Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Laterale Root Induceerbare System in doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Het wortelstelsel is cruciaal voor de groei van planten, omdat het zorgt voor verankering en opname van water en voedingsstoffen uit de bodem. Door de uitbreiding van een wortelstelsel berust voornamelijk op de productie van zijwortels, de initiatie en vorming zijn uitgebreid onderzocht. Zijwortels worden geïnitieerd in een bepaalde subgroep van pericycluscellen, de zogenaamde stichter cellen 1. In de meeste tweezaadlobbigen, zoals Arabidopsis thaliana, wordt deze cellen zich aan de protoxyleem polen 2, terwijl in eenzaadlobbigen zoals maïs, worden zij vinden in het floëem polen 3. Founder cellen worden gekenmerkt door een verhoogde auxine respons 4, gevolgd door expressie van specifieke genen celcyclus (bv CYCLIN B1; 1 / CYCB1, 1), waarna zij ondergaan een eerste ronde van asymmetrische anticlinale gebieden 5. Na een reeks gecoördineerde anticlinale en periclinale divisies, wordt een laterale wortel primordium gevormd die uiteindelijk zal ontstaan ​​als eenutonomous laterale wortel. De locatie en het tijdstip van zijwortelinitiatie zijn echter niet voorspelbaar, omdat deze gebeurtenissen noch overvloedig noch gesynchroniseerd. Dit belemmert de toepassing van moleculaire methoden zoals transcriptomics dit proces te bestuderen.

Om dit aan te pakken, is een zijwortelinitiatie induceren systeem (LRIS) ontwikkeld 6, 7. In dit systeem worden zaailingen eerst behandeld met N -1-naphthylphthalamic acid (NPA), die auxinetransport en accumulatie remt derhalve blokkeren zijwortelinitiatie 8. Door vervolgens de overdracht van de zaailing op medium dat de synthetische auxine 1-naftaleen azijnzuur (NAA), het hele pericyclus laag reageert op de verhoogde auxine niveaus waardoor massaal inducerende laterale wortel initiëren celdelingen 6. Als zodanig is dit systeem leidt tot een snelle, synchrone en uitgebreide zijwortels initiaties, waardoor u gemakkelijk verzamelen van wortel monsters verrijkt voor een bepaalde fase van de lateral wortelontwikkeling. Vervolgens kunnen deze monsters worden gebruikt om genoom-wijde expressie profielen tijdens zijwortelvorming bepalen. De LRIS heeft reeds aanzienlijke kennis zijwortelinitiatie in Arabidopsis en maïs 9-13, maar de noodzaak leverde dit systeem voor andere plantensoorten wordt duidelijker naarmate meer genomen worden gesequenced en er is een toenemende belangstelling kennis dragen aan economisch belangrijke species.

Hier, de gedetailleerde protocollen van het Arabidopsis en maïs LRISs worden gegeven. Vervolgens wordt een voorbeeld van het gebruik van het systeem verschaft, door illustreren hoe transcriptomics data afkomstig van maïs LRIS kan worden gebruikt om functionele homologen die een geconserveerd functioneel tijdens zijwortelinitiatie in verschillende plantensoorten te identificeren. Tenslotte richtlijnen om de LRIS optimaliseren voor andere plantensoorten worden voorgesteld.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Arabidopsis LRIS Protocol

Opmerking: De tekst verwijst naar "kleine" of "grote" grootschalige experimenten. Kleinschalige experimenten, zoals marker line analyse en histologische kleuring 6, 14, vereisen slechts een paar voorbeelden. Grootschalige experimenten, zoals kwantitatieve real-time qRT-PCR, micro-arrays 11/09 of RNA sequentie, vereist een groter aantal monsters. Als zodanig een hoeveelheid van ~ 1000 zaailingen per monster werd door Vanneste et al. 11 microarray experiment voeren na wortel segment dissectie.

DAG 1

  1. Sterilisatie van Arabidopsis zaden
    Opmerking: Selecteer een van de volgende procedures voor zaad sterilisatie. Een van hen is geschikt voor de volgende stappen van het protocol. Gas sterilisatie (1.1.2) biedt twee belangrijke voordelen ten opzichte van vloeibare sterilisatie (1.1.1): het kost minder tijd bij het hanteren van een grote gevoellozeer zaden, aangezien geen pipetteren te treden voor de individuele monsters; en de gesteriliseerde zaden worden opgeslagen gedurende langere tijd. Het vereist echter een exsiccator en zorgvuldige behandeling.
    1. Vloeibare sterilisatie
      1. Giet het gewenste aantal zaden in de micro-centrifuge buizen. Gebruik maximaal 20 mg (~ 800 zaden) in een 1,5 ml buis of 40 mg (~ 1600 zaden) in een 2 ml micro-centrifugebuizen.
      2. Voeg 1 ml van 70% ethanol. Omkeren of schud gedurende 2 minuten.
      3. Vervang de 70% ethanol met 1 ml sterilisatie oplossing 15 min. (Bereid verse sterilisatie oplossing: 3,85 ml natriumhypochloriet (NaOCl) voorraad (12%) (LET OP: Gebruik zuurkast), 5 ul Tween 20, tot 10 ml met water Inverteer de buizen meerdere malen om ervoor te zorgen dat alle zaden komen. in contact met de oplossing.
      4. In een laminaire luchtstroom kabinet, vervang de sterilisatie-oplossing met 1 ml steriel gedestilleerd water en spoel de zaden 5 keer gedurende 5 minuten door herhaaldelijkly vervangen door 1 ml vers steriel gedistilleerd water.
    2. Gas Sterilisatie
      1. Giet het gewenste aantal zaden in een 2 ml micro-centrifugebuis. Gebruik afzonderlijke buizen bij het werken met verschillende onafhankelijke lijnen, en schik ze geopend in een plastic micro-centrifuge buizen doos of houder. Als het aantal zaden in één buis dan 500 (12,5 mg), verdelen de zaden in het juiste aantal buizen succesvolle sterilisatie te verzekeren. Zorg ervoor dat de doppen van de naburige buizen hebben geen betrekking op elkaar. Breng samen het deksel van de doos aan de onderzijde, aangezien hiervoor in de exsiccator ook voor sterilisatie.
      2. Plaats de doos in de kom van een exsiccator, samen met een bekerglas (LET OP: Gebruik zuurkast).
      3. Vul de beker met 100 ml 12% NaOCl (LET OP: Gebruik zuurkast). Doe de deksel op de exsiccator, maar laat een kleine opening waar de beker wordt geplaatst.
      4. Voeg 3 ml 37% zoutzuur (rokend) (CAUTIE: Gebruik zuurkast) aan de beker door de kleine opening en snel te sluiten de exsiccator. De oplossing zal bubbel voor enige tijd als gevolg van Cl 2 -gas formatie. Laat het systeem gesloten O / N (of tenminste 8 uur).
      5. Verwijder het deksel van de exsiccator. Neem de doos en bedek het met de deksel om besmetting tijdens het transport te voorkomen.
      6. Zet de doos in een laminaire luchtstroom kabinet, verwijder het deksel en laat de zaden gedurende ongeveer 1 uur bij RT om gas vrijlating toe te staan.
        Opmerking: Zaden kan veilig droog in gesloten micro-centrifuge buizen worden opgeslagen voor maximaal 2 weken bij 4 ° C.
  2. Laterale Root inductie in Arabidopsis
    1. Laterale Root Remming (NPA Treatment)
      1. Bereid groeimedium voor in vitro groei. Het medium bevat halve sterkte Murashige en Skoog zoutmengsel 15, 0,1 g / L myo-inositol, 10 g / l sucrose, en gebufferd met 0,5g / L 2- (N-morfolino) ethaansulfonzuur (MES).
      2. Breng de pH op 5,7 met 1 M KOH. Voeg 8 g / l agar plantenweefsel autoclaaf en het medium 20 minuten bij 121 ° C.
      3. Bereid een 25 mM voorraad oplossing van NPA in dimethylsulfoxide (DMSO) (LET OP: Gebruik handschoenen). In een laminaire flowkast Koel de geautoclaveerde medium tot ca. 65 ° C (dat is de temperatuur waarbij de fles kan worden vastgehouden met de hand) en voeg 25 mM NPA voorraadoplossing om een ​​eindconcentratie van 10 uM NPA verkrijgen.
      4. Homogeniseren na toevoeging door voorzichtig schudden van de fles voor 10 sec. Giet 50 ml medium per vierkante petrischaal (12 cm x 12 cm).
        Opmerking: In het geval van grootschalige experiment, breng dan een nylon mesh (20 micrometer) om gemakkelijke overdracht te waarborgen. Bereid een maas (9 cm x 9 cm) voor autoclaaf (Figuur 1A). Bij geautoclaveerd Breng het gaas aan het groeimedium met steriele pincet (Figuur 1B). Duw het gaas aan het groeimedium met een sterilized drigalsky om ervoor te zorgen dat het in goed contact met het groeimedium (Figuur 1B) (LET OP: Werk in steriele omstandigheden).
      5. Zaai de zaden op de NPA-platen.
        Opmerking: In het geval van een grootschalig experiment is gepland, zaaien 2 dichte en goed uitgelijnd rijen van 50 zaden van de bemonstering te vergemakkelijken (zie 1.2.2.3).
        1. In het geval van vloeibare sterilisatie, zaaien de zaden op NPA-platen met behulp van een 200 ul pipet. Snij 3 - 4 mm van het uiteinde van de tips pipetteren in steriele omstandigheden (of vóór sterilisatie van de uiteinden) om te kunnen de zaden pipetteren. Pipet op en neer een paar keer opnieuw op te schorten de zaden, dan pipet ongeveer 150 ul steriel water met 10-20 zaden en wacht tot de zaden sediment aan de onderkant van de tip. (LET OP: Werk in steriele omstandigheden)
          Opmerking: Bij het ​​aanraken van de agar of het gaas voorzichtig met de punt, zal een druppel water met een zaadje worden vrijgesteld van deze (figuur 1C).
        2. <li> In het geval van gas sterilisatie, zaaien met behulp van een autoclaaf toothpicks.Pinch de tandenstoker in het agar voordat de zaden tot een kleverige oppervlak te garanderen. Pick-up van de zaden één voor één met de tandenstoker en verdeel de zaden op de platen (figuur 1D). Als alternatief, voeg steriel water om de zaden en zaaien, zoals beschreven in 1.2.1.5.1 (LET OP: Werk in steriele omstandigheden).
      6. Dicht de platen met ademende plakband en opslaan platen bij 4 ° C in het donker gedurende minstens 2 dagen en ten hoogste één week. Dit is nodig voor stratificatie en garandeert gesynchroniseerd en efficiënter kieming.
        Opmerking: Als alternatief kan zaden worden gestratificeerd voor het zaaien, ondergedompeld in gedestilleerd water in de micro-centrifuge buizen, die minder koelkast ruimte vereist. In dit geval slaan de buizen gedurende ten minste één week bij 4 ° C, en zet de platen om de groeikast onmiddellijk na het zaaien (zie 1.2.1.7).
        DAG 3 Verplaats de platen om de groei kast (continu licht (110 uE m -2 s -1), 21 ° C) gedurende 5 dagen (2 dagen na kieming en 3 dagen groei) in een nagenoeg verticale positie (80 tot 90 °) root groei, en niet in het medium te verzekeren.
        DAG 8
    2. Laterale Root Inductie (NAA Treatment)
      1. Bereid hetzelfde groeimedium zoals beschreven in 1.2.1.1 en 1.2.1.2. Bereid een 50 mM voorraad oplossing van NAA in DMSO (LET OP: Gebruik handschoenen). Koel het geautoclaveerde medium tot aan 65 ° C en voeg NAA oplossing aan het medium tot een uiteindelijke concentratie van 10 uM NAA verkrijgen (LET werkzaamheden steriele omstandigheden).
        1. Homogeniseren na toevoeging door voorzichtig schudden van de fles voor 10 sec. Giet 50 ml medium per vierkante petrischaal (12 cm x 12 cm).
      2. Breng de zaailingen van de platen met kweekmedium, aangevuld met 10 pM NPA die supvuld met 10 uM NAA.
        1. Haak de armen van gebogen pincet onder de zaadlobben van de zaailingen en verwijder het voorzichtig van de plaat. Slechts overdracht zaailingen waarvan de wortels gegroeid geheel in contact met de NPA-groeimedium bij voorkeur beneden.
        2. Schep de wortel over de NAA-bevattend groeimedium oppervlak over een kleine afstand. Zorg ervoor dat de plantenwortels in goed contact met het groeimedium. Indien nodig, druk op de wortel zachtjes aan het groeimedium oppervlak met de pincet.
          Opmerking: Bij een grootschalig experiment, verwijder alle zaailingen die niet in contact met de maas en de overdracht door het opheffen van de maas bij de twee bovenhoeken met een pincet. Zorg ervoor dat het gaas is in goed contact met de NAA-bevattend medium door het afromen van de mazen in de agar oppervlak over een kleine afstand (figuur 1E).
      3. Verzegeling van de nieuwe platen met ademende tape en plaats ze in de groei kast (concontinu licht (110 uE m -2 s -1), 21 ° C) in een verticale positie voor de gewenste na inductie tot bemonstering.
        Opmerking: Bij een grootschalig experiment gebruikt een scalpel om de wortelsegmenten ineens direct aan de maas gesneden en proeven ze door voorzichtig schrapen van het oppervlak van het gaas.

2. LRIS Maïs Protocol

  1. Gelaagdheid van maïskorrels
    1. Incubeer de maïskorrels bij 4 ° C in het donker gedurende ten minste 1 week.
      Opmerking: Dit protocol is ontwikkeld met behulp van de B73 maïs inteeltlijn.
  2. Sterilisatie van maïskorrels
    DAG 1
    Noot: Hoewel maïszaailingen niet te worden gekweekt in steriele omstandigheden, wordt aanbevolen de maïskorrels steriliseren en met steriel materiaal schimmelgroei in de papierrol te voorkomensysteem.
    1. De nodige aantal maïskorrels in een gesteriliseerde glazen beker.
    2. Voeg 100 ml van de sterilisatie-oplossing (6% NaOCl in water) (LET OP: Gebruik zuurkast).
    3. Voeg een magnetische roerstaaf en plaats de beker op een magnetische roerder bij lage roersnelheid (ongeveer 250 rpm) bij kamertemperatuur gedurende 5 min.
    4. Spoel vijf keer gedurende 5 min door vervanging van de oplossing met 100 ml vers steriel water.
  3. Zaaien maïskorrels
    1. Doe handschoenen om de kans op besmetting te verminderen, en neem een ​​rol papier handdoeken.
    2. Scheur twee stukken van de handdoek papier met een totale lengte van twee bladen (ongeveer 92 cm x 24 cm) en leg ze op de top van elkaar op een schoon oppervlak (Figuur 2A).
    3. Vouw de vellen verdubbelen over de lengte (ongeveer 92 cm x 12 cm) (Figuur 2A).
    4. Gebruik een pincet om 10 pitten verspreiden op ongeveer 2 cm van de top over tHij gehele lengte van het papier, terwijl bij beide uiteinden (figuur 2B) houden een tussenruimte van 8 cm tussen elke korrel en 8 cm. Zorg ervoor dat het worteltje van de kernel wordt naar beneden en in de richting van het papier (Figuur 2B).
    5. Schud het papier over de lengte, terwijl de zaden in plaats (Figuur 2B). Om de rollen te vergemakkelijken, is het optioneel om eerst spuiten het papier met steriel water.
    6. Plaats de papierrollen in gesteriliseerde glazen buizen van ongeveer 6 cm diameter en 14 cm hoogte (bijvoorbeeld 250 ml centrifugebuizen) en plaats ze in een rek (figuur 2C).
  4. Laterale Root Inductie in Maize
    1. Bereid een 50 mM NPA stockoplossing (opgelost in DMSO) (LET OP: Gebruik handschoenen).
    2. Voor elke buis, maken 50 uM NPA door toevoeging van 125 ul van de 50 mM voorraadoplossing NPA aan 125 ml steriel water in een gesteriliseerde glazen beker.
    3. Meng goed enGiet 125 ml van de 50 uM NPA oplossing over de papierrol in de buis. De papierrol zal de oplossing te absorberen en wordt volledig doorweekt.
      Opmerking: Bij het ​​gebruik van papierrollen en buizen met andere dimensies, het volume aanpassen dienovereenkomstig. De vloeistof moet halverwege de buis te bereiken om voldoende opname te garanderen.
    4. Plaats de papierrol systeem een ​​groeikast drie dagen (27 ° C, continu licht, 70% relatieve vochtigheid). Zorg ervoor dat de papierrollen blijven doorweekt door het toevoegen van extra 50 uM NPA oplossing, omdat de oplossing verdampt in de tijd (Figuur 2D).
      DAG 4
    5. Bereid een 50 mM NAA stockoplossing (opgelost in DMSO) (LET OP: Gebruik handschoenen).
    6. Voor elke buis, bereiden een 50 uM NAA oplossing door het toevoegen van 125 pi van de 50 mM NAA voorraad tot 125 ml steriel water in een gesteriliseerde glazen beker.
    7. Knijp het grootste deel van de resterende NPA oplossing uit de papierrollen en plaats dem in steriel water gedurende 5 minuten om het te wassen (LET OP: Gebruik handschoenen). Knijp het grootste deel van het water uit de papierrollen. Herhaal deze wasstap driemaal.
    8. Meng goed en giet de 50 uM NAA oplossing over de papierrollen in de buizen. Zorg ervoor dat ze volledig doorweekt.
    9. Plaats de papierrol systeem de groei cabinet (27 ° C, continu licht, 70% relatieve vochtigheid) voor de gewenste tijdsduur na inductie.
  5. Laterale Root Inductie in Onvoorziene Kroon Wortels van maïs
    Opmerking: De LRIS hierboven beschreven induceert zijwortels in de primaire wortel. In maïs en andere eenzaadlobbigen, de primaire wortel en de embryonale rudimentaire wortels, samen met hun laterale wortels, zijn vooral belangrijk tijdens zaailing ontwikkeling. In een later stadium van de plantengroei, de post-embryonale bijwortels ontstaan ​​van de voor- en tevens zijwortels een nieuw wortelstelsel 16 vormen te ontwikkelen. De LRIS kan ook gebruik wordend laterale wortels op deze post-embryonale onvoorziene kroon wortels veroorzaken door het volgen van enkele kleine aanpassingen aan de IRIS zijn op de embryonale primaire wortel.
    1. Om de papierrollen te maken, maakt u een sandwich van documenten met respectievelijk twee lagen handdoek papier aan de buitenzijde, en twee lagen van kieming papier binnen. Plaats de gesteriliseerde kernels (zie stap 2.1 en 2.2) tussen de twee vellen papier kiemkracht. Kieming papier, tegenover handdoekpapier, zal minder snel worden gepenetreerd door wortelharen en zijwortels, die zal de opening van de papierrollen gemakkelijker later. Anderzijds zullen de twee externe lagen van handdoekpapier absorptie van de vloeistof te vergemakkelijken.
    2. Steek de rollen in 700 ml glazen buizen en giet steriel water zonder NPA over hen. Zorg ervoor dat ze volledig doorweekt.
    3. Ontkiemen van de gesteriliseerde pitten in de groei kast (zie stap 2.4.9).
    4. Groeien de zaailingen tot de onvoorziene kroon wortelsbeginnen te ontstaan ​​(6 dagen voor B73). Zorg ervoor dat de papierrollen zijn te allen tijde nat gehouden door het toevoegen van steriel water wanneer dat nodig is.
    5. Verwijzing naar een 25 pM oplossing NPA 4 dagen (zie stap 2.4.1 tot 2.4.4), gevolgd door een soortgelijke inductie van zijwortelinitiatie door vervanging van de NPA-oplossing met een 50 uM NAA oplossing na een wasstap (zie stap 2,4 0,5 tot 2.4.9).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Toepassing van de LRIS te presteren Vergelijkende Transcriptomics van de zijwortelinitiatie Process

Een toepassing van de LRIS de vergelijking en correlatie van genexpressieprofielen in laterale wortelvorming in verschillende soorten. Vergelijkende transcriptomics benadert maken van de mogelijkheid om orthologe genen die betrokken zijn in de laterale wortelontwikkeling proces in verschillende soorten lokaliseren. Zijwortelinitiatie, dat bestaat uit de vorming van een nieuwe orgaan bij een subset van cellen in een reeds gevormde wortel as, is het belangrijkste mechanisme gedeeld door angiosperms hun wortelarchitectuur regelen. Bijgevolg is het zeer waarschijnlijk dat het geëvolueerd van bestaande trajecten aanwezig in een gemeenschappelijke voorouder en is geconserveerd doorheen de evolutie. Inderdaad, hebben gemeenschappelijke potentiële regulatoren van zijwortelinitiatie gevonden in verschillende soorten <sup> 17, 18.

Bemonstering materiaal met behulp van de LRIS in Arabidopsis en maïs, en Transcriptome Analyse

Het LRIS is vastgesteld in twee verschillende soorten:. Arabidopsis en maïs 10, 13 in beide species, werd besloten de planten proeven net voor NAA behandeling en kort na inductie, bij het ​​begin van of tijdens de auxine respons, zoals alsmede bij het begin van of tijdens de eerste compartimenten in de pericyclus. Bovendien Fluorescentie Activated Cell Sorting 19 (FACS) werd gebruikt in Arabidopsis of Laser Capture Microscopie 20, 21 (LCM) in maïs om te selecteren op pericycluscellen. In Arabidopsis zijn de tijdstippen van 2 en 6 uur na inductie gekozen op basis van de karakterisering van de transcriptionele pDR5 :: GUS auxine respons en pCYCB1; 1 :: GUS marker celcyclus lijnen 9 (figuur 3). In maïs, de tijdstippen 2, 3 en 4 uur na inductie werden geselecteerd na microscopische karakterisering van celdeling activiteit en de analyse van verschillende celcyclus markergenen expressie met behulp van real-time kwantitatieve reverse transcriptie-polymerase kettingreactie (qRT-PCR) 13 . RNA werd geëxtraheerd uit de geïsoleerde cellen en gehybridiseerd op microarray platforms zoals eerder beschreven 10, 13.

Het vinden van de Ortholoog van Arabidopsis CYCB1; 1 (AtCYCB1; 1) in maïs

In Arabidopsis, de markering lijn pCYCB1; 1 :: GUS is op grote schaal gebruikt om de eerste afdelingen van de pericyclus tijdens zijwortelinitiatie volgen. Dergelijke marker zou erg zijnnuttig in maïs. Verschillende homologen van AtCYCB1; 1 werden gevonden in maïs (www.maizesequence.org, alle peptiden, BLASTP, standaardinstellingen). Zes daarvan waren aanwezig op de microarray uitgevoerd na LRIS in mais en significante verrijking. De beste BLAST hit, GRMZM2G310115, vertoonden zeer hoge transcriptieniveaus na LRIS, vergelijkbaar met wat in Arabidopsis werd waargenomen voor AtCYCB1; 1 (Figuur 4).

Toepassing van de LRIS te controleren Individuele Gene Expression

Om GRMZM2G310115 valideren als een goede kandidaat ortholoog van AtCYCB1; 1 in maïs zijwortelinitiatie, een real-time qRT-PCR op monsters genomen op verschillende tijdstippen werd uitgevoerd in de loop van een LRIS 13. Planten werden behandeld zoals beschreven in het bovengenoemde protocol en geoogst op verschillende tijdstippen: voor NAA behandeling (NPA) en na 2, 3 en 4 h NAA behandeling. Ook materiaal van planten gekweekt alleen in water werd geoogst om genexpressie vergelijken tussen LRIS en neutrale omstandigheden. Onmiddellijk na de oogst, wortelsegmenten overeenkomend met een gebied tussen 5 mm en 15 mm boven de worteltop werden ontleed onder het binoculair. Met een pincet, werd de cortex gescheiden van de stele (die pericyclus bevat) en RNA werd geëxtraheerd uit beide weefsels. Deze laatste stap werd uitgevoerd in plaats van LCM, omdat het veel sneller en goedkoper te valideren. De volgende respectieve voorwaartse en omgekeerde qRT-PCR-primers, AGCAGGACGCAGTTGGAGAG en GAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 werd gevalideerd om up-gereguleerd op LRIS, en specifiek voor de zuil weefsels (figuur 5) zijn. Bovendien toont dit experiment dat zonder synchrone inductie, de discrete gebeurtenissen van zijwortelinitiatie gebeurt binnen de stam groeien in water niet waarneembaar en illustreren de behoefte van de LRIS om differentiële genexpressie in verband met het proces van zijwortelinitiatie onthullen.

Figuur 1
Figuur 1. Laterale Root Inducible System voor Arabidopsis (A) voorbereiden nylon mesh (20 micrometer). Snijd de nylon mesh (9 cm bij 9 cm), wikkel het in aluminiumfolie en zet het in een glazen beker voor autoclaaf. (B) Breng de nylon mesh op NPA-bevattende plaat (10 uM) met een pincet. Maak dan gebruik van een steriele Drigalski om luchtbellen te verwijderen. (C) Het zaaien van zaden op de nylon mesh met behulp van een pipet. (D) Het zaaien van zaden op de nylon mesh met behulp van een tandenstoker. (E) Breng de nylon mesh om een-NAA bevattende plaat (10 uM) met een pincet.81 / 53481fig1large.jpg "target =" _ blank "> Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2. Laterale Root Inducible System voor maïs.   (A) voorbereiden papierrollen: twee lagen papier (92 cm x 24 cm, lengte van twee vellen) boven op elkaar en vouw ze dubbel over de lengte (92 cm x 12 cm). (B) Plaats 10 gesteriliseerd maïskorrels de kiemwortel naar beneden op het papier 2 cm vanaf de top met een tussenruimte van 8 cm. Rol dan het papier terwijl de maïskorrels in de plaats. (C) Plaats de papierrollen in buizen (bijvoorbeeld 250 ml centrifugebuizen) en zet ze in een rek. (D) Groei van de maïs zaailingen voor drie dagen in een 50 uM NPA-oplossing (bij 27 ° C, continu licht, relatieve humidity 70%). (E) Links: zaailing net voor overdracht naar NAA; Midden: microtome transversale secties net voor overdracht naar NAA en 2 dagen na overdracht aan NAA; Right. Zaailing met zichtbare ontstaan ​​zijwortels 5 dagen na overdracht aan NAA Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 3
Figuur 3. zijwortelinitiatie wordt gestimuleerd bij langdurige NAA Treatment. (AF) Time natuurlijk met de auxine respons tijdens een NAA behandeling met behulp van de pDR5 :: GUS marker lijn. De auxine respons, één van de eerste gebeurtenissen met zijwortelinitiatie, start 2 uur na aanvang van de behandeling NAA. In het bovenste paneel, is een overzicht van de hele zaailing gegeven; het onderste paneel toonts de auxine respons in de root tip. (GM) Tijd loop van het NAA behandeling met behulp van de pCYCB1; 1 :: GUS marker lijn. De GUS representeert de expressie van het CYCB1, 1 gen, wat aangeeft dat de eerste celdelingen die tot zijwortelvorming starten 6 uur na de start van de behandeling NAA. In het bovenste paneel, is een overzicht van de hele zaailing gegeven; het onderste paneel toont CYCB1;. 1 expressie in de wortel tip (GUS kleuring volgens Beeckman en Engler, 1994 22) Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 4
Figuur 4. Expressie Profiel van CYCB1 genen in Arabidopsis en maïs tijdens LRIS.   (A) microarray waarden van AtCYCB1; 1 tijdens LRIS zoals beschreven door De Smet et al. 2008 10 (B) microarray waarden van potentiële orthologen van AtCYCB1; 1 tijdens LRIS zoals beschreven door Jansen et al. 2013 13 BLASTP score is de score verkregen bij het ​​stralen van de eiwitsequentie van AtCYCB1; 1 op de maïs genoom. Foutbalken uiten standaarddeviatie en ** staat voor een p-waarde ≤0.01. Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 5
Figuur 5. Expressie van GRMZM2G310115 in de Stele en de Cortex van maïs Roots tijdens LRIS. De expressie van <em> GRMZM2G310115 tijdens LRIS in maïs werd geëvalueerd door kwantitatieve real-time qRT-PCR op ontleed stele en cortex monsters. Een aanvullende steekproef werd uitgevoerd op planten geteeld op water. Waarden werden genormaliseerd voor expressie in de stele in water. Foutbalken uiten standaarddeviatie en ** staat voor een p-waarde ≤0.01 (primers en referentie-genen volgens Jansen et al. 2013 13). Klik hier om een grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In het Arabidopsis LRIS protocol, is het belangrijk om alleen de overdracht van de zaailingen die zijn gegroeid volledig in contact met de NPA-bevattend groeimedium. Dit zorgt ervoor dat zijwortelinitiatie geblokkeerd over de gehele wortellengte. Om te voorkomen verwonden plantjes tijdens de overdracht, kunnen de armen van de gebogen pincet worden aangesloten onder de zaadlobben van de zaailing. Bij overdracht, zorg ervoor dat de zaailing wortels liggen in voldoende contact met de NAA met agar medium. Dit kan worden bereikt door afromen de wortel via agar oppervlak over een kleine afstand. Dit zal zorgen voor een efficiënte synchroniseren inductie van de zijwortelinitiatie over de totale lengte wortel. De wortels kunnen worden geteeld blootgesteld aan licht, zonder negatieve gevolgen voor hun groei en laterale wortel inductie.

In maïs LRIS protocol, is het belangrijk dat de kiemwortel de kernel naar beneden gericht en naar het papier naar de wortel d groeien zorgenownwards en hechten aan het papier aan de juiste zijde 16. Na drie dagen van de NPA behandeling, moet de zaailingen zijn voortgekomen uit de kernel met een kleine spruit, een primaire wortel en rudimentaire wortels 16. De primaire wortel moet ongeveer 2 cm lang alvorens tot de inductie van zijwortelinitiatie zijn. Dit protocol is ontwikkeld met behulp van de B73 maïs inteeltlijn, maar in geval van een maïslijn met een andere groei, pas de incubatietijd dienovereenkomstig. Zorg ervoor dat de papierrollen blijven doorweekt door het toevoegen van regelmatig 50 uM NPA oplossing als de vloeistof verdampt in de tijd, anders NPA behandeling zou kunnen zijn inefficiënt en ongewenste vroege laterale wortelontwikkeling kunnen optreden. Het systeem zelf voorkomt expositie van de wortels aan het licht, maar het licht is niet een groot probleem en heeft geen invloed op de wortelgroei en laterale wortel inductie.

Alternatieven voor gecontroleerde inductie van zijwortels zijn het gebruik van mechanical buigen gravistimulation 23 of 24. Het belangrijkste voordeel van deze systemen is dat ze een "natuurlijker" inductie vergeleken met hormoonbehandelingen in de LRIS, maar het nadeel is dat ze beperkt in de hoeveelheid materiaal die op een bepaald tijdstip kan worden geoogst, omdat zij alleen een zijwortelinitiatie gebeurtenis op in de bocht per zaailing vergelijking met een volledige inductie van de pericyclus de LRIS.

De LRIS gebruikt in Arabidopsis en maïs kan worden gebruikt in een verscheidenheid van planten, maar gunstige voorwaarden moeten worden geoptimaliseerd. Een LRIS installeren twee belangrijke opeenvolgende stappen worden gerealiseerd: (1) blokkeren van auxinetransport en (2) ophoping van auxine te zijwortelinitiatie induceren. Het teeltsysteem moet mogelijk maken efficiënte en uniforme opname van de verbindingen en dienen goede ontwikkeling van de zaailingen toe. Alternatieve systemen om vast medium (Arabidopsis) en papierrollen (maïs), zoals vloeibare kweek, hydrocultuur of steenwol, kunnen worden gebruikt voor andere diersoorten. De eerste fase van de LRIS, dat wil zeggen de blokkering van de auxine transport kan worden bereikt door toevoeging van een auxinetransport inhibitor. Hoewel NPA leidt tot een efficiënte blok zijwortelinitiatie in Arabidopsis en maïs, alternatieve verbindingen zoals 2,3,5-trijoodbenzoëzuur (TIBA) of p- chlorophenoxyisobutyric zuur (pCIB) zou beter werken in andere soorten. Eenzelfde optimalisatie kan worden gedaan voor de tweede stap van de LRIS, dwz de auxine behandeling. De synthetische auxine NAA lijkt het meest geschikt voor een LRIS. De auxine precursor indool-3-boterzuur (IBA) kan een goed alternatief als ook sterk induceert zijwortels en een hoge bioactiviteit in verschillende planten 25, 26. Anderzijds, het natuurlijke auxine indol-3-azijnzuur (IAA) is minder stabiel en gemakkelijker gemetaboliseerd 27, rationalisatie van de zwakkere effect op wortel ontkeling in bijvoorbeeld maïs en rijst 25, 26. De synthetische auxine 2,4-dichloorfenoxyazijnzuur (2,4D) hoopt zich sterk in pericycluscellen, deels omdat het niet uit de cellen 28 wordt geëxporteerd, afbreuk juiste zijwortelinitiatie en het induceren van kunstmatige gefuseerde constructies. Ook andere verbindingen die interactie met auxine trajecten, zoals naxillin 12, bleken zijwortelinitiatie induceren in Arabidopsis en kunnen worden getest bij andere diersoorten.

In sommige gevallen, kieming inefficiënt in aanwezigheid van NPA en men kan kiezen om eerst ontkiemen de zaden in afwezigheid van NPA, de zaailingen vervolgens overdragen aan de NPA-bevattende systeem. Dit leidt tot een mogelijke risico op vroegtijdige zijwortelinitiatie rudimentaire voordat zijwortelinitiatie inductie met NAA behandeling geïnitieerd dus is het belangrijk om alleen proeven het gebied van de wortel die langwerpige NPA tijdens de behandeling. Na deze algemene strategie, een should in staat zijn om een ​​LRIS optimaliseren voor vrijwel elke (zaad), planten en als zodanig een eenvoudig systeem om laterale wortelontwikkeling studeren voor de plant van belang. Verdere karakterisering van de timing van de zijwortelinitiatie kan plaatsvinden via markeringslijnen, zoals geïllustreerd voor Arabidopsis. Als markeerlijnen moeilijk te verkrijgen, kan een gedetailleerde histologisch onderzoek gedaan, maar dit is tijdrovend en de eerste celdelingen zijn niet herkenbaar. Als alternatief kan expressie-analyse van celdeling markers worden gebruikt om de timing van de eerste celdelingen geven.

De LRIS kan worden gebruikt voor verschillende doeleinden, zoals het transcriptoom 9-13 zoals kort beschreven in de resultaten, en histologische waarnemingen van het macroscopisch en microscopisch niveau tijdens zijwortelinitiatie 14. Verschillende types van steekproeven, van orgaan naar cel schaal 29 kan toestaan ​​ontrafelen verschillende aspecten van de latereal wortel initiatie. Bovendien kan de LRIS worden gebruikt om het effect van verschillende verbindingen op de zijwortelinitiatie 12, 30 bewaken. Tenslotte met reporter lijnen, een LRIS kan ook worden gebruikt om de genexpressie en / of eiwit lokalisatie gemakkelijk karakteriseren in laterale wortelontwikkeling.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
Laterale Root Induceerbare System in<em&gt; Arabidopsis</em&gt; En maïs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter