1990).
  10. Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease. J Immunol. 161, (11), 5880-5885 (1998).
  11. Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells. J Immunol. 193, 6124-6134 (2014).
  12. Petri, M., Orbai, A. -M., et al. Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum. 64, (8), 2677-2686 (2012).
  13. Zangala, T. Isolation of genomic DNA from mouse tails. J Vis Exp. (6), e246 (2007).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J Vis Exp. (63), e3998 (2012).
  15. Product information: Thermo Scientific FastDigest PsuI. Thermo Scientific. Available from: https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf (2012).
  16. Matheu, M. P., Parker, I., Cahalan, M. D. Dissection and 2-photon imaging of peripheral lymph nodes in mice. J Vis Exp. (7), e265 (2007).
  17. Harrell, M. I., Iritani, B. M., Ruddell, A. Lymph node mapping in the mouse. J Immunol Methods. 332, (1-2), 170-174 (2008).
  18. Covelli, V. Chapter 3, Internal examination. Guide to the necroscopy of the mouse. Available from: http://eulep.pdn.cam.ac.uk/Necropsy_of_the_Mouse/index.php?file=Chapter_3.html (2009).
  19. Quah, B. J. C., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. J Vis Exp. (44), e2259 (2010).
  20. Matheu, M. P., Cahalan, M. D. Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification. J Vis Exp. (9), e53319 (2007).
  21. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual Restraint and Common Compound Administration Routes in Mice and Rats. J Vis Exp. (67), e2771 (2012).
  22. Hoff, J. Methods of Blood Collection in the Mouse. Lab Animal. 29, (10), 47-53 (2000).
  23. Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution. J Vis Exp. (67), e3928 (2012).
  24. Cohen, P. L., Maldonado, M. A. Animal models for SLE. Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).
  25. Seavey, M. M., Lu, L. D., Stump, K. L. Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery. Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).
  26. McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells. J Leukoc Biol. 89, (2), 291-300 (2011).
  27. Scott, D. M., Ehrmann, I. E., et al. Identification of a mouse male-specific transplantation antigen H-Y. Nature. 376, 695-698 (1995).
  28. Joly, E., Hudrisier, D. What is trogocytosis and what is its purpose. Nat Immunol. 4, (9), 815 (2003).
  29. Brown, D. R., Calpe, S., et al. Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity. J Immunol. 187, (1), 21-25 (2011).
  30. Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease. J Immunol. 144, (3), 916-922 (1990).
  31. Choudhury, A., Cohen, P. L., Eisenberg, R. A. B cells require “nurturing” by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus. Clin Immunol. 136, (1), 105-115 (2010).
  32. Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. Humoral immunity due to long-lived plasma cells. Immunity. 8, (3), 363-372 (1998).
O Inducible Modelo BM12 de Lúpus Eritematoso Sistêmico (LES) em camundongos C57BL / 6
Play Video
PDF DOI

Cite this Article

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).More

Klarquist, J., Janssen, E. M. The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice. J. Vis. Exp. (105), e53319, doi:10.3791/53319 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter