Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Seitenwurzel induzierbaren Systems in doi: 10.3791/53481 Published: January 14, 2016
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Das Wurzelsystem ist von entscheidender Bedeutung für das Pflanzenwachstum, da es sicherstellt, Verankerung und die Aufnahme von Wasser und Nährstoffen aus dem Boden. Weil die Expansion eines Wurzelsystem stützt sich hauptsächlich auf die Herstellung von Seitenwurzeln, ihre Einführung und Bildung weitgehend untersucht worden. Seitenwurzeln in einer bestimmten Untergruppe von Perizykel Zellen initiiert, die so genannte Gründerzellen 1. In den meisten Dikotyledonen wie Arabidopsis thaliana, sind diese Zellen an den Protoxylem Polen 2 angeordnet, wohingegen in Monokotyledonen wie Mais, werden sie an den Phloem Pole 3 gefunden. Gründer-Zellen werden durch eine erhöhte Auxin Reaktion 4 markiert, gefolgt von der Expression spezifischer Zellzyklusgene (zB CYCLIN B1; 1 / CYCB1; 1), wonach sie eine erste Serie von asymmetrischen anticlinal Divisionen 5 unterzogen werden. Nach einer Reihe von koordinierten Antiklinale und perikline Divisionen wird ein Seitenwurzel Primordium ausgebildet ist, dass schließlich wird als ein hervorutonomous Seitenwurzeln. Der Ort und Zeitpunkt des Seitenwurzel Initiation sind jedoch nicht vorhersehbar, da diese Ereignisse weder reichlich, noch synchronisiert. Dies erschwert die Verwendung von molekularen Ansätzen wie Transkriptomik, um diesen Prozess zu studieren.

Um dies zu bewältigen, wurde ein Seitenwurzel induzierbare System (LRIS) entwickelt worden, 6, 7. In diesem System werden die Sämlinge zuerst mit N-1-Naphthylphthalamidsäure (NPA), der Auxin-Transport und die Akkumulation hemmt folglich blockiert Seitenwurzelinitiations behandelten 8. Durch anschließendes Überführen der Keimling zum Medium, das die synthetischen Auxin 1-Naphthalin Essigsäure (NAA), reagiert die gesamte Perizykel Schicht auf den erhöhten Auxin Ebenen dadurch massiv Induktionsseitenwurzel Einleitung Zellteilungen 6. Als solche führt dieses System, um schnelle, synchrone und umfangreiche Seitenwurzeln Einweihungen, was eine einfache Sammlung von Wurzelproben für eine bestimmte Stufe der späten angereichertral Wurzelentwicklung. Anschließend kann diese Proben verwendet werden, um genomweite Expressionsprofile während der seitlichen Wurzelbildung zu bestimmen. Die LRIS hat bereits bedeutende Wissen über Seitenwurzel Einleitung in Arabidopsis und Mais 9-13, aber die Notwendigkeit ergab, dieses System auf andere Pflanzenarten gelten wird noch deutlicher, da mehr Genome sequenziert werden, und es gibt ein wachsendes Interesse an Wissen, um wirtschaftliche Bedeutung zu übertragen Spezies.

Hier werden die detaillierten Protokolle des Arabidopsis und Mais LRISs angegeben. Als nächstes wird ein Beispiel für die Verwendung des Systems vorgesehen ist, die darstellt, wie Transkriptomik Daten aus dem Mais LRIS gewonnen kann verwendet werden, um funktionelle Homologe, die eine konservierte Funktion während der seitlichen Wurzel Einleitung in verschiedenen Pflanzenarten zu identifizieren. Schließlich Richtlinien, um die LRIS Optimierung für andere Pflanzenarten vorgeschlagen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Arabidopsis LRIS Protocol

Hinweis: Der Text bezieht sich auf "klein" oder "groß" angelegten Experimenten. Kleinen Maßstab Versuche, wie Markierungslinie Analyse und histologischen Färbung 6, 14, erfordern nur ein paar Proben. Großversuche, wie die quantitative Echtzeit-qRT-PCR, Mikroarrays 9-11 oder RNA-Sequenzierung, erfordern eine größere Menge von Proben. Als solche wird eine Menge von etwa 1000 Sämlinge pro Probe wurde durch Vanneste et al. 11 verwendet, um Mikroarray nach Wurzelsegment Dissektion durchführen.

