Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Multi-exon Skipping Brug Cocktail antisenseoligonukleotider i Canine X-bundet Muskelsvindfonden

doi: 10.3791/53776 Published: May 24, 2016
* These authors contributed equally

Summary

Exon skipping er i øjeblikket en mest lovende behandlingsmulighed for Duchennes muskeldystrofi (DMD). For at udvide anvendeligheden for DMD patienter og optimere stabiliteten / funktion af de resulterende trunkerede dystrofin proteiner, blev en multi-exon springe tilgang med cocktail antisense oligonukleotider udviklet og vi viste systemisk dystrofin redning i en hund model.

Abstract

Duchenne muskeldystrofi (DMD) er en af de mest almindelige dødelige genetiske sygdomme verden over, som skyldes mutationer i dystrofin (DMD) genet. Exon skipping beskæftiger kort DNA / RNA-lignende molekyler kaldet antisense oligonukleotider (AONs), der genopretter læsning ramme og producerer kortere, men funktionelle proteiner. Imidlertid exon skipping terapi står over for to store forhindringer: begrænset anvendelighed (op til kun 13% af patienterne kan behandles med en enkelt AON lægemiddel) og usikker funktion af trunkerede proteiner. Disse spørgsmål blev behandlet med en cocktail AON tilgang. Mens ca. 70% af DMD patienter kan behandles ved en enkelt exon skipping (alle exoner kombineret), kunne man potentiel behandling mere end 90% af DMD patienter, hvis multiple exon skipping hjælp cocktail antisenselægemidler kan realiseres. Hunde X-bundet muskeldystrofi (CXMD) hundemodel, hvis fænotype er mere ligner humane DMD patienter, blev anvendt til at teste den systemiske effekACY og sikkerheden af multi-exon skipping af exon 6 og 8. CXMD hundemodel huser et splejsningssted mutation i intron 6, som fører til en mangel på exon 7 i dystrofin mRNA. For at gendanne læseramme CXMD kræver multi-exon skipping af exon 6 og 8; Derfor CXMD er en god mellemstor dyremodel til test af effekten og sikkerheden af ​​multi-exon skipping. I den aktuelle undersøgelse blev en cocktail af antisense morpholinos målrettet exon 6 og exon 8 konstrueret og det gendannede dystrofinekspression i kroppen hele skeletmuskulatur. Metoder til transfektion / injektion af cocktail oligoer og evaluering af effekten og sikkerheden af ​​multi-exon skipping i CXMD hund model præsenteres.

Introduction

Duchenne muskeldystrofi (DMD) er en X-linked recessive muskel lidelse karakteriseret ved fremadskridende muskelsvaghed, først beskrevet af Dr. Guillaume-Benjamin-Amand Duchenne (de Boulogne) 1. DMD er en almindelig genetisk sygdom, der påvirker omkring 1 i 3500 drenge i hele verden, med cirka 20.000 berørte børn født hvert år 2,3. Motoriske udvikling er forsinket, og gangforstyrrelser ses i den tidlige barndom 4, efterfulgt af afhængighed kørestol ved om de tidlige teenageår. Døden opstår typisk i alderen mellem 20 og 30 på grund af respiratorisk eller hjertesvigt 5-8. Der er i øjeblikket ingen helbredelse for DMD. Behandling med glukokortikoider kan bremse udviklingen af muskeldegeneration til en vis grad, men er forbundet med betydelige bivirkninger, herunder fedme og diabetes mellitus 2,7,8. DMD skyldes mutationer i dystrofin (DMD) genet, hvilket fører til et tab af funktionel dystrofin Protein. DMD er en meget stor gen med over 2 millioner basepar og 79 exons 9,10. Sletning, nonsense, og dobbeltarbejde mutationer, der fører til out-of-frame mutationer er den mest almindelige årsag til DMD fænotype. Regionerne exonerne 3 - 9 og exon 45 - 55 betegnes "mutation hotspots" som de fleste patienter har deletionsmutationer inden for disse dele af genet, hvilket fører til ikke-funktionelle dystrofin i DMD patienter 3,9,11-16. Dystrofin funktioner i dystrofin-glycoprotein-kompleks (DGC), som har en afgørende rolle i stabilisering muskel membran. Den N- og C-termini er de vigtigste områder for funktion, mens den centrale stang domænet spiller en mindre vigtig rolle 3,9,17. Overholdelsen af en mild fænotype forbundet med Becker muskeldystrofi (BMD), som for det meste skyldes i-frame mutationer i DMD-genet, inspireret anvendelse af exon springe til behandling af DMD. BMD patienter har en forkortet, men functional, dystrophinprotein, der fastholder begge termini 3,6,18. Exon skipping, i teorien, kan gendanne læserammen, hvilket resulterer i forkortede-men-funktionelle dystrofin proteiner ligner dem, der ses i BMD 3,19.

Flere typer af antisense oligonukleotider (AONs) er blevet afprøvet i kliniske forsøg, herunder 2'O-methylerede phosphorthioater (2'OMePS) og phosphordiamidat morpholino oligomerer (PMOS). Skipping exon 51 og 53 ved hjælp af disse AONs er blevet undersøgt, og mens resultaterne er lovende, er single-exon skipping begrænset anvendelighed, da det er mutationsspecifikke 3, 19, 20,21, 22-26. Spørgsmål også fortsat om stabiliteten af de resulterende forkortede dystrofin proteiner fremstillet af single-exon springe 22,23. Derudover nogle patienter kræver mere end en enkelt exon, der skal springes over for at genoprette læserammen 3. Mens teknisk vanskeligere, multi-exon skipping er en metode, derkunne løse disse problemer 3,19. Multi-exon skipping er tidligere blevet påvist i dystrofisk hund og humane cellelinier in vitro. Derudover har mdx52 mus og hunde X-bundet muskeldystrofi (CXMD) Hund modeller blevet anvendt til undersøgelser in vivo 22, 24-27. Canine X-bundet muskeldystrofi Japan (CXMD J) beagler blev anvendt her, som læserammen for CXMD J kan genoprettes ved multi-exon skipping af exon 6 og 8, eller yderligere exoner (f.eks exonerne 3 - 9) (fig 1). Beagle-baserede CXMD deler den samme mutation mønster som Golden Retriever muskelsvind (GRMD) model, men beagles er mindre og billigere at vedligeholde på grund af deres krop størrelse, hvilket giver en nyttig model for DMD 28,29. CXMD hunde mere nøje efterligner den menneskelige DMD fænotype end mindre dyremodeller, ligesom gnaver, og er mere pålidelige for toksikologiske vurderinger 3,22,30,31 (Figur 2). CXMD hunde vise progressiv muskel forfald, gangforstyrrelser, og hjerte- og åndedrætsproblemer ligner dem, der ses i DMD. Sammenlignet med single-exon skipping, multi-exon skipping er gældende for en meget større andel af patienterne. Blandt de tre mest almindelige mutation typer (deletioner, nonsens, og dobbeltarbejde), 80 - kunne 98% af patienterne behandles gennem multi-exon skipping 14,32,33, mens 45% af alle DMD patienter kunne drage fordel af specifikt springer exons 45 - 55 3,19,22,34.

Med udviklingen af ​​modificerede morpholinos, har effektiviteten af ​​AON cocktails på at lette exon springe forbedret. Arginin-rige celle-gennemtrængende peptid-konjugeret projektstyringskontorer (PPMOs), og vivo-morpholinoer (vPMOs) er AON kemier, der har væsentligt forbedrede celle-gennemtrængende evne og stabilitet 3,35-38. Bekymringer forblive om langsigtet AON toksicitet; dog betydelige fremskridtDer er gjort. Kemiske foretaget morpholinoer ændringer i høj grad falde off-target effekter og prækliniske studier har rapporteret om signifikante toksiske virkninger 3,22,39,40. En tilbageværende udfordring for multi-exon skipping er det nuværende krav for hver enkelt AON skal testes for toksicitet alene, som et enkelt lægemiddel, i stedet for sammen som en cocktail 3,19,22,41,42. I DMD undersøgelser med både single og multi-exon Skipping målrettet til hjertet, har der været lidt forbedring i dystrofisk hjerte væv. Effekten af ​​morpholinos i hjertet menes at være lav på grund af dårlig celle-gennemtrængende evne. Peptid-konjugerede PPMOs har forbedret evne AONs at trænge ind hjerteceller, forøgelse af mængden af funktionelle dystrophinprotein reddet i hjertet 3,19,38.

Her er vores AON cocktail tilgang drøftet indgående, herunder design af AON sekvenser ved hjælp ESEfinder software 43. Protocoler til hund eksperimenter med multi-exon skipping er også beskrevet. CXMD J beagler blev anvendt til exon 6 og 8 springer eksperimenter. Multi-exon springe i CXMD hund model viser lovende resultater, men udfordringer, der skal overvindes, før de er klinisk relevant.

Protocol

Alle protokoller, der er anført nedenfor er i overensstemmelse med retningslinjerne for dyr pleje, der er fremsat af National Center for Neurologi og Psykiatri (NCNP) i Japan. Alle forsøg blev godkendt af Institutional Animal Care og brug Udvalg NCNP.

1. Design af antisense Oligo

  1. Brug rednings ESE og ESEfinder programmer til at opdage ESE steder 44, 45-47.
  2. Design 25 basepar (bp) sekvenser, som er antisense til exoner, der skal målrettes. Target exon 6 og 8 i hundens model (figur 1).
    1. Brug 25 - 30 bp sekvenser for projektstyringskontorer (tabel 1) eller 25 bp for 2'OMePS. At designe 25 bp sekvenser, vælge sekvenser, der er inden for det ønskede område. Overvej sekundær struktur, undgåelse af heterodimerer, exon splejsning forstærker motiver, og GC-indhold til at skabe stabile sekvenser 43. AONs bør målrettes mod mindst én af ESE sites som identificeret ved den ovennævnte software.
    2. Vælg AONs med et GC-indhold, der er mindre end 65%, med færre end 4 på hinanden følgende 'G, og ikke indeholder selvstændige komplementære sekvenser. Brug NCBI Blast software til at forudsige off-target annealingsites 22,48,49.
  3. Vælg en passende AON rygrad kemi. For in vitro-forsøg bruger 2'O-methyl oligonukleotider (2'OMePS) eller morpholinoer. For in vivo eksperimenter, brug 2'OMePS, morpholinoer eller vPMOs. 3,19,48,50

2. In Vitro Eksperimenter (Exon 6 og 8 Skipping i CXMD Model)

  1. 2'OMePS Transfektion af Hund Myoblaster
    1. Kultur CXMD myoblaster i 3 ml vækstmedium i 6-brønds plader. Seed 1 - 5 x 10 3 celler / cm2 med 0,5 ml / cm2 af medium til myoblaster. For vækstmediet, bruge Dulbeccos modificerede Eagles medium (DMEM) med 10% føtalt bovint serum (FBS) og 1%penicillin / streptomycin (P / S) 40.
    2. Der inkuberes ved 37 ° C, indtil 60 - med 80% sammenflydende. Dette tager ca. 12 til 24 timer.
    3. Fortynd en kationisk liposom transficere middel til i alt 100 pi i reduceret serummedium (2: 1-forhold transficerende agent: AONs, fx, 10 pi Lipofectin vs. 5 ug AONs). Lad blandingen henstå ved stuetemperatur i 30 - 45 min.
    4. Fortynd AONs (2'OMePS eller morpholinoer) til et slutvolumen på 100 pi i reduceret serummedium.
    5. Kombiner den fortyndede transfektion middel med fortyndet AONs og inkuberes ved stuetemperatur i 10 - 15 min.
    6. Mens transfektion agent / AON blanding sidder ved RT, fjerne gamle medier fra celler via aspiration og vask celler med medierne.
    7. Tilføj 0,8 ml medium til transfektion agent / AON blandingen og tilsæt derefter hele løsning på de frisk vaskede celler. Inkuber i 3 timer ved 37 ° C.
    8. Efter inkubation, erstatter medier med OBion medier (DM); differentiering kan tage op til 10 dage. Kontroller, om differentiering er forekommet starter ved omkring dag 3. differentiering medier er DMEM med 2% hesteserum, 200 U / ml penicillin, 200 mg / ml streptomycin, og 10 ug / ml insulin.
  2. Morpholino Transfektion af Hund Myoblaster
    1. Kultur CXMD myoblaster i vækstmedium som beskrevet i trin 2.1.
    2. Skift til differentiering medium (DM), og der tilsættes 0,1 mM stamopløsning morpholino til hver brønd for at gøre slutkoncentrationen 1 uM. Heat cocktail morpholinos ved 65 ° C i 10 minutter før transfektion eller injektion for at undgå AON aggregering. Tilføj et peptid levering reagens 39,51 og justere til en endelig koncentration på 3. - 6. uM.
    3. Efter 16-48 timers inkubation, indsamle celler til RNA ekstraktion. Tilsæt 1 ml syreguanidiniumthiocyanat-phenol-chloroform til cellerne for at frigøre celler fra pladen. Udfør RNA udvindetion efter dette trin.
      1. Alternativt tilsættes trypsin så det dækker alle celler og inkuberes i 2 minutter ved 37 ° C.
        Bemærk: Hvis agter at foretage immunkemi, bruge Chambered slide briller til dyrkning. Efter differentiering kan celler fastgøres ved hjælp paraformaldehyd (PFA) (4% i 10 min).
  3. RNA-ekstraktion og Reverse Transcription Polymerase Chain Reaction (RT-PCR)
    1. Når cellerne er differentieret i myorør, fjerne medium og tilsæt 1 ml syreguanidiniumthiocyanat-phenol-chloroform; inkuberes i 10 minutter ved stuetemperatur.
    2. Overførsel til 1,5 ml rør. Kombiner med 200 pi chloroform og inkuberes ved stuetemperatur i 2 min, indtil tre separate lag kan ses. De tre lag fra top til bund er: et RNA lag, et DNA lag, og et protein lag.
    3. Der centrifugeres ved 12.000 x g i 15 minutter ved 4 ° C. Fjerne det øverste lag supernatanten og sted i et rør med 500 & #181 l isopropanol (hvis stopper her, Supernatanten opbevares ved -80 ° C). Centrifuger supernatanten ved 12.000 x g i 10 minutter ved 4 ° C; efter centrifugering, holde den resulterende RNA pellet og kassér supernatanten.
    4. Vask pelleten med ethanol og centrifugeres ved 8.000 xg i 5 min ved 4 ° C. Fordampe resterende ethanol ved at vende røret i 15 minutter og tilsæt derefter 15 - 30 pi RNase-frit vand. Kvantificere total RNA koncentration ved hjælp US / VIS spektroskopi ved 260 nm.
    5. Kombiner de nødvendige reagenser til en RT-PCR-reaktion: 1.5 pi 10 pM forward primer, 1.5 pi 10 pM reverse primer, 1 pi dNTP, 5 pi ettrins-PCR-kittet puffer, 0,7 pi RNase inhibitor, 1 pi enzymblanding fra en- trin PCR kit, og 200 ng af RNA. Når disse er blevet blandet, tilsæt vand til et endeligt volumen på 25 pi.
    6. Placer blandingen i en termo-cycler. Kør en 30 min cyklus ved 50 ° C, en 15 min0; cyklus ved 95 ° C, derefter 35 cykler ved 94 ° C i 1 min, 60 ° C i 1 min og 72 ° C i 1 min. Endelig køre en 10 min cyklus ved 72 ° C. Store PCR-produkt i køleskab ved 4 ° C eller -20 ° C
  4. Komplementær DNA (cDNA) Sekventering
    1. Identificer exon 6 - 9-oversprungne bands ved hjælp af agarosegelelektroforese. Belastning 5 pi af hver prøve i brøndene på en 1,5% agarosegel, køre 135 V gennem gelen i 5 min og derefter 120 V i 20 min. Dernæst inkuberes gelen i DNA gel pletten ved stuetemperatur i 30 min. Visualiser bands bruger imaging software.
    2. Udskære båndet af interesse under anvendelse af et Gel Extraction kit.
      1. Udskære DNA-fragmentet og solubilisere gelskiven anvendelse af 200 pi NTI / 100 mg gel. Lad denne sidde i 5 til 10 min i et 50 ° C vandbad. Derefter overføre til silicamembranen rør.
      2. Centrifuger ved 11.000 x g i 30 sek. Vask to gange med 700 pi NT3 buffer inden centrifuging igen ved 11000 x g i 30 sek.
      3. Tør silicamembranen ved centrifugering ved 11.000 x g i 1 min.
      4. Der tilsættes 15 - 30 fil NE buffer og lad det sidde ved stuetemperatur i 1 min. Derefter centrifugeres ved 11000 x g i 1 min. Fjern silicagel og holde indholdet i røret.
    3. Brug en sekventeringskit at bestemme sekvensen ifølge fabrikantens protokol.

3. intramuskulære injektioner eller Open muskelbiopsi

  1. Til vedligeholdelse af sterile forhold under overlevelse kirurgi, fjerne hår ved hjælp klippere i området omkring operationsstedet (bagbenet). Brug iodophorer eller klorhexidin som desinfektionsmiddel. Brug sterile afdækningsstykker til operationsstedet ved at placere og fastgøre dem over hele dyret og operationsbordet.
    1. Bær rene scrubs, ansigtsmasker, hovedbeklædning, sterile handsker og særlige sko til operationsstuen 52,53.
    2. </ Ol>
    3. Sprøjt CXMD hunde med 20 mg / kg af thiopentalnatrium at bedøve dem. Brug dyrlæge salve på øjnene for at forhindre øjnene mod udtørring.
    4. Brug 2 - 3 i% isofluran inhalation at opretholde generel anæstesi (Figur 3). Check muskel reflekser og overvåge hjerte og vejrtrækning at vurdere dybden af ​​bedøvelse. Den normale respiration sats (RR), puls (HR), og SpO 2 under fuld narkose er som følger: RR: 10 - 20 vejrtrækninger / min; SpO 2: 95 - 100%, HR: 80 - 120 slag i minuttet (bpm).
    5. Ved hjælp af en skalpel, skæres huden over kraniel tibial (CT), også kendt som tibialis anterior (TA), og gøre en enkelt snit ca. 5 cm i længderetningen (for unge voksne hunde). For at markere injektionssteder, sy den dybe fascia ved hjælp af en kirurgisk nål og kirurgisk tråd og lave to sting markører på 2 cm mellemrum.
    6. Injicer den ønskede koncentration af AONs i musklen med en 27 G nål. Den ønskede koncention varierer mellem behandling betingelser. For CT, give to injektioner af 1 ml volumen hver, i alt 1,2 mg cocktail projektstyringskontorer (0,4 mg hver PMO) eller 0,4 mg cocktail vPMOs (0,13 mg hver vPMO). For extensor carpi ulnaris (ECU) forben muskel, injicere to bind på 0,5 ml hver for i alt 1,2 mg cocktail projektstyringskontorer (0,4 mg hver PMO) eller 0,4 mg cocktail vPMOs (0,13 mg hver vPMO). Lad nålen i i 1 min. Brug samme mængde hver AON for cocktail.
    7. Udfør åben muskel biopsi ved at fjerne et stykke af muskelvæv ca. 2 cm i længde fra CT muskel ved anvendelse af en kirurgisk skalpel.
    8. Gå til trin 6,5 til forberedelse muskel prøve.
    9. Ved hjælp af en nål, indgivelse af en intramuskulær injektion på 0,02 mg / kg buprenorphinhydrochlorid før opvågning fra generel anæstesi. Lay muskelfascie og hud tilbage over muskler og sy disse ved hjælp af en 3-0 absorberbar tråd og 3-0 nylon tråd til muskelfascie og hud lukning, respektively.
    10. Mens du holder munden åben, afgøre, om gag refleks er vendt tilbage; når gag reflex er vendt tilbage, ekstuberes hunden.
    11. Administrere 15 til 30 mg / kg cefazolin eller cephalexin (antibiotika) i op til 3 dage via intravenøs eller intramuskulær injektion for at forhindre infektion.
    12. Fjern suturer inden for syv dage. Lad ikke hunden uden opsyn, indtil det har genvundet tilstrækkelig bevidsthed til at opretholde brystleje og tillader ikke hunden til at interagere med andre dyr, indtil en fuldstændig genopretning er lavet. Hold endotracheale rør på plads så længe som muligt og fjerne dem, når dyret begynder at tygge eller synke. Overvåg dyrets puls, åndedræt, og hydrering for at sikre de er stabile og inden for normale grænser.
    13. For post-kirurgi pleje, giver analgesi i 3 dage (f.eks buprenorphin 0,01 mg / kg) og sygepleje støtte, herunder en rolig, mørk hvilested, passende sår og bandage vedligeholdelse, en blødhvile overflade, rehydrering med orale eller parenterale væsker, og en tilbagevenden til normal fodring gennem brug af meget velsmagende fødevarer eller godbidder. Dyr, der kræver yderligere medicinering, giver en intramuskulær injektion af 0,3 mg / kg af butorphanoltartrat afhængigt af smerter symptomer.
      Bemærk: Hunde i smerte kan bide, ridse, eller vogte smertefulde områder, og hvis den håndteres, kan være usædvanligt bange eller aggressiv. Desuden smerter i et lem normalt resulterer i halten eller holde op af de ramte led med forsøg på at anvende den. I sådanne situationer, giver en intramuskulær injektion af 0,02 mg / kg af buprenorphin-hydrochlorid hver 6 - 8 time.

    4. Systemiske Injektioner

    Bemærk: Denne procedure kan gentages ugentligt eller hver anden uge for det ønskede antal uger.

    1. Begrænse hunde manuelt og forsigtigt ved at få hunden til at ligge ned og derefter drapere armene over skuldre og hofter til at holde hunden på plads i hele than procedure.
    2. Sprøjt AONs; 120 - 240 mg / kg cocktail projektstyringskontorer (40 - 80 mg hver AON) ved hjælp af en venøs indlagt nål i en legemsdel vene (kendt som en cephalic eller en vena vene). Mængden af ​​AON injicerede afhænger af eksperimentelle tilstand. Brug samme mængde hver AON for cocktail.
    3. Brug infusionspumpe eller sprøjte driver til at injicere 50 ml totalt ved en hastighed på 2,5 ml / min i 20 min, efter producentens anvisninger. Gentag injektioner ugentligt eller hver anden uge (hver anden uge) mindst 5 gange, som dystrofinekspression vil akkumulere med gentagne injektioner.
    4. Udfør blodprøver ugentligt at undersøge toksicitet.
      1. Ved hjælp af en nål, indsamle 3 ml blod - 0,5 ml til komplet blodtælling (CBC) og 2,5 ml til andre - fra en af ​​de subkutane vener i forgrunden eller bagben. Medtag CBC, gamma- glutamyltransferase (GGT), aspartat aminotransferase (AST), blod urea nitrogen (BUN), alanin aminotransferase (ALT), kreatinkinase (CK), og kreatinin vurderinger når teste indsamlede blod, efter producentens anvisninger fra blod testkit. 40,54

    5. Klinisk Grading of Dogs

    1. Opsæt et videokamera og optage hundeadfærd og gangart. Optage hele mødet med hunden, da dette vil fungere som en reference, når klassificering hunden; det betyder hver video vil være en anden længde, afhængigt af hundens evner og vilje. Brug standard optagelse parametre. Optagelserne skaber en registrering af indplacering, så det kan blive gennemgået på et senere tidspunkt.
    2. Grade gangart og bevægelse forstyrrelser.
      1. For gangart og bevægelse forstyrrelser, bruge følgende kvaliteter:
        grad 1 = ingen, grad 2 = sidder med bagben forlænget, grad 3 = bunny-humle med bagbenene, grad 4 = blander gåtur, og grad 5 = ude af stand til at gå.
      2. For mobilitet forstyrrelse, bruge følgende kvaliteter: klasse 1 = ingen, grade 2 = liggende mere end normalt, grad 3 = kan ikke hoppe på bagbenene, grad 4 = stigende sværhedsgrad bevæger sig rundt, og grad 5 = ikke komme op og bevæge sig rundt.
    3. Tid, hvor lang tid det tager hunden til at køre 15 m. Afmål 15 m, placer hunden ved startlinien og tilskynde den til at køre, indtil 15 m mærket.
    4. Bestem muskelatrofi af benet ved hjælp af følgende karakterskala:
      grad 1 = ingen, grad 2 = mistænkte hårdhed, grad 3 = kan føle hårdhed eller synes tynde, klasse 4 = mellem kvaliteter 3 og 5, og grad 5 = ekstremt tynd eller hård.
    5. Grade savlen ved hjælp af følgende skala: grad 1 = ingen, grad 2 = lejlighedsvis dribler spyt, når man sidder, grad 3 = nogle savle når de spiser og drikker, grad 4 = strenge af savle når de spiser eller drikker, og grad 5 = kontinuerlig savle.
    6. Grade hypertrofi af tungen (macroglossia) ved hjælp af følgende skala: grad 1 = ingen, grad 2 = lidt forstørret, grad 3 = udvidet Stykker af plastde tandsæt, grad 4 = udvidet og lidt fortykket, og lønklasse 5 = udvidet og fortykket.
    7. Grade hundens evne til at sluge bruge følgende skala: grad 1 = ingen problemer, klasse 2 = tager tid og kræfter i at tage mad, grad 3 = svært ved at tage mad fra en plade, grad 4 = besvær med at tygge, synke eller drikke og grad 5 = ude af stand til at spise.
    8. Beregn samlede karakter ved at tilføje scores fra hver kategori (med undtagelse af 15 m kører test) 55.
      Bemærk: Undersøgelserne skal blindet for ikke at indføre bias.

    6. Magnetic Resonance Imaging (MRI)

    1. Brug en 3 Tesla (3T) MR og 18 cm i diameter / 18 cm længde menneske ekstremitet spole for at opnå T2-vægtede billeder af hind-lemmer.
    2. Bedøver dyr ved at injicere CXMD hunde med 20 mg / kg af thiopental. Brug dyrlæge salve på øjnene for at forhindre øjnene mod udtørring. Brug 2-3% isofluran inhalation at opretholde generel anæstesi.
      1. Check muskel reflekser og overvåge hjerte og vejrtrækning at vurdere dybden af ​​bedøvelse. Den normale respiration sats (RR), puls (HR) og SpO 2 under generel anæstesi er som følger: RR: 10 - 20 vejrtrækninger / min, SpO 2: 95 - 100%, HR: 80 - 120 slag i minuttet (bpm ).
    3. Brug følgende indstillinger til at opnå T2-vægtede billeder: TR / TE = 4000/85 msek, skive tykkelse = 6 mm, skive hul = 0 mm, synsfelt = 18 cm x 18 cm, matrix size = 256 x 256, og række opkøb = 3 under hurtig spin-ekko (figur 4).

    7. Muskel prøveudtagning og klargøring (Obduktion)

    Bemærk: Musklerne bør udtages prøver en eller to uger efter den sidste AON injektion.

    1. Injicere hunde med 20 mg / kg af thiopentalnatrium at bedøve dem. Brug dyrlæge salve på øjnene under bedøvelse for at forhindre udtørring af øjnene.
    2. Brug 2 - 3 i% isofluran inhalation at opretholde Anesvelse. Check muskel reflekser og overvåge hjerte og vejrtrækning at vurdere dybden af ​​bedøvelse. Den normale respiration sats (RR), puls (HR) og SpO 2 under fuld narkose er som følger: RR: 10 - 20 vejrtrækninger / min; SpO 2: 95 - 100%, HR: 80-120 bpm.
      1. Afliv hunde ved afblødning under generel anæstesi (for obduktion kun). Brug afblødning under totalbedøvelse at undgå virkningerne forårsaget af blodafledte faktorer i molekylær analyse (f.eks kardiale muskler).
    3. Dissekerer følgende muskler (figur 5): CT, extensor digitorum longus (EDL), gastrocnemius, soleus, biceps femoris, rectus femoris, overarmsmuskel brachii, triceps brachii, deltoid, ECU, extensor carpi radialis (ECR), flexor carpi ulnaris (FCU ), flexor carpi radialis (FCR), gracilis, intercostal, mavemuskler, mellemgulvet, lateral dorsi, spiserør, sternocleidomastoideus, og hjerte. At undersøge toksicitet, indsamle nyre og liver prøver. Brug Evans og Alexander de Lahunta (2009) som en reference for dissektion teknik 56.
    4. Skær CT, EDL, gastrocnemius, soleus, biceps femoris, rectus femoris, biceps brachii, triceps brachii, deltoid, ECU, ECR, FCU, FCR, gracilis, intercostal, mavemuskler, lateral dorsi, spiserør, sternocleidomastoideus, hjerte, nyre, og lever i små sektioner ca. 1 - 1,5 cm i længden. Rul mellemgulvet op og derefter skæres i 1 - 1,5 cm §§ 56.
    5. Placer tragantgummi, så det er ca. 0,5 - 1 cm tyk på kork diske. Label diske med dyrets identifikation og muskel navn på den modsatte side af tragacanthgummi.
    6. Placer muskler med deres længdeakse vinkelret på proppen i tragacanthgummi.
    7. Placer propper i en beholder isopentan, der sidder i flydende nitrogen. Flyt den rundt hele tiden med en pincet i 1 min eller indtil den er helt frosset. Opbevar muskler på propperi hætteglas ved -80 ° C. Ved transport, sætte hætteglas på tøris.
    8. Forbered objektglas mærket med identifikation af dyr / muskel navn og dato.
    9. I en kryostat afkølet til -25 ° C, montere proppen til stativet. Indstil snittykkelse til det ønskede niveau. Brug 8 um til immunhistokemi og 12 um for hematoxylin og eosin (HE) -farvning. Brug 15 pm til Western blot prøver. Trim omkring en fjerdedel af musklen for at opnå en flad muskel for korrekt muskel prøveudtagning.
    10. Skæring en sektion af muskel ad gangen, sted hver 6. afsnit om den samme glasplade, hvis planlægning at bruge prøver til immunhistokemi eller HE farvning. Hvis du bruger prøver til Western blots, sætte 30 - 40 sektioner i et rør og opbevares ved -80 ° C.
    11. Efter fremstilling af objektglas, lad objektglassene tørre i 1,5 timer ved stuetemperatur. Store glider ved -80 ° C.

    8. Immunhistokemi

    1. Fjern forberedte slides fra opbevaring og placere dem iet fugtighedsindhold kammer til at holde objektglassene adskilt og opretholde fugt. Fyld fugt kammer, så at bunden er netop dækket med vand (ca. 1 mm vand).
    2. Lufttørre i 0,5 timer. Tegn en firkant omslutter musklen prøven på dias ved hjælp af en hydrofob barriere pen.
    3. Tilsæt 15% gedeserum i phosphatpufret saltvand (PBS) og inkuberes i 2 timer ved stuetemperatur Ved blokering reagens.
    4. Tilføj anti-dystrofin stang domæne (DYS-1) muse-monoklonalt primært antistof, eller C-terminale monoklonalt antistof (DYS-2) til hund dystrofin-farvning (1: 150 fortynding). Fortynd anvendelse af et blokerende middel i 1,25 ml PBS. Inkuber