In Vitro Experiments
Myoblasts were transfected with various 2'OMePS treatment conditions in order to compare the effectiveness of each AON. Single AON treatments with 600 nM each of Ex6A, Ex6B, Ex8A, or Ex8B were done, as well as a cocktail treatment with 600 nM each of all 4 AON sequences. RNA samples were collected four days after transfection. After RT-PCR, samples for each treatment were run on a gel along with non-treated (NT) samples. Bands higher on the gel represent out-of-frame DMD products; these bands were seen in NT, Ex8A, and Ex8B treated myoblasts. Ex6A, Ex6B, Ex8A, and the cocktail-treated myoblasts showed in-frame products. The cocktail and Ex6A/B showed 100% in-frame products, while Ex8A showed only 30% in-frame products (Figure 7). To confirm exon skipping and restoration of the reading frame, cDNA sequencing was performed; the results indicated that exons 6 - 9 had indeed been skipped (Figure 7). Immunohistochemistry showed that AON-treated dogs had increased dystrophin-positive fibers compared to NT samples (Figure 8).
In Vivo Experiments
To compare the efficiency of various AON treatment conditions, CXMD dogs (0.5 - 5 years old) were injected once with 1.2 mg Ex6A or a cocktail of Ex6A, Ex6B, and Ex8A at various dosages. Two weeks after the injection, muscle samples were collected and stained with DYS-1 to compare the number of dystrophin-positive fibers. All cocktail-treated samples showed increased dystrophin expression compared to NT samples. Dystrophin-positive fibers increased with AON dosage (Figure 9). Following systemic injection, wild-type (WT), NT, and cocktail-treated CXMD muscle samples were stained with DYS-1 (Figure 10). Cocktail-treated CXMD dogs showed increased dystrophin expression compared to NT CXMD dogs, both in CT and heart muscle samples. However, AON-treated skeletal muscle (CT) showed much higher expression of dystrophin compared to treated cardiac muscle. An immunoblot comparing WT, NT, and various morpholino cocktail-treated muscles led to the same conclusion. There was also a large range of dystrophin expression in the treated skeletal muscle samples (Figure 10). Hematoxylin and eosin (HE) staining revealed that treated CXMD dogs showed improved histopathology, with a significant decrease in centrally-nucleated fibers (CNF) in comparison to NT CXMD dogs (Figure 11). This indicates there is more degeneration/regeneration occurring in the NT dog, a sign of dystrophic muscle pathology. Additionally, treated dogs had faster running times and improved scores on the clinical grading scale. Treated CXMD dogs showed better scores than NT CXMD dogs in all categories (Figure 12).

Figure 1. Mutation Pattern of the CXMD Dog and Exons 6 - 8 Skipping Strategies Using an Antisense Cocktail. CXMD dogs have a point mutation in exon 6 leading to a loss of exon 7 in dystrophic dog mRNA. This results in the mRNA being out-of-frame and dystrophin protein production is lost. Short AON sequences are designed to bind to exon 6 and 8, which results in mRNA splicing effectively skipping exons 6 - 8. The gray bar in the AON cocktail-treated dogs represents short AON sequences. Exon 9 encodes a hinge domain and is sometimes spontaneously spliced out with AONs against exon 6 and 8. The resulting mRNA codes for dystrophin proteins that are shorter but functional. Please click here to view a larger version of this figure.

Figure 2. Major Clinical Symptoms of a 1-year-old Canine X-linked Muscular Dystrophy (CXMD) Animal. A 1-year-old wild-type beagle and a CXMD dog are shown. The involvement of proximal, limb, and temporal muscles are typically observed from 2 months of age. Joint contracture and a shifting of the pelvis are overt from 4 months of age. Please click here to view a larger version of this figure.

Figure 3. General Anesthesia for a Dog. A) Intramuscular injections and muscle biopsies are performed under general anesthesia with isoflurane. B) Holding of the animal for systemic injections. Please click here to view a larger version of this figure.

Figure 4. Magnetic Resonance Imaging (MRI) of Wild-type, Non-treated CXMD, and Treated CXMD. MRI scans of the hind limb at 3 months and 5 months in WT and NT CXMD dogs. Two sample images of treated CXMD hind limb MRIs pre- (1 week before the first injection) and post-injection of AON are shown. 2703MA was treated 7x weekly with 200 mg/kg cocktail morpholinos. 2001MA was treated with 5x weekly IV injection of 120 mg/kg cocktail morpholinos. Control and treated dogs were age-matched. Treated dogs show decreased T2 signals. Images are adapted with permission from Yokota et al. (copyright 2009, John Wiley & Sons) 40 Please click here to view a larger version of this figure.

Figure 5. Muscle Biopsy Procedure for a Dog. A) A lower limb is fixed for muscle biopsy. B) With the help of forceps, the lower limb is held. C) The CT muscle is exposed. Open biopsy technique is used to obtain muscle samples of injected sites. Threads are used to hold biopsy samples. D) Muscle samples on tragacanth gum after dissection. Please click here to view a larger version of this figure.

Figure 6. Semi-dry Transfer Method. A representation of the semi-dry transfer method for Western blotting is presented. Three papers soaked in concentrated anode buffer are laid down at the negative terminal; 3 papers soaked in anode buffer are stacked on top of this. The Mb PVDF paper is soaked in methanol and then anode buffer before being laid on top of the 6 papers. The gel, which has been soaked in cathode buffer, is laid gently over the PVDF paper. Finally, 3 papers soaked in cathode buffer are laid on top of the gel. The positive terminal is set on top. For 1 hr, 400 mA is run through the system. Please click here to view a larger version of this figure.

Figure 7. Exon Skipping in CXMD Myoblasts. CXMD myoblasts were transfected with Ex6A, Ex6B, Ex8A, or Ex8B alone, or a cocktail of all four. A total of 600 nM was used for the individual sequences and for the cocktail 600 nM of each sequence was used. A) 2'OMePS treatment in CXMD dog myoblasts. Ex6A, Ex6B, and the cocktail-treated samples show strong bands at the expected position of in-frame exon-skipped transcripts. Ex8A shows an intermediate band, Ex8B shows a weak band, and NT does not show a band at the in-frame position. B) cDNA sequencing from Ex6A alone, 4 days after transfection. Images are adapted with permission from Yokota et al. (copyright 2009, John Wiley & Sons) 40. Please click here to view a larger version of this figure.

Figure 8. Increased Dystrophin Expression in 2'O-methylated Phosphorothioate (2'OMePS) Transfected CXMD Myoblasts. CXMD myoblasts were transfected with Ex6A alone or with cocktail 2'OMePS. DYS-2 (red) and DAPI (blue) staining are shown. The treated myoblasts are compared to wild-type (WT) and non-treated (NT) myoblasts. Images are adapted with permission from Yokota et al. (copyright 2009, John Wiley & Sons) 40. Bar = 50 µm. Please click here to view a larger version of this figure.

Figure 9. Rescue of Dystrophin Expression with Intramuscular Injections of Morpholinos in CXMD Dogs. Either Ex6A alone or a cocktail of Ex6A, Ex6B, and Ex8A were injected into the CT muscles of CXMD dogs. Dystrophin (DSY-1) staining of wild-type (WT), non-treated (NT), and treated CXMD dogs are shown. Dogs were either treated with 1.2 mg Ex6A alone or 1.2 mg cocktail. Images are adapted with permission from Yokota et al. (copyright 2009, John Wiley & Sons) 40. Bar = 100 µm. Please click here to view a larger version of this figure.

Figure 10. Increased Dystrophin Expression After Systemic Cocktail Morpholino Treatment in CXMD Dogs. Dystrophin (DYS-1) staining was used to compare dystrophin expression in wild type (WT) (positive control), non-treated (NT) (negative control), and CXMD dogs treated with 120 mg/kg morpholino cocktail (40 mg/kg of each AON). The morpholino cocktail contained Ex6A, Ex6B, and Ex8A. Dogs were injected intravenously 5 times weekly with this cocktail. A) A comparison of dystrophin expression in cranial tibial (CT) muscles of WT, NT, and treated dogs. B) A comparison of dystrophin expression in heart tissue between NT and morpholino cocktail-treated dogs. C) Immunoblot for dystrophin with desmin as a loading control is shown for WT, NT, and morpholino cocktail-treated dogs. The following muscles are shown for treated dogs: triceps brachii (TB), biceps brachii (BB), diaphragm (DIA), esophagus (ESO), CT, adductor (ADD), extensor digitorum longus (EDL), masseter (MAS), and heart. Images are adapted with permission from Yokota et al. (copyright 2009, John Wiley & Sons) 40. Bar = 200 µm. Please click here to view a larger version of this figure.

Figure 11. Improved Histopathology in CXMD Dogs Treated For 7 Weeks with 240 mg/kg Morpholino Cocktail. CXMD dogs ranging from half a year to five years old were injected intravenously with 240 mg/kg morpholino cocktail (Ex6A, Ex6B, and Ex8A) once a week for 7 weeks. Fourteen days after the last injection, esophagus muscles were taken and hematoxylin and eosin (HE) staining was done. HE staining of esophagus muscles from non-treated (NT) and morpholino cocktail-treated (Treated) CXMD dogs (40X objective lens). Please click here to view a larger version of this figure.

Figure 12. Improved Scores on Clinical Grading and 15 m Running Time After Morpholino Treatment. Morpholino-treated dogs were compared to non-treated (NT) littermates. Error bars in the graph indicate SEM. A) Total score on the clinical grading exam was calculated before and after treatment and treated animals were compared with NT littermates. B) A comparison of 15 m running times of treated and NT dogs. C) Similar to B; however, younger dogs were used. Images are adapted with permission from Yokota et al. (copyright 2009, John Wiley & Sons) 40. Please click here to view a larger version of this figure.
| Antisense Oligonucleotide | Nucleotide Sequence |
| Ex6A | GTTGATTGTCGGACCCAGCTCAGG |
| Ex6B | ACCTATGACTGTGGATGAGAGCGTT |
| Ex8A | CTTCCTGGATGGCTTCAATGCTCAC |
Table 1. Antisense Oligonucleotide Design.