TAG 1

  1. Sterilisation von Arabidopsis-Samen
    Hinweis: Wählen Sie eine der folgenden Verfahren für die Saatgut Sterilisation. Einer von ihnen ist geeignet für die nächsten Schritte des Protokolls. Gassterilisation (1.1.2) stellt zwei Hauptvorteile gegenüber Flüssigkeitssterilisation (1.1.1): Es dauert weniger Zeit beim Umgang mit einer großen tauber von Saatgut, weil kein Pipettieren muss für die einzelnen Proben auftreten; und die sterilisierten Samen können für einen längeren Zeitraum gelagert werden. Es erfordert jedoch einen Exsikkator und sorgfältige Handhabung.
    1. Flüssigkeitssterilisation
      1. Gießen Sie die gewünschte Anzahl von Samen in Mikrozentrifugenröhrchen. Verwenden Sie bis zu 20 mg (~ 800 Samen) in einem 1,5-ml-Röhrchen oder 40 mg (~ 1600 Samen) in einem 2 ml Mikrozentrifugenröhrchen.
      2. 1 ml 70% Ethanol. Invertieren oder schütteln für 2 min.
      3. Ersetzen Sie die 70% Ethanol mit 1 ml Sterilisationslösung für 15 min. (Bereiten Sie frische Sterilisationslösung: 3,85 ml Natriumhypochlorit (NaOCl) stock (12%) (ACHTUNG: Dunstabzug), 5 ul Tween 20, bis zu 10 ml mit Wasser Kehren Sie die Röhrchen mehrere Male, um sicherzustellen, dass alle Samen zu kommen. in Kontakt mit der Lösung.
      4. In einem laminaren Luftstrom Schrank, ersetzen Sie die Sterilisationslösung mit 1 ml sterilem destilliertem Wasser und spülen Sie die Samen 5 mal für 5 Minuten durch wiederholtely Austausch mit 1 ml frischem sterilem destilliertem Wasser.
    2. Gassterilisation
      1. Gießen der gewünschten Anzahl von Samen in einem 2 ml Mikrozentrifugenröhrchen. Verwenden Sie einzelne Rohre bei der Arbeit mit mehreren unabhängigen Linien, und ordnen sie in einem Kunststoff-Mikrozentrifugenröhrchen Box oder Halter eröffnet. Wenn die Anzahl von Samen in einem Rohr 500 übersteigt (12,5 mg), unterteilen die Samen in die entsprechende Anzahl von Rohren zur erfolgreichen Sterilisation zu gewährleisten. Stellen Sie sicher, die Kappen der Nachbarrohre einander nicht decken. Zusammenpassen, die Deckel der Kiste auf dem Boden, wie es braucht, um im Exsikkator als auch für die Sterilisation ist.
      2. Legen Sie die Box in der Schüssel mit einem Exsikkator, zusammen mit einem Becherglas (ACHTUNG: Dunstabzug).
      3. Füllen Sie das Becherglas mit 100 ml von 12% NaOCl (ACHTUNG: Abzugshaube). Setzen Sie den Deckel auf dem Exsikkator, aber lassen Sie eine kleine Öffnung, wo das Becherglas platziert.
      4. 3 ml 37% ige Salzsäure (rauchende) (CAUTION: Verwendung Dunstabzug) in das Becherglas durch die kleine Öffnung und der Exsikkator schnell zu schließen. Die Lösung perlt seit einiger Zeit aufgrund von Cl 2 -Gas-Formation. Lassen Sie das System geschlossen O / N (oder zumindest 8 h).
      5. Entfernen Sie den Deckel des Exsikkator. Nehmen Sie die Box und bedecken Sie es mit dem Deckel, um eine Verunreinigung während des Transports zu vermeiden.
      6. Legen Sie die Box in einem laminaren Luftstrom Kabinett, entfernen Sie den Deckel und lassen Sie die Samen für etwa 1 h bei RT, um Gas-Release zu ermöglichen.
        Hinweis: Seeds sicher trocken in geschlossenen Mikrozentrifugenröhrchen bei 4 ° C gelagert werden bis zu 2 Wochen.
  2. Laterale Wurzelinduktion in Arabidopsis
    1. Seitenwurzel Inhibition (NPA-Behandlung)
      1. Vorzubereiten Wachstumsmedium für in-vitro-Wachstum. Das Medium von halber Stärke Murashige und Skoog Salzgemisch 15, 0,1 g / l Myo-Inositol, 10 g / l Saccharose enthält und mit 0,5 gepuffertg / L 2- (N-Morpholino) ethansulfonsäure (MES).
      2. Passen Sie mit 1 M KOH den pH-Wert auf 5,7. Hinzufügen von 8 g / l von Pflanzengewebe Agar und autoklaviert das Medium für 20 Minuten bei 121 ° C.
      3. Bereiten Sie eine 25 mM Stammlösung von NPA in Dimethylsulfoxid (DMSO) (ACHTUNG: Verwenden Sie Schutzhandschuhe). In laminarem Luftstrom kühlt man das autoklavierte Medium auf etwa 65 ° C (das ist die Temperatur, bei welcher die Flasche mit der Hand gehalten werden soll), und geben 25 mM NPA-Stammlösung, um eine Endkonzentration von 10 uM NPA erhalten.
      4. Homogenisierung nach Zugabe durch leichtes Schütteln der Flasche für 10 Sekunden. Gießen Sie 50 ml Medium pro Quadratpetrischale (12 cm x 12 cm).
        Hinweis: Bei der Großversuch, tragen Sie eine Nylon-Mesh (20 um), um einfache Übertragung zu gewährleisten. Vorbereitung einer Masche (9 cm x 9 cm) zum Autoklavieren (Figur 1A). Wenn autoklaviert das Armierungsgewebe in das Wachstumsmedium mit sterilen Pinzetten (1B). Schieben Sie die Masche in das Wachstumsmedium mit einem sterilized drigalsky sicherstellen, dass es in gutem Kontakt mit dem Wachstumsmedium (1B) ist (ACHTUNG: Arbeiten unter sterilen Bedingungen).
      5. Die Saat auf den NPA-Platten.
        Hinweis: Bei einem Großversuch ist geplant, säen 2 dicht und gut ausgerichteten Reihen mit 50 Samen, um die Probenahme zu erleichtern (siehe 1.2.2.3).
        1. Im Falle von flüssigen Sterilisation, die Saat auf NPA-Platten mit einer 200 ul-Pipette. Abgeschnitten 3-4 mm von dem Ende der Pipettenspitzen in sterilen Bedingungen (oder vor der Sterilisation der Spitzen), um in der Lage, um die Samen pipettieren sein. Pipette nach oben und unten ein paar Mal, um erneut zu suspendieren die Saat, so pipettieren etwa 150 & mgr; l sterilem Wasser mit 10 - 20 Samen und warten, bis der Samen Sediment am Boden der Spitze. (ACHTUNG: Arbeiten unter sterilen Bedingungen)
          Hinweis: Beim Berühren der Agar oder die Maschen sanft mit der Spitze, wird ein Wassertropfen mit einem Startkapital von ihm (1C) freigegeben werden.
        2. <li> Im Falle der Gassterilisation, die Saat mit autoklaviert toothpicks.Pinch den Zahnstocher in den Agar, bevor die Samen, um eine klebrige Oberfläche zu gewährleisten. Nehmen Sie den Samen einer nach dem anderen mit dem Zahnstocher und verteilen die Samen auf den Platten (1D). Alternativ fügen sterilem Wasser auf den Samen, und säen, wie in 1.2.1.5.1 beschrieben (ACHTUNG: Arbeiten unter sterilen Bedingungen).
      6. Verschließen Sie die Platten mit atmungs Klebeband und speichern sie Platten bei 4 ° C im Dunkeln für mindestens 2 Tage und höchstens eine Woche. Dies ist für die Schichtung und stellt sicher, synchronisiert und effizienter Keimung erforderlich.
        Anmerkung: Alternativ können Samen vor der Aussaat geschichtet, in destilliertem Wasser in Mikrozentrifugenröhrchen, die weniger Kühlraum benötigt getaucht. In diesem Fall speichern Sie die Röhrchen für mindestens eine Woche bei 4 ° C, und bewegen Sie die Platten auf die Wachstumskammer unmittelbar nach der Aussaat (siehe 1.2.1.7).
        TAG 3 Bewegen die Platten an der Wachstumskammer (Dauerlicht (110 & mgr; E m -2 s -1), 21 ° C) für 5 Tage (2 Tage der Keimung und 3 Tagen Wachstum) in einer fast vertikalen Position (80 bis 90 °) Wurzelwachstum auf, und nicht in dem Medium zu gewährleisten.
        TAG 8
    2. Laterale Wurzelinduktion (NAA Treatment)
      1. Bereiten Sie die gleichen Wachstumsmediums, wie in 1.2.1.1 und 1.2.1.2 beschrieben. Bereiten Sie eine 50 mM Stammlösung von NAA in DMSO (ACHTUNG: Verwenden Sie Schutzhandschuhe). Kühlen Sie das autoklavierte Medium auf 65 ° C und fügen NAA Lösung für das Medium, um eine Endkonzentration von 10 & mgr; M zu erhalten NAA (ACHTUNG: Arbeiten unter sterilen Bedingungen).
        1. Homogenisierung nach Zugabe durch leichtes Schütteln der Flasche für 10 Sekunden. Gießen Sie 50 ml Medium pro Quadratpetrischale (12 cm x 12 cm).
      2. Übertragen Sie die Sämlinge aus den Platten, die Wachstumsmedium mit 10 & mgr; M NPA ergänzt um jene supgänzt mit 10 uM NAA.
        1. Haken Sie die Arme des gebogenen Pinzette unter den Keimblättern des Keimlings und nehmen Sie es vorsichtig von der Platte. Nur übertragen Sämlinge von denen die Wurzeln vollständig in Kontakt mit der NPA-Wachstumsmedium und vorzugsweise nach unten gewachsen.
        2. Überfliegen die Wurzel über die NAA-enthaltenden Wachstumsmedium Oberfläche über eine kleine Distanz. Stellen Sie sicher, dass die Pflanzenwurzeln sind in gutem Kontakt mit dem Wachstumsmedium. Falls erforderlich, drücken Sie die Wurzel vorsichtig in das Wachstumsmedium Fläche mit der Pinzette.
          Hinweis: Bei einem Großexperiment, entfernen Sie alle Sämlinge, die in Kontakt mit dem Netz und Übertragung durch Anheben des Mesh an den beiden oberen Ecken mit einer Pinzette nicht. Sicherzustellen, dass die Maschen in guten Kontakt mit dem NAA haltigen Medium durch Abschöpfen des Netzes über die Agaroberfläche über einen kleinen Abstand (1E).
      3. Verschließen Sie die neuen Platten mit atmungsBand und legen Sie sie in der Wachstumskammer (conDauerlicht (110 & mgr; E m -2 s -1), 21 ° C) in einer vertikalen Position für die gewünschte Zeit nach der Induktion bis zur Probenahme.
        Hinweis: Bei einem Großexperiment, mit einem Skalpell, um die Wurzelsegmente auf einmal direkt auf dem Netz geschnitten und probieren Sie sie durch sanftes Abkratzen der Oberfläche des Netzes.

2. LRIS Maize Protocol

  1. Schichtung der Maiskörner
    1. Maiskörner Inkubieren bei 4 ° C im Dunkeln für mindestens 1 Woche.
      Hinweis: Dieses Protokoll wurde mit dem B73 Maisinzuchtlinie entwickelt.
  2. Sterilisation von Maiskörnern
    TAG 1
    Anmerkung: Obwohl Maissämlinge müssen nicht unter sterilen Bedingungen gezüchtet werden, wird empfohlen, um die Maiskörner zu sterilisieren und mit Sterilgutes von Pilzwachstum in der Papierrolle zu verhindern,System.
    1. Legen Sie die erforderliche Anzahl von Maiskörnern in einem sterilisierten Glasbecher.
    2. 100 ml Sterilisationslösung (6% NaOCl in Wasser) (ACHTUNG: Abzugshaube).
    3. Fügen Sie einen Magnetrührstab und das Becherglas auf einem Magnetrührer bei niedriger Rührgeschwindigkeit (ca. 250 UpM) bei Raumtemperatur für 5 min.
    4. Fünfmal für 5 min gründlich durch Ersetzen der Lösung mit 100 ml frischem sterilem Wasser.
  3. Aussaat Maiskörner
    1. Setzen Sie auf Handschuhe, um das Risiko einer Kontamination zu verringern, und nehmen Sie eine Rolle Papiertücher.
    2. Reißen Sie zwei Strecken der Handtuchpapier mit einer Gesamtlänge von zwei Blätter (ungefähr 92 cm x 24 cm), und legen Sie sie auf der jeweils anderen auf einer sauberen Oberfläche (2A).
    3. Falten Sie die Blätter zu verdoppeln über die Länge (ungefähr 92 cm x 12 cm) (2A).
    4. Verwenden einer Pinzette zu 10 Kerne in etwa 2 cm von der Spitze über t verteilener gesamten Länge des Papiers, ohne dabei einen Zwischenraum von 8 cm zwischen jedem Kernel und 8 cm an beiden Enden frei (2B). Sicherstellen, dass die Keimwurzel des Kernels nach unten und in Richtung des Papiers (2B).
    5. Sanft rollen Sie das Papier über die Länge, während die Samen an Ort und Stelle (2B). Um den Roll zu erleichtern, ist es optional, ersten sprühen Sie das Papier mit sterilem Wasser.
    6. Setzen Sie die Papierrollen in sterilisierte Glasröhren von ca. 6 cm Durchmesser und 14 cm Höhe (zB 250 ml Zentrifugenröhrchen) und legen Sie sie in einem Rack (2C).
  4. Laterale Wurzelinduktion in Mais
    1. Bereiten Sie eine 50 mM NPA-Stammlösung (gelöst in DMSO) (ACHTUNG: Verwenden Sie Schutzhandschuhe).
    2. Für jedes Rohr, einen 50 uM NPA Lösung durch Zugabe von 125 ul von 50 mM NPA Stammlösung zu 125 ml sterilem Wasser in einem sterilisierten Glasbecher.
    3. Gut mischen undPour 125 ml der 50 uM NPA-Lösung über der Papierrolle in das Rohr. Die Papierrolle wird die Lösung absorbieren und völlig durchnässt.
      Hinweis: Bei Verwendung von Papierrollen und Rohre mit anderen Dimensionen, die Lautstärke entsprechend an. Die Flüssigkeit sollte auf halber Strecke das Rohr zu erreichen, um eine ausreichende Aufnahme zu gewährleisten.
    4. Legen Sie die Papierrollensystem in einer Wachstumskammer für drei Tage (27 ° C, Dauerlicht, 70% relative Luftfeuchtigkeit). Stellen Sie sicher, dass die Papierrollen bleiben Hinzufügen von zusätzlichen 50 uM NPA-Lösung eingeweicht, da die Lösung im Laufe der Zeit (2D) verdampft.
      TAG 4
    5. Bereiten Sie eine 50 mM NAA-Stammlösung (gelöst in DMSO) (ACHTUNG: Verwenden Sie Schutzhandschuhe).
    6. Für jedes Rohr, bereiten eine 50 uM NAA Lösung durch Zugabe von 125 & mgr; l aus der 50 mM NAA Lager zu 125 ml sterilem Wasser in einem sterilisierten Glasbecher.
    7. Sanft Großteil der verbleibenden NPA-Lösung von den Papierrollen und legen Sie diem in sterilem Wasser für 5 Minuten, um es zu waschen (ACHTUNG: Verwenden Sie Schutzhandschuhe). Sanft das meiste Wasser aus der Papierrollen. Wiederholen Sie diesen Waschschritt dreimal.
    8. Gut mischen und gießen Sie die 50 uM NAA-Lösung über die Papierrollen in den Rohren. Sicherstellen, dass sie völlig durchnässt werden.
    9. Legen Sie die Papierrollensystem in der Wachstumskammer (27 ° C, Dauerlicht, 70% relative Feuchtigkeit) nach der Induktion der gewünschten Dauer.
  5. Laterale Wurzelinduktion in Zufälliges Crown Wurzeln von Mais
    Hinweis: Die LRIS wie oben beschrieben induziert Seitenwurzeln in der Primärwurzel. Doch in Mais und anderen Monokotyledonen, der primären Wurzel und den embryonalen Samen Wurzeln, zusammen mit ihren Seitenwurzeln, sind während der Keimlingsentwicklung vor allem wichtig. Zu einem späteren Zeitpunkt in das Pflanzenwachstum ergeben sich die post-embryonale Adventivwurzeln auf dem Stamm und zu entwickeln Seitenwurzeln, eine neue Wurzelsystem 16 bilden auch. Die LRIS kann auch nützlich seind, um Seitenwurzeln auf diesen post-embryonale zufällige Krone Wurzeln, indem Sie einige kleinere Anpassungen an der LRIS auf der embryonalen Primärwurzel zu induzieren.
    1. Um die Papierrollen zu machen, erstellen Sie ein Sandwich von Papieren mit jeweils zwei Schichten aus Handtuchpapier auf der Außenseite und zwei Lagen Papier Keimung innerhalb. Legen Sie die sterilisiert Kernel (siehe Schritte 2,1 bis 2,2) in zwischen den beiden Platten der Keimung Papier. Keimung Papier, verglichen mit Handtuch Papier, wird weniger anfällig für durch die Wurzelhaare und Seitenwurzeln, die machen die Öffnung der Papierrollen später leichter durchdrungen werden können. Auf der anderen Seite werden die beiden äußeren Schichten Handtuchpapier Absorption der Flüssigkeit zu erleichtern.
    2. Legen Sie die Brötchen in 700 ml Glasröhrchen und gießen sterilem Wasser ohne NPA über sie. Sicherstellen, dass sie völlig durchnässt werden.
    3. Keimen die sterilisierten Kerne in der Wachstumskammer (siehe Schritt 2.4.9).
    4. Wachsen die Setzlinge bis die zufällige Kronenwurzelnbeginnen zu entstehen (6 Tage B73). Sicherstellen, dass die Papierrollen werden nass zu jeder Zeit durch Zugabe von sterilem Wasser, wenn nötig gehalten wird.
    5. Transfer in ein 25 & mgr; M NPA-Lösung für 4 Tage (siehe Schritte 2.4.1 bis 2.4.4), gefolgt von einem ähnlichen Induktion Seitenwurzel Initiierung durch Ersetzen der NPA-Lösung mit einer 50 & mgr; M NAA Lösung nach einem Waschschritt (siehe Schritt 2.4 0,5 bis 2.4.9).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Anwendung des LRIS um des Seitenwurzel Initiation Prozess durchzuführen Vergleichs Transcriptomics

Eine Anwendung der LRIS ist der Vergleich und die Korrelation von Genexpressionsprofilen in seitlichen Wurzelbildung in verschiedenen Arten. Vergleichende Transkriptomik nähert schaffen die Möglichkeit, orthologen Genen in der lateralen Wurzelentwicklung in verschiedenen Spezies beteiligt lokalisieren. Seitenwurzel Einleitung, die für die Bildung eines neuen Organs bei einer Untergruppe von Zellen in einer bereits gebildeten Wurzelachse enthaltenen besteht, ist der Hauptmechanismus, durch den Angiospermen geteilt werden, um ihre Wurzelarchitektur steuern. Folglich ist es sehr wahrscheinlich, dass sie von in einem gemeinsamen Vorfahren vorhanden bestehenden Bahnen entwickelt und wurde im Laufe der Evolution konserviert. In der Tat haben gemeinsames Potential Regulatoren des Seitenwurzel Einleitung in verschiedenen Spezies gefunden <sup> 17, 18.

Probenmaterial mit dem LRIS in Arabidopsis und Mais, und Transkriptomanalyse

Die LRIS wurde in zwei verschiedenen Arten nachgewiesen. Arabidopsis und Mais 10, 13 in beiden Spezies wurde beschlossen, die Pflanzen direkt vor NAA Behandlung abzutasten, und kurz nach der Induktion zu Beginn oder während der Auxin-Antwort, wie sowie zu Beginn oder während der ersten Teilungen in Perizykel. Darüber hinaus aktivierte Fluoreszenz Cell Sorting 19 (FACS) wurde in Arabidopsis oder Laser Capture Microscopy 20, 21 (LCM) in Mais verwendet werden, um für Perizykel Zellen auszuwählen. In Arabidopsis, die Zeitpunkte von 2 und 6 Stunden nach der Induktion wurden ausgewählt auf der Grundlage der transkriptionellen Charakterisierung der PDR5 :: GUS Auxin Antwort und pCYCB1; 1 :: GUS Zellzyklus-Markierungslinien 9 (Abbildung 3). In Mais, den Zeitpunkten 2, 3 und 4 Stunden nach der Induktion wurden nach der mikroskopischen Charakterisierung der Zellteilungsaktivität und der Analyse von mehreren Zellzyklus-Marker-Gene Expression mittels real-time quantitative Reverse-Transkriptase-Polymerase-Kettenreaktion (qRT-PCR) 13 ausgewählt . RNA wurde aus den isolierten Zellen extrahiert und auf Microarray hybridisiert Plattformen, wie zuvor beschrieben 10, 13.

Das Finden der Ortholog von Arabidopsis CYCB1; 1 (AtCYCB1; 1) in Mais

In Arabidopsis, die Markierungslinie pCYCB1; 1 :: GUS wurde in großem Umfang verwendet, um die ersten Divisionen der Perizykel bei seitlichen Wurzel Einleitung zu verfolgen. Solche Marker würde sehr seinnützlich bei Mais. Mehrere Homologen AtCYCB1; 1 wurden in Mais (www.maizesequence.org, alle Peptide, BLASTP, Standardeinstellungen) gefunden. Sechs von ihnen waren auf dem Mikroarray nach LRIS in Mais durchgeführt Gegenwart und zeigte eine signifikante Bereicherung. Die beste BLAST Hit GRMZM2G310115, zeigte sehr hohe Transkriptionsniveaus nach LRIS, ähnlich dem, was in Arabidopsis AtCYCB1 beobachtet; 1 (Tabelle 4).

Anwendung des LRIS zu einzelnen Gene Expression prüfen

Um GRMZM2G310115 als guter Kandidat Ortholog AtCYCB1 validieren; 1 in Maisseitenwurzel Initiierung, ein Echtzeit-qRT-PCR von Proben zu verschiedenen Zeitpunkten genommen wurden im Verlauf eines LRIS 13 durchgeführt. Pflanzen wurden behandelt, wie in dem oben erwähnten Protokoll beschrieben und zu verschiedenen Zeitpunkten geerntet: before NAA Behandlung (NPA) und nach 2, 3 und 4 h NAA Behandlung. Auch Material aus Pflanzen nur in Wasser angebaut wurde geerntet, um die Genexpression zwischen LRIS und neutralen Bedingungen zu vergleichen. Unmittelbar nach der Ernte, Wurzelsegmenten entsprechend einem Bereich zwischen 5 mm und 15 mm über der Wurzelspitze unter dem Binokular seziert besteht. Mit einer Pinzette, wurde die Rinde von der Stele (die die Perizykel enthält) voneinander getrennt sind, und RNA wurde aus beiden Geweben extrahiert. Dieser letzte Schritt wurde anstelle von LCM durchgeführt, weil es viel schneller und kostengünstiger zur Validierung. Mit dem folgenden jeweiligen Vorwärts- und Rückwärts qRT-PCR-Primer, AGCAGGACGCAGTTGGAGAG und GAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 wurde validiert, um hochreguliert auf LRIS sein und spezifisch für die Stele Gewebe (Abbildung 5) zu sein. Zusätzlich zeigt dieses Experiment, dass ohne Synchron Induktion, die diskrete Ereignisse Seitenwurzel Einleitung geschieht in einer Wurzel im Wasser wachsenden nicht nachweisbar sind, und veranschaulichen die Notwendigkeit des LRIS auf differentielle Genexpression auf den Prozess der Seitenwurzelinitiations bezogen offenbaren.

Abbildung 1
Abbildung 1. Seitenwurzel induzierbaren Systems für Arabidopsis (A) Vorbereiten des Nylon-Mesh (20 um):. Schneiden Sie die Nylon-Mesh (9 cm von 9 cm), wickeln Sie es in Alufolie und steckte es in ein Becherglas für Autoklavieren. (B) Übernehmen Sie die Nylon-Mesh auf einer NPA-enthaltenden Platte (10 & mgr; M) mit einer Pinzette. Dann mit einem sterilen Drigalski, um Luftblasen zu entfernen. (C) für die Aussaat Samen auf dem Nylon Netz unter Verwendung einer Pipette. (D) für die Aussaat Samen auf dem Nylon Netz mit einem Zahnstocher. (E) Bringen Sie die Nylon Netz zu einer NAA haltige Platte (10 & mgr; M) mit einer Pinzette.81 / 53481fig1large.jpg "target =" _ blank "> Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Seitenwurzel induzierbaren Systems für Mais.   (A) Herstellung der Papierrollen: Platz zwei Schichten aus Papier (92 cm x 24 cm, Länge von zwei Blättern) auf der jeweils anderen und falten Sie sie über die Länge zu verdoppeln (92 cm x 12 cm). (B) Setzen Sie 10 sterilisiert Maiskörner mit der Keimwurzel nach unten auf dem Papier, auf 2 cm von der Spitze mit einem Zwischenraum von 8 cm. Dann rollen Sie das Papier, während die Maiskörner in Kraft. (C) Setzen Sie die Papierrollen in Rohren (zB 250 ml Zentrifugenröhrchen) und setzte sie in einem Rack. (D) wachsen die Maiskeimlinge für drei Tage in einem 50 & mgr; M NPA-Lösung (bei ​​27 ° C, Dauerlicht, bezogen humifeuchtigkeit 70%). (E) links: Sämling kurz vor Übergabe an NAA; Mitte: Mikrotom Querschnitte kurz vor Übergabe an NAA und 2 Tage nach der Übertragung auf NAA; Rechts:. Sämling mit sichtbaren entstanden Seitenwurzeln 5 Tage nach der Übergabe an NAA Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. Seitenwurzel Initiation wird bei längerer NAA Behandlung. (AF) Zeitverlauf, die die Auxin-Antwort während einer Behandlung mit dem NAA PDR5 :: GUS Markierungslinie stimuliert. Auxin-Antwort, die eine der ersten für das Auslösen Seitenwurzel Initiation ist, beginnt 2 h nach dem Start der NAA Behandlung. In der oberen Platte wird ein Überblick über das gesamte Sämling gegeben; die untere Platte zeigens die Auxin-Antwort in der Wurzelspitze. (GM) Zeitlicher Verlauf einer NAA-Behandlung mit dem pCYCB1; 1 :: GUS Markierungslinie. Die GUS-Signal stellt die Expression des CYCB1; 1-Gen, was darauf hinweist, dass die ersten Zellteilungen, die zu seitlichen Wurzelbildung beginnen 6 h ​​nach Beginn des NAA Behandlung. In der oberen Platte wird ein Überblick über das gesamte Sämling gegeben; das untere Feld zeigt CYCB1;. 1-Expression in der Wurzelspitze (GUS-Färbung nach Beeckman und Engler, 1994 22) Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 4
Abbildung 4. Expressionsprofil von CYCB1 Gene in Arabidopsis und Mais während LRIS.   (A) Mikroarray-Expressionswerte AtCYCB1; 1 während LRIS wie von De Smet et al. 2008 10 (B) Mikroarray-Expressionswerten der potentiellen Orthologe AtCYCB1; 1 während LRIS wie von Jansen et al. 2013 13 BLASTP-Score ist die Punktzahl erreicht, wenn Strahlen der Proteinsequenz von AtCYCB1; 1 auf dem Maisgenom. Fehlerbalken auszudrücken Standardabweichung und ** steht für eine p-Wert ≤0.01. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 5
Abbildung 5. Expression von GRMZM2G310115 in der Stele und der Cortex der Maiswurzeln während LRIS. Die Expression von <em> GRMZM2G310115 während LRIS in Mais wurde durch quantitative real-time qRT-PCR auf seziert Stele und Cortex Proben ausgewertet. Eine ergänzende Probenahme wurde an Pflanzen auf dem Wasser gewachsen durchgeführt. Die Werte wurden für die Expression in der Stele in Wasser normalisiert. Fehlerbalken auszudrücken Standardabweichung und ** steht für eine p-Wert ≤0.01 (Primer und Referenzgenen nach Jansen et al. 2013 13). Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Im Arabidopsis LRIS Protokoll ist es wichtig, nur die Keimlinge, die vollständig in Kontakt mit der NPA-enthaltenden Wachstumsmedium gezüchtet wurden übertragen. Dies stellt sicher, daß Seitenwurzelinitiierung über den gesamten Wurzellänge blockiert. Um Verwundung der Pflänzchen bei der Übertragung zu verhindern, können die Arme der Pinzette unter gekrümmte den Kotyledonen der Sämling eingehängt werden. Bei der Übertragung, stellen Sie sicher, dass die Sämling Wurzeln sind in ausreichenden Kontakt mit dem NAA-haltigen Agar-Medium. Dies kann durch Abschöpfen der Wurzel über die Agaroberfläche über eine kleine Distanz erreicht werden kann. Dadurch wird sichergestellt, eine effiziente synchronisiert Induktion des Seitenwurzel Einleitung über die gesamte Wurzellänge. Die Wurzeln können, um Licht, ohne ihr Wachstum und ihre seitlichen Wurzelinduktion beeinträchtigen ausgesetzt angebaut werden.

In der Mais LRIS-Protokoll, ist es wichtig, dass die Keimwurzel des Kernels muss nach unten und in Richtung des Papiers, um die Wurzel wird d wachsen zu gewährleistenownwards und heften sich an das Papier an der richtigen Seite 16. Nach drei Tagen der NPA Behandlung sollten die Sämlinge aus dem Kernel mit einem kleinen Spross, einer Primärwurzel und Samen Wurzeln 16 entstanden sind. Die Hauptwurzel sollte ca. 2 cm lang, bevor Sie mit der Induktion von Seitenwurzeln Einweihung sein. Dieses Protokoll wurde mit dem B73 Maisinzuchtlinie entwickelt, aber im Falle einer Maissorte mit einem anderen Wachstumsrate, passen Sie die Inkubationszeit. Stellen Sie sicher, dass die Papierrollen bleiben durch Zugabe von regelmäßig 50 uM NPA-Lösung, wenn die Flüssigkeit mit der Zeit verdampft, sonst NPA Behandlung könnte ineffizient und unerwünscht frühen seitlichen Wurzelentwicklung auftreten könnten getränkt. Das System selbst verhindert Darstellung der Wurzeln mit dem Licht, sondern Licht ist nicht ein großes Problem und hat keine Auswirkungen auf das Wurzelwachstum und laterale Wurzelinduktion.

Alternative Wege für die kontrollierte Induktion der Seitenwurzeln sind die Verwendung von MEChanical Biege 23 oder Gravistimulation 24. Der wesentliche Vorteil dieser Systeme ist, dass sie eine "natürliche" Induktion im Vergleich zu den Hormonbehandlungen im LRIS, aber der Nachteil ist, dass sie in der Materialmenge, die zu einem gegebenen Zeitpunkt geerntet werden können, begrenzt, da nur sie ergeben eine seitliche Wurzelinitiationsereignis in der Biegung pro Sämling im Vergleich zu einer vollständigen Induktion der Perizykel im LRIS.

Die in Arabidopsis und Mais verwendet LRIS können in einer Vielzahl von Anlagen eingesetzt werden, wenn auch günstigere Bedingungen optimiert werden müssen. Um eine LRIS installieren, müssen zwei wichtige aufeinander folgenden Schritten erreicht werden: (1) Blockierung der Auxin-Transport-und (2) Akkumulation von Auxin zu Seitenwurzelinitiations induzieren. Die wachsende System sollte für eine effiziente und gleichmäßige Aufnahme der Verbindungen zu ermöglichen, und sollte eine gute Entwicklung der Keimlinge zu ermöglichen. Alternative Systeme zur Festmedium (Arabidopsis) und Papierrollen (Mais), wie beispielsweise Flüssigkultur, Hydrokultur, oder aeroponics, könnte auch für andere Spezies verwendet werden. Die erste Stufe in der LRIS, also die Sperrung der Auxin-Transport, kann durch Zugabe eines Auxintransporthemmstoff erreicht werden. Obwohl NPA führt zu einer effizienten Block Seitenwurzel Einleitung in Arabidopsis und Mais, alternative Verbindungen wie 2,3,5-Triiodbenzoesäure (TIBA) oder p- chlorophenoxyisobutyric Säure (PCIB) möglicherweise besser in anderen Arten zu arbeiten. Eine ähnliche Optimierung kann für den zweiten Schritt des LRIS, also vom Auxin-Behandlung durchgeführt werden. Das synthetische Auxin NAA scheint am besten geeignet für eine LRIS sein. Das Auxin Vorläufer Indol-3-Buttersäure (IBA) könnte eine gute Alternative sein, da es auch stark induziert Seitenwurzeln und hat eine hohe Bioaktivität in verschiedenen Werken 25, 26. Auf der anderen Seite, die natürliche Auxin Indol-3-Essigsäure (IAA) ist weniger stabil und leichter metabolisiert 27, Rationalisierung ihrer schwächeren Effekt auf die Wurzel develwicklung in beispielsweise Mais oder Reis 25, 26. Die synthetischen Auxin 2,4-Dichlorphenoxyessigsäure (2,4-D) sammelt hoch in Perizykel Zellen, teilweise, weil sie nicht aus den Zellen 28 exportiert, beeinträchtigen richtige Seitenwurzelinitiierung und Induktion künstlicher kondensierte Strukturen. Auch andere Verbindungen, die Interaktion mit Auxin Wege wie naxillin 12, wurde gezeigt, dass Seitenwurzel Einleitung in Arabidopsis zu induzieren, und können auch in anderen Arten getestet werden.

In einigen Fällen ist die Keimung ineffizient in Gegenwart von NPA und man könnte wählen, um zunächst die Samen keimen in Abwesenheit von NPA, um anschließend die Sämlinge Transfer zum NPA haltigen System. Dies induziert eine mögliche Gefahr, dass frühe seitlichen Wurzelprimordia vor seitlichen Wurzelinduktion mit NAA Behandlung und initiiert daher ist es wichtig, nur den Bereich der Wurzel, die während der Behandlung NPA längliche abzutasten. Im Anschluss an diese allgemeine Strategie, eine shoULD in der Lage, eine LRIS für praktisch jede (Samen) Pflanze zu optimieren und als solche haben ein einfaches System, um laterale Wurzelentwicklung für die Pflanze von Interesse zu studieren. Weitere Charakterisierung der Zeitlage des Seitenwurzel Einleitung kann über Markierungslinien auftreten, wie zum Beispiel Arabidopsis. Wenn Markierungslinien schwierig zu erhalten sind, kann eine detailliertere histologische Untersuchung durchgeführt werden, dies ist jedoch zeitaufwendig, und die ersten Zellteilungen nicht leicht erkennbar. Alternativ kann die Expressionsanalyse Zellteilungsmarker verwendet werden, um das Timing der ersten Zellteilungen anzuzeigen.

Die LRIS kann für verschiedene Zwecke, wie Transkriptomanalyse 9-13 so kurz in den Ergebnissen beschrieben, sowie histologische Beobachtungen auf makroskopischer und mikroskopischer Ebene während der seitlichen Wurzelinitiations 14 verwendet werden. Verschiedene Arten von Abtastung, die von Organzell Skala 29 zulässig sein könnte, zu entwirren verschiedenen Aspekte der späterenal root Initiation. Darüber hinaus kann die LRIS verwendet, um die Wirkung verschiedener Verbindungen auf die Seitenwurzelinitiations 12, 30 überwacht werden. Schließlich kann durch Verwendung von Reporter-Linien eine LRIS kann auch verwendet werden, um während der seitlichen leicht charakterisieren die Genexpression und / oder Proteinlokalisierung Wurzelentwicklung.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Materials

Name Company Catalog Number Comments
ARABIDOPSIS LRIS
Seeds
Arabidopsis seeds Col-0 ecotype
Gas sterilization of seeds
micro-centrifuge tubes 1.5 ml SIGMA-ALDRICH 0030 125.215 Eppendorf microtubes 3810X, PCR clean
micro-centrifuge tubes 2 ml SIGMA-ALDRICH 0030 120.094 Eppendorf Safe-Lock microcentrifuge tubes
hydrochloric acid Merck KGaA 1,003,171,000 37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu
glass desiccator SIGMA-ALDRICH Pyrex
glass beaker
plastic micro-centrifuge tubes box or holder
Bleach sterilization of seeds
ethanol Chem-Lab nv CL00.0505.1000 Ethanol, abs. 100% a.r. dilute to 70%
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
Tween 20 SIGMA-ALDRICH P1379
sterile water
Growth medium
Murashige and Skoog salt mixture DUCHEFA Biochemie B.V. M0221-0050
myo-inositol SIGMA-ALDRICH I5125-100G
2-(N-morpholino)ethanesulfonic acid (MES) DUCHEFA Biochemie B.V. M1503.0100
sucrose VWR, Internation LLC 27483.294 D(+)-Sucrose Ph. Eur.
KOH Merck KGaA 1050211000 pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur
Plant Tissue Culture Agar LabM Limited MC029
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 10 µM (Arabidopsis)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 10 µM (Arabidopsis)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Making a mesh for transfer
nylon mesh Prosep byba Synthetic nylon mesh 20 µm
Sowing and seedling handling
square petri dish plates GOSSELIN BP124-05 12 x 12 cm
50 ml DURAN tubes SIGMA-ALDRICH CLS430304 Corning 50 ml centrifuge tubes
drigalski Carl Roth K732.1
pipette
cut pipette tips Daslab 162001X Universal 200, cut off 5 mm of tip before autoclaving
breathable tape  3M Deutschland GmbH cat. no. 1530-1
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
Growth conditions
growth room 21 °C, continuous light
Materials Company Catalog Comments
MAIZE LRIS
Seeds
Maize kernels B-73
Bleach sterilization of kernels
glass beaker
magnetic stirrer  Fiers nv/sa C267.1
sodium hypochlorite (NaOCl) Carl Roth 9062.3 12%
sterile water
Lateral root induction chemicals
N-1-naphthylphthalamic acid (NPA) DUCHEFA Biochemie B.V. No. N0926.0250 50 µM (maize primary root), 25 µM (maize adventitious root)
1-naphthalene acetic acid (NAA) DUCHEFA Biochemie B.V. No. N0903.0050 50 µM (maize)
dimethylsulfoxide (DMSO) SIGMA-ALDRICH 494429-1L
Sowing and seedling handling
paper hand towels Kimberly-Clark Professional* 6681 SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)
seed germination paper Anchor Paper Company 10 X 15 38# seed germination paper
tweezers Fiers nv/sa K342.1; K344.1 Dumont tweezers type a nr 5; Dumont tweezers type e nr 7
250 ml (centrifuge) tubes SCHOTT DURAN 2160136 approx. 5.6 cm diameter and 14.7 cm height 
700 ml tubes DURAN GROUP 213994609 cylinders, round foot tube, D 60  x 250
rack for maize tubes, home made
sterile water
Growth conditions
growth cabinet 27 °C, continuous light, 70% relative humidity

DOWNLOAD MATERIALS LIST

References

  1. Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. To branch or not to branch: the role of pre-patterning in lateral root formation. Development. 140, 4301-4310 (2013).
  2. Dolan, L., et al. Cellular organisation of the Arabidopsis thaliana root. Development. 119, 71-84 (1993).
  3. Bell, J. K., McCully, M. E. A histological study of lateral root initiation and development in Zea mays. Protoplasma. 70, 179-205 (1970).
  4. Benkova, E., et al. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell. 115, 591-602 (2003).
  5. Beeckman, T., Burssens, S., Inzé, D. The peri-cell-cycle in Arabidopsis. J. Exp. Bot. 52, 403-411 (2001).
  6. Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inzé, D., Beeckman, T. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell. 14, 2339-2351 (2002).
  7. Jansen, L., Parizot, B., Beeckman, T. Inducible system for lateral roots in Arabidopsis thaliana and maize. Methods Mol Biol. 959, 149-158 (2013).
  8. Casimiro, I., et al. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13, 843-852 (2001).
  9. Himanen, K., et al. Transcript profiling of early lateral root initiation. Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).
  10. De Smet, I., et al. Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science. 322, 594-597 (2008).
  11. Vanneste, S., et al. Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana. Plant Cell. 17, 3035-3050 (2005).
  12. De Rybel, B., et al. A role for the root cap in root branching revealed by the non-auxin probe naxillin. Nat. Chem. Biol. 8, 798-805 (2012).
  13. Jansen, L., et al. Comparative transcriptomics as a tool for the identification of root branching genes in maize. Plant Biotechnol. J. 11, 1092-1102 (2013).
  14. Parizot, B., et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol. 146, 140-148 (2008).
  15. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15, 473-497 (1962).
  16. Bellini, C., Pacurar, D. I., Perrone, I. Adventitious roots and lateral roots: similarities and differences. Annu Rev Plant Biol. 65, 639-666 (2014).
  17. Grunewald, W., Parizot, B., Inzé, D., Gheysen, G., Beeckman, T. Developmental biology of roots: One common pathway for all angiosperms? Int. J. Plant Dev. Biol. 1, 212-225 (2007).
  18. Parizot, B., Beeckman, T. Genomics of root development. Root Genomics and Soil Interactions. Crespi, M. 3-28 (2012).
  19. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. Journal of visualized experiments : JoVE. (2010).
  20. Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell. 15, 583-596 (2003).
  21. Ludwig, Y., Hochholdinger, F. Laser microdissection of plant cells. Methods Mol Biol. 1080, 249-258 (2014).
  22. Beeckman, T., Engler, G. An easy technique for the clearing of histochemically stained plant tissue. Plant Mol. Biol. Rep. 12, 37-42 (1994).
  23. Ditengou, F. A., et al. Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).
  24. Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J. Exp. Bot. 59, 55-66 (2008).
  25. Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid. Plant Growth Regul. 41, 41-47 (2003).
  26. Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J Plant Physiol. 176, 147-156 (2015).
  27. Beyer, E. M., Morgan, P. W. Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C. Plant Physiol. 46, 157-162 (1970).
  28. Delbarre, A., Muller, P., Imhoff, V., Guern, J. Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta. 198, 532-541 (1996).
  29. Bailey-Serres, J. Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers. Annu Rev Plant Biol. 64, 293-325 (2013).
  30. Perez-Torres, C. A., et al. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell. 20, 3258-3272 (2008).
Seitenwurzel induzierbaren Systems in<em&gt; Arabidopsis</em&gt; Und Mais
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).More

Crombez, H., Roberts, I., Vangheluwe, N., Motte, H., Jansen, L., Beeckman, T., Parizot, B. Lateral Root Inducible System in Arabidopsis and Maize. J. Vis. Exp. (107), e53481, doi:10.3791/53481 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter