Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Боковые Корень Индуцибельная системы в doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Корневая система имеет решающее значение для роста растений, так как он обеспечивает закрепление и поглощение воды и питательных веществ из почвы. Поскольку расширение корневой системы, главным образом, зависит от производства боковых корней, их инициирование и формирование были широко изучены. Боковые корни начато в определенное подмножество клеток перицикла, называется стволовых клеток 1. В большинстве двудольных, таких как Arabidopsis THALIANA, эти клетки расположены в protoxylem полюсов 2, тогда как у однодольных, таких как кукуруза, они находятся на флоэмы полюсов 3. Стволовых клеток отмечены повышенным ответ ауксина 4, с последующим экспрессии специфических генов клеточного цикла (например, циклин В1; 1 / CYCB1; 1), после чего они проходят первый этап асимметричных антиклинальными подразделений 5. После серии скоординированных антиклинальных и периклинальных подразделений, боковая корень зачаток формируется, что, наконец появится в качестве аutonomous боковой корень. Место и сроки боковых корней начала, однако, не предсказуема, так как эти события ни в изобилии, ни синхронизированы. Это препятствует использованию молекулярных подходов, таких как транскриптомики для изучения этого процесса.

Для решения этого, боковых корней Индуцибельная Система (LRIS) была разработана 6, 7. В этой системе, рассаду сначала обрабатывают N -1-naphthylphthalamic кислоты (НПД), который ингибирует транспортировки ауксина и накопление, следовательно, блокируя боковых корней инициирование 8. По впоследствии передаче рассаду, чтобы среде, содержащей синтетический ауксина 1-нафталин уксусной кислоты (НАА), весь слой перицикла реагирует на повышенный уровень ауксина, таким образом, индуцируя массово корневые начала разделы боковые клеточные 6. Таким образом, эта система приводит к быстрым, синхронных и обширные боковые корни посвящений, что позволяет легко коллекция образцов корневых обогащенные для определенной стадии позднегоRAL развитие корневой. Впоследствии эти образцы могут быть использованы для определения генома профили экспрессии во время формирования боковых корней. LRIS дала уже значительные знания о боковых корней посвящения в Arabidopsis и кукурузы 9-13, но необходимость применять эту систему с другими видами растений становится все более очевидной, поскольку все больше геномы последовательности и есть повышенный интерес к передаче знаний, чтобы экономично важно виды.

Здесь подробные протоколы Arabidopsis и кукурузы LRISs приведены. Далее, пример использования системы обеспечивается, иллюстрируя, как данные, полученные от транскриптомика кукурузы LRIS могут быть использованы для идентификации функциональных гомологов, которые имеют консервативный функцию при инициации боковых корней между различными видами растений. Наконец, руководящие принципы для оптимизации LRIS для других видов растений предлагается.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Arabidopsis LRIS протокол

Примечание: текст относится к "малых" или "больших" экспериментов масштабе. Масштабные эксперименты Маленькие, такие как анализ маркер линии и гистологического окрашивания 6, 14, требуют лишь несколько образцов. Крупномасштабные эксперименты, такие как количественные реального времени Qrt-ПЦР, микро-массивов 9-11 или РНК секвенирования, требуют большего количества образцов. Таким образом, количество ~ 1000 саженцев на образце был использован Ваннесте др 11. Для выполнения микрочипов эксперимента после корня сегмента вскрытия.

1 ДЕНЬ

  1. Стерилизация Arabidopsis Семена
    Примечание: Выберите один из следующих процедур для семян стерилизации. Любой из них подходит для следующих шагов протокола. Стерилизация газовая (1.1.2) представляет два основных преимущества по сравнению с жидкой стерилизации (1.1.1): это занимает меньше времени, когда обработке большого онемениеэ семян, так как нет пипетки не должно происходить для отдельных образцов; и стерилизованные семена могут храниться в течение длительного периода времени. Тем не менее, это требует эксикаторе и осторожного обращения.
    1. Жидкость стерилизации
      1. Налейте нужное количество семян в микро-центрифужные пробирки. Можно использовать до 20 мг (~ 800 семян) в 1,5 мл пробирку или 40 мг (~ 1600), в семенах 2 мл микро-центрифужные пробирки.
      2. Добавить 1 мл 70% этанола. Обратить или встряхните в течение 2 мин.
      3. Заменить 70% этанола с 1 мл раствора стерилизации в течение 15 мин. (Подготовка свежий раствор стерилизации: 3,85 мл гипохлорита натрия (NaOCl) акций (12%) (ВНИМАНИЕ: Используйте вытяжной шкаф), 5 мкл Tween 20, до 10 мл водой инвертировать трубок несколько раз, чтобы убедиться, что все семена приходят. в контакте с раствором.
      4. В ламинарного шкафа воздушного потока, заменить стерилизации раствора с 1 мл стерильной дистиллированной воды и промыть семена 5 раз в течение 5 мин при повторномLY заменяя 1 мл свежей стерильной дистиллированной воды.
    2. Газ Стерилизация
      1. Налейте нужное количество семян в 2 мл микро-центрифужную пробирку. Используйте отдельные трубы при работе с несколькими независимыми линиями, а также организовать их открыл в пластиковой коробке микро-центрифуги трубы или владельца. Если количество семян в одной пробирке превышает 500 (12,5 мг), подразделяют семена в соответствующем количестве трубок, чтобы обеспечить успешную стерилизацию. Убедитесь, что крышки соседних труб не покрывают друг друга. Совмещаются крышку коробки на дне, как это должно быть в эксикаторе, а также для стерилизации.
      2. Поместите коробку в миску эксикаторе, наряду с стеклянный стакан (ВНИМАНИЕ: Используйте вытяжной шкаф).
      3. Заполните стакан с 100 мл 12% NaOCl (ВНИМАНИЕ: Используйте вытяжной шкаф). Положите крышку на эксикаторе, но оставить небольшое отверстие, где стакан помещается.
      4. Добавьте 3 мл 37% соляной кислоты (дымящей) (ЦАСАЦИИ: Используйте вытяжной шкаф) в стакане через небольшое отверстие и быстро закрыть эксикаторе. Решение будет пузыриться в течение некоторого времени из-за образования Cl 2 -gas. Оставьте систему закрыт O / N (или, по крайней мере 8 ч).
      5. Снимите крышку эксикаторе. Выньте коробку и закройте его крышкой, чтобы избежать загрязнения во время транспортировки.
      6. Поставьте флажок в ламинарном шкафу воздушного потока, снимите крышку и оставьте семена в течение приблизительно 1 часа при комнатной температуре, чтобы позволить выпуск газа.
        Примечание: Семена можно безопасно хранить в сухом в закрытых микро-центрифужные пробирки до 2 недель при температуре 4 ° С.
  2. Боковые Корень Индукция в Arabidopsis
    1. Боковые Корень Ингибирование (НПД Лечение)
      1. Подготовьте питательную среду для роста в пробирке. Среда содержит половинной крепости Murashige и Skoog смесь солей 15, 0,1 г / л мио-инозит, 10 г / л сахарозы, и буферизуется с 0,5г / л 2- (N-морфолино) этансульфоновой кислоты (MES).
      2. Отрегулируйте рН до 5,7 с помощью 1 М КОН. Добавить 8 г / л агара тканей растений и автоклав среды в течение 20 мин при 121 ° С.
      3. Подготовка 25 мМ исходного раствора в ННА диметилсульфоксид (ДМСО) (ВНИМАНИЕ: Используйте перчатки). В ламинарном шкафу потоком воздуха, охлаждение автоклавного среды до приблизительно 65 ° С (что температура, при которой бутылка может быть проведена вручную), и добавить 25 мм NPA маточного раствора с получением конечной концентрации 10 мкМ NPA.
      4. Перемешать при добавлении осторожно встряхивая бутылку в течение 10 сек. Налейте 50 мл среды на квадратный Петри (12 см х 12 см).
        Примечание: В случае крупномасштабного эксперимента, нанесите нейлоновая сетка (20 мкм), чтобы обеспечить легкую передачу. Подготовьте сетку (9 см х 9 см) для автоклавирования (рис 1А). Когда в автоклаве, применять сетку к среде роста использованием стерильных пинцетов (рис 1б). Аккуратно надавите на сетку в среду роста с помощью Sterilized drigalsky чтобы убедиться, что он находится в хорошем контакте со средой роста (рис 1B) (ВНИМАНИЕ: Работа в стерильных условиях).
      5. Сейте семена на НПД-пластин.
        Примечание: В случае, если масштабный эксперимент планируется, сеять 2 плотные и хорошо выровненных строк 50 семян, чтобы облегчить отбор проб (см 1.2.2.3).
        1. В случае жидкого стерилизации, посеять семена на NPA-пластин с использованием 200 мкл пипетки. Отрежьте 3 - 4 мм, в конце советы пипетки в стерильных условиях (или до стерилизации советы) для того, чтобы иметь возможность пипетки семена. Внесите вверх и вниз несколько раз, чтобы вновь приостановить семена, затем пипеткой примерно 150 мкл стерильной воды с 10 - 20 семян и ждать, пока осадок семян в нижней части наконечника. (ВНИМАНИЕ: Работа в стерильных условиях)
          Примечание: При нажатии на агар или сетку мягко кончиком, капля воды с семенами, будут освобождены от него (рис 1С).
        2. <LI> В случае газовой стерилизации, посеять семена с помощью автоклавного toothpicks.Pinch зубочистку в агар, прежде чем принимать семена, чтобы обеспечить липкую поверхность. Возьмите один семян по одному, используя зубочистку и распространять семена на пластинах (рис 1D). Кроме того, добавить стерильную воду на семена, и сеять, как описано в 1.2.1.5.1 (ВНИМАНИЕ: Работа в стерильных условиях).
      6. Печать пластины с дышащей клейкой ленты и хранить их пластины при 4 ° С в темноте в течение по крайней мере 2 дней и максимум на один неделю. Это необходимо для стратификации и обеспечивает синхронизированных и более эффективного прорастания.
        Примечание: В качестве альтернативы, семена могут быть стратифицированы перед посевом, погруженный в дистиллированной воде в микро-центрифуги труб, что требует меньше пространства холодильника. В этом случае, хранить трубы, по крайней мере, одной недели при 4 ° С, и перемещать панели к шкафу роста сразу же после посева (см 1.2.1.7).
        ДЕНЬ 3 Перемещение пластины к корпусу роста (непрерывный свет (110 м мкЕ -2 с -1), 21 ° С) в течение 5 дней (2 дня прорастания и 3 дня роста) в почти вертикальном положении (от 80 до 90 °) обеспечить рост корневой на, а не в среде.
        ДЕНЬ 8
    2. Боковые Корень Индукционная (НАА Лечение)
      1. Подготовка же среду для роста, как описано в 1.2.1.1 и 1.2.1.2. Подготовьте 50 мМ маточного раствора в ДМСО НАА (ВНИМАНИЕ: Используйте перчатки). Охлаждают автоклавного среды до 65 ° С и добавляют раствор NAA к среде для получения конечной концентрации 10 мкМ NAA (ВНИМАНИЕ: работа в стерильных условиях).
        1. Перемешать при добавлении осторожно встряхивая бутылку в течение 10 сек. Налейте 50 мл среды на квадратный Петри (12 см х 12 см).
      2. Передача рассаду из чашки, содержащие среду для роста с добавлением 10 мкМ NPA к тем SUPplemented 10 мкМ НУК.
        1. Крюк руки изогнутых пинцетов под семядолей проростков и осторожно удалите его из пластины. Только передать саженцы которых корни выросли совсем в контакте со средой НПД-роста и предпочтительно вниз.
        2. Обезжиренное корень над НАА среде, содержащей рост поверхности на небольшом расстоянии. Убедитесь, что корни растений находятся в хорошем контакте со средой роста. Если требуется, нажмите корень мягко среднесрочной рост поверхности с помощью пинцета.
          Примечание: В случае крупномасштабного эксперимента, удалить все саженцы, которые не находятся в контакте с сеткой и передачи путем поднятия сетки на двух верхних углах с помощью пинцета. Убедитесь, что сетка в хорошем контакте с НАА среде, содержащей по полету сетку над поверхностью агара на небольшом расстоянии (рис 1E).
      3. Печать новых пластин с дышащей ленты и поместите их в шкаф роста (CONнепрерывный свет (110 м мкЕ -2 с -1), 21 ° С) в вертикальном положении в течение требуемого времени после индукции до отбора проб.
        Примечание: В случае масштабного эксперимента, использовать скальпель, чтобы сократить корень сегментов сразу непосредственно на сетке и образец их осторожно очищая поверхность сетки.

2. LRIS Кукуруза протокол

  1. Расслоение кукурузы ядра
    1. Инкубируйте кукурузы ядра при 4 ° С в темноте в течение по меньшей мере 1 недели.
      Примечание: Этот протокол был разработан с использованием В73 кукурузы инбредной линии.
  2. Стерилизация кукурузы ядра
    1 ДЕНЬ
    Примечание: Хотя проростков кукурузы не должны быть выращены в стерильных условиях, рекомендуется для стерилизации кукурузы ядра и работать с стерильным материалом для предотвращения роста грибов в рулон бумагиСистема.
    1. Положите необходимое количество кукурузы ядер в стерилизованную стеклянную мензурку.
    2. Добавить 100 мл раствора стерилизации (6% NaOCl в воде) (ВНИМАНИЕ: Использование вытяжного шкафа).
    3. Добавить магнитной мешалкой и поместить стакан на магнитную мешалку на низкой скорости перемешивания (приблизительно 250 оборотов в минуту) при комнатной температуре в течение 5 мин.
    4. Промыть пять раз в течение 5 мин при замене раствора 100 мл свежего стерильного воды.
  3. Посев кукурузы орехов
    1. Наденьте перчатки, чтобы уменьшить риск заражения, и принимать рулон бумажных полотенец.
    2. Оторвите два отрезка бумажного полотенца руки с общей протяженностью двух листов (примерно 92 см х 24 см) и поместите их поверх друг друга на чистую поверхность (2А).
    3. Сложите листы вдвое по длине (приблизительно 92 см х 12 см) (2А).
    4. Используйте пинцет, чтобы распределить 10 ядер примерно в 2 см от верхней над Тон всей длине бумаги, сохраняя при этом внутреннее пространство 8 см между каждым ядром и 8 см свободного на обоих концах (Фигура 2В). Убедитесь, что корешок из ядра вниз и в сторону бумаги (рис 2B).
    5. Аккуратно свернуть бумагу по всей длине, сохраняя семена в месте (рис 2б). Для облегчения прокатки, это необязательно сначала распылить бумагу стерильной водой.
    6. Положите булочки бумаги в стерилизованные стеклянные трубки примерно на 6 см в диаметре и 14 см в высоту (например, 250 мл центрифужные пробирки) и поместите их в стойку (рис 2С).
  4. Боковые Корень Индукция в кукурузы
    1. Подготовьте мМ NPA маточного раствора 50 (растворенного в ДМСО) (ВНИМАНИЕ: Используйте перчатки).
    2. Для каждой трубки, сделать 50 мкм NPA решение, добавив 125 мкл из мМ NPA раствора 50 мл до 125 стерильной воды в стерилизованную стеклянную мензурку.
    3. Все хорошо перемешать изалить 125 мл 50 мкМ раствора NPA над рулона бумаги в трубе. Рулонная бумага будет поглощать решение и стать полностью всасывается.
      Примечание: При использовании рулонов бумаги и трубки с другими размерами, регулировать громкость, соответственно. Жидкость должна достичь наполовину трубки для обеспечения достаточного поглощения.
    4. Установите систему рулона бумаги в шкафу роста в течение трех дней (27 ° C, непрерывного света, 70% относительной влажности). Убедитесь, что ролики бумажные остаются пропитанной добавления дополнительных 50 мкм решение NPA, так как решение со временем испаряется (рис 2D).
      ДЕНЬ 4
    5. Подготовьте мМ НАА маточного раствора 50 (растворенного в ДМСО) (ВНИМАНИЕ: Используйте перчатки).
    6. Для каждой трубки, приготовить раствор НАА 50 мкм, добавив 125 мкл из запаса 50 мМ НАА в 125 мл стерильной воды в стерилизованную стеклянную мензурку.
    7. Осторожно выжать большую часть оставшегося раствора NPA из бумажных рулонов и местом в стерильной воде в течение 5 мин, чтобы вымыть его (ВНИМАНИЕ: Используйте перчатки). Аккуратно выдавите большая часть воды из рулонов бумаги. Повторите этот этап промывки три раза.
    8. Все хорошо перемешать и залить 50 мкм НАА раствора через рулонов бумаги в трубках. Убедитесь, что они полностью всасывается.
    9. Установите систему рулона бумаги в кабинете роста (27 ° С, непрерывное излучение, 70% относительной влажности) в течение требуемой продолжительности после индукции.
  5. Боковые Корень Индукция в Адвентивные Короны корней кукурузы
    Примечание: LRIS, как описано выше, индуцирует боковые корни в основной корень. Тем не менее, в кукурузе и других однодольных, основной корень и эмбриональных семенных корней, вместе с их боковых корней, в основном важно во время всходов развития. На более поздней стадии роста растений, пост-эмбриональные придаточные корни возникают на стебле, а также развивать боковые корни, чтобы сформировать новую корневую систему 16. LRIS также можно использоватьd, чтобы вызвать боковые корни на этих пост-эмбриональных придаточных корней коронок после некоторых незначительных корректировок в LRIS на эмбриональной первичной корня.
    1. Для того, чтобы рулоны бумаги, создать бутерброд бумаг с соответственно двух слоев бумажного полотенца руки на внешней стороне, и двух слоев бумаги для проращивания внутри. Поместите простерилизованные ядра (см шаги 2.1 до 2.2) между двумя листами бумаги для проращивания. Всхожесть бумаги, по сравнению с рукой полотенце бумаги, будет менее склонным быть пронизана корневых волосков и боковых корней, которые сделают открытие бумажных рулонов легче позже. С другой стороны, два внешних слоя бумажного полотенца стороны будет способствовать поглощению жидкости.
    2. Вставьте рулоны в 700 мл стеклянных трубок и залить стерильную воду без NPA над ними. Убедитесь, что они полностью всасывается.
    3. Прорастают стерилизованные ядра в шкафу роста (см шаг 2.4.9).
    4. Вырастить рассаду до тех придаточных корней коронокначинают появляться (6 дней для B73). Убедитесь, что ролики бумаги хранятся во влажном состоянии путем добавления стерильной воды при необходимости.
    5. Передача к раствору 25 мкМ NPA в течение 4 дней (см шаги 2.4.1 2.4.4), затем аналогичный индукции боковых корней инициации путем замены раствора NPA с 50 мкМ NAA раствора после стадии промывки (см шаг 2,4 .5 2.4.9).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Применение LRIS Выполнение сравнительных транскриптомика боковой корневого процесса инициации

Одним из применений LRIS является сравнение и сопоставление профилей экспрессии генов в процессе формирования боковых корней у разных видов. Сравнительные транскриптомика подходы создают возможность определить ортологичные генов, участвующих в процессе развития боковых корней у разных видов. Боковые корень инициация, которая состоит из формирования нового органа из подмножества клеток, содержащихся в уже сформированной корневой оси, является основным механизмом разделяют покрытосеменных контролировать их корневой архитектуры. Следовательно, это очень вероятно, что она превратилась из существующих путей, присутствующих в общего предка и сохраняется на протяжении эволюции. Действительно, общий потенциал регуляторы боковых корней инициации были найдены в различных видов <SUP> 17, 18.

Отбор материала с использованием LRIS в Arabidopsis и кукурузы, и Транскриптом анализ

LRIS была создана в двух разных видов:. Arabidopsis и кукурузы 10, 13 У обоих видов, было решено попробовать растения непосредственно перед обработкой НАА, а вскоре после индукции, в начале или в ходе реакции ауксина, а а также в начале или в течение первых делений в перицикла. Кроме того, флуоресцентный сортировка клеток (FACS 19) был использован в Arabidopsis или лазерной микроскопии захвата 20, 21 (LCM) в кукурузе, чтобы выбрать для перицикла клеток. В Arabidopsis, временные точки 2 и 6 ч после индукции были выбраны на основе транскрипции характеристике pDR5 :: GUS ответ ауксина и pCYCB1; 1 :: клеточного цикла маркерные линии GUS 9 (Рисунок 3). У кукурузы, время указывает 2, 3 и 4 часа после индукции, были выбраны после микроскопического характеристики деления клеток активностью и анализа экспрессии нескольких генов маркеров клеточного цикла с использованием в режиме реального времени количественный обратной транскрипции полимеразной цепной реакции (QRT-ПЦР) 13 , РНК экстрагировали из клеток изолированных и гибридизовали с микрочипов платформ, как описано выше 10, 13.

Поиск ортологом Arabidopsis CYCB1; 1 (AtCYCB1; 1) в кукурузы

В Arabidopsis, маркера линии pCYCB1; 1 :: GUS широко используется для отслеживания первые дивизий перицикла во боковых корней посвящения. Такой маркер будет оченьполезно в кукурузе. Несколько гомологи AtCYCB1; 1 были найдены в кукурузе (www.maizesequence.org, всех пептидов, BLASTP, настройки по умолчанию). Шесть из них были представлены на микрочипе, выполняемой после LRIS кукурузы и показали значительное обогащение. Лучший BLAST хитом, GRMZM2G310115, показали очень высокие уровни транскрипции после LRIS, подобные тому, что наблюдалось в Arabidopsis для AtCYCB1; 1 (рисунок 4).

Применение LRIS для проверки отдельных экспрессии генов

Для проверки GRMZM2G310115 как хороший кандидата ортолога AtCYCB1; 1 в боковых корней кукурузы инициации, в режиме реального времени Qrt-ПЦР на образцах, взятых в различные моменты времени проводили в течение 13 с LRIS. Растения обрабатывали, как описано в вышеупомянутой протокола и собирают в различные моменты времени: Перед NЛечение АА (НПД), и после 2, 3 и 4 ч обработки НАА. Кроме того, материал растений, выращенных только в воде собирали для сравнения экспрессии генов между LRIS и нейтральных условиях. Сразу же после сбора урожая, корневые сегменты, соответствующих области, заключенной между 5 мм и 15 мм выше кончика корня рассекали под бинокулярным. С помощью пинцета, кора была отделена от стелы (который содержит перицикла), и РНК экстрагировали из обеих тканях. Этот последний шаг был выполнен вместо LCM, потому что это гораздо быстрее и дешевле, для проверки. Использование следующий соответствующий вперед и назад Qrt-ПЦР-праймеры, AGCAGGACGCAGTTGGAGAG и GAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 была подтверждена, чтобы быть до-регулируется по LRIS, и быть специфическими для стелы тканей (рисунок 5). Кроме того, этот эксперимент показывает, что без синхронного индукции, дискретные события боковых корней начала, происходящие в корне растущий в воде не обнаружено, и иллюстрируют необходимость в LRIS раскрыть дифференциальную экспрессию генов, связанных с процессом инициации боковых корней.

Рисунок 1
Рисунок 1. Боковая Корень Индуцибельная система Arabidopsis (А) Подготовка нейлоновая сетка (20 мкм):. Вырезать нейлоновой сетки (9 см на 9 см), обернуть его в алюминиевую фольгу и положить его в стеклянный стакан для обработки в автоклаве. (Б) Применение в нейлоновую сетку на НПД-содержащего пластину (10 мкм) с помощью пинцета. Затем используйте стерильную Дригальский для того, чтобы избежать образования пузырьков воздуха. (C) Посев семян на нейлоновой сетки с помощью пипетки. (D) посев семян на нейлоновой сетки с помощью зубочистки. (Е) передать нейлоновая сетка с НАА, содержащие пластины (10 мкм) с помощью пинцета.81 / 53481fig1large.jpg "целевых =" _blank "> Нажмите здесь, чтобы посмотреть большую версию этой фигуры.

фигура 2
Рисунок 2. Боковой Корень Индуцибельная система кукурузы.   (А) Подготовка рулонов бумаги: Место два слоя бумаги (92 см х 24 см, длина из двух листов) на верхней части друг с другом и свернуть их в два раза по длине (92 см х 12 см). (Б) Поставьте 10 стерилизованных кукурузы ядра с корешком вниз на бумаге в 2 см от верхней с interspacing 8 см. Затем сверните бумагу при сохранении кукурузы ядра на месте. (С) Поместите бумажные рулоны в трубах (например, 250 мл центрифужные пробирки) и положить их в стойку. (D), Расти кукурузы саженцев в течение трех дней в 50 мкМ раствора NPA (на 27 ° С, непрерывное излучение, относительная HUMIDity 70%). (Е) Слева: Рассада только до передачи НАА; Средний: Микротом поперечные сечения как раз перед переходом на НАА и 2 дней после передачи НАА; Справа:. Саженцев с видимыми появившихся боковых корней 5 дней после передачи НАА Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Рисунок 3
Рисунок 3. Боковая Корень Посвящение Вынужденное при длительном процессе НАА Лечение. (АФ), показывающие время ответа ауксина во время лечения НАА, используя pDR5 :: GUS маркерный линию. Реакция ауксина, который является одним из первых событий, вызывающих боковых корней инициацию, начинает 2 ч после начала лечения НАА. В верхней панели, обзор всей рассады дается; нижняя панель шоуS ответ ауксина в кончике корня. (GM) Время курс лечения в НАА с помощью pCYCB1; 1 :: GUS линия маркера. Сигнал GUS представляет экспрессию CYCB1; 1 гена, указывая, что первые деления клеток, ведущие к образованию боковых корней начать 6 ч после начала лечения НАА. В верхней панели, обзор всей рассады дается; нижняя панель показывает CYCB1;. 1 выражение в кончике корня (окрашивания GUS в соответствии с Beeckman и Энглер, 1994 22) Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Рисунок 4
Рисунок 4. Выражение Профиль CYCB1 генов в Arabidopsis и кукурузы во время LRIS.   (А) значения экспрессии микрочипов на AtCYCB1; 1 во LRIS как описано De Smet др. 2008 10 (В) микрочипов значения экспрессии потенциальных Ортологи AtCYCB1; 1 во LRIS как описано Янсен и др. 2 013 13 BLASTP оценка является оценка получается при взрывных последовательность белка AtCYCB1; 1 на кукурузы генома. Усы выразить стандартное отклонение и ** означает р -Value ≤0.01. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Рисунок 5
Рисунок 5. Экспрессия GRMZM2G310115 в Стелы и коры кукурузы Roots во LRIS. Выражение <EM> GRMZM2G310115 во LRIS кукурузы оценивали количественными реальном времени ПЦР QRT-на расчлененных стелы и коры образцов. Дополнительный отбор проводили на растений, выращенных на воде. Значения были нормализованы для экспрессии в стеле в воде. Усы выразить стандартное отклонение и ** означает р -Value ≤0.01 (праймеров и справочные генов в соответствии с Янсен и др. 2013 13). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

В протоколе Arabidopsis LRIS, важно, чтобы передать только рассаду, которые выросли совершенно в контакте с НПД-содержащей среде роста. Это гарантирует, что инициирования боковых корней заблокирован по всей длине корневого. Для того, чтобы предотвратить ранив ростки Во время передачи вооружений изогнутых щипцов может быть подключен в соответствии с семядолей проростков. При передаче, убедитесь, что корни рассады в достаточной контакте с НАА-агар, содержащий среды. Это может быть достигнуто путем скользя корень на поверхность агара в течение небольшом расстоянии. Это обеспечит эффективное синхронизированный индукцию боковых корней начала по всей длине корня. Корни могут быть выращены на свету без ущерба для их роста и боковой корень индукции.

В протоколе кукурузы LRIS, важно, что корешок ядра обращена вниз и в сторону бумаги, чтобы обеспечить корень будет расти Downwards и приложить к бумаге при правильной стороне 16. После трех дней лечения NPA, саженцы должны появились из ядра с небольшим стрелять, основной корень и семенных корней 16. Основной корень должен быть приблизительно 2 см длиной, прежде чем приступить к индукции боковых корней инициации. Этот протокол был разработан с использованием В73 кукурузы инбредной линии, но и в случае линии кукурузы с разной скоростью роста, регулировать время инкубации соответственно. Убедитесь, что ролики бумажные остаются пропитанные добавлением регулярно 50 мкм решение NPA, когда жидкость испаряется в течение долгого времени, в противном случае лечение может быть NPA может произойти неэффективным и нежелательным раннее развитие боковых корней. Сама система предотвращает экспозицию корней на свет, но свет не является основным вопросом и не влияет на рост корневой системы и боковых корней индукции.

Альтернативные способы для контролируемой индукции боковых корней использование тесhanical изгиба 23 или 24 gravistimulation. Основное преимущество этих систем состоит в том, что они имеют более "естественный" индукцию по сравнению с гормональной терапии в LRIS, но недостатком является то, что они ограничены в количестве материала, который может быть собран в данный момент времени, потому что они только выход один боковой событие корень инициации в излучине на рассады по сравнению с полной индукции перицикла в LRIS.

LRIS используется в Arabidopsis и кукурузы могут быть использованы в различных растений, хотя благоприятные условия должны быть оптимизированы. Чтобы установить LRIS, два важных последовательные шаги должны быть достигнуты: (1) блокирование транспортировки ауксина и (2) накопления ауксина, чтобы вызвать возбуждение боковых корней. Растущий система должна позволять эффективное и равномерное поглощение соединений и должны допускать хорошее развитие проростков. Альтернативные системы в твердой среде (Arabidopsis) и бумажных рулонов (кукуруза), такой как жидкий культуры, гидропоника или аэропоники, могут быть использованы для других видов. На первом этапе в LRIS, т.е. блокирование транспортировки ауксина, может быть достигнуто путем добавления ингибитора транспортировки ауксина. Хотя НПД приводит к эффективному блока боковых корней Arabidopsis инициации в кукурузе, и альтернативные соединения, такие как 2,3,5-triiodobenzoic кислоты (ТИБА) или п-chlorophenoxyisobutyric кислоты (PCIB) у других видов может работать лучше. Подобная оптимизация может быть сделано для второй стадии LRIS, т.е. ауксина лечения. Синтетический ауксин НАА, кажется, наиболее подходит для LRIS. Ауксина предшественником индол-3-бутановой кислоты (МАА) может быть хорошей альтернативой, поскольку она также сильно индуцирует боковые корни и имеет высокую биологическую активность в различных растений 25, 26. С другой стороны, естественное ауксина индол-3-уксусной кислоты (МАА) является менее стабильной и более легко метаболизируется 27, рационализации его более слабый эффект на корневой развитие в например, кукуруза или рис 25, 26. Синтетический ауксин 2,4-дихлорфеноксиуксусной кислоты (2,4D) накапливается в высокой перицикла клеток, отчасти потому, что не экспортируется из клеток 28, ухудшая надлежащего боковых корней инициацию и вызывая искусственный слитые конструкции. Также другие соединения, взаимодействующие с ауксина путей, таких как naxillin 12, как было показано, чтобы вызвать боковых корней Arabidopsis инициацию в и может быть испытан в других видах.

В некоторых случаях, прорастание неэффективно в присутствии NPA и можно выбрать сначала прорастают семена при отсутствии NPA, чтобы впоследствии передать рассаду в НПД-содержащей системы. Это вызывает возможный риск, связанный с раннего боковые корневые зачатки, начатых до боковых корней индукции лечения НАА и, следовательно, важно, чтобы только попробовать область корня, что вытянутой во время лечения NPA. После этого общей стратегии, один шоÜLD сможет оптимизировать LRIS практически любого числа (начального) завода и, таким образом иметь простую систему для изучения развитие боковых корней для завода интереса. Дальнейшая характеристика сроков боковых корней начала может произойти через маркерных линий, в качестве примера для Arabidopsis. Если маркер линии трудно получить подробное гистологическое исследование могло быть сделано, но это требует много времени и первые деления клеток не легко узнаваемы. Кроме того, анализ экспрессии клеточного деления маркеров может быть использован для указания на сроки первых клеточных делений.

LRIS могут быть использованы для различных целей, таких как транскриптома анализа 9-13, как кратко описаны в результатах, а также гистологических наблюдений на макро- и микроскопическом уровне в течение боковых корней начала 14. Различные типы выборки, начиная от органа к шкале клеток 29, возможно, позволяют разгадке различные аспекты позжеаль корень начало. Кроме того, LRIS могут быть использованы для мониторинга эффекта различных соединений на боковых корней инициации 12, 30. Наконец, с помощью репортерных линий, А LRIS также может быть легко использованы для характеристики экспрессии генов и / или локализации белка во боковое развитие корней.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрывать.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
Боковые Корень Индуцибельная системы в<em&gt; Arabidopsis</em&gt; И кукурузы
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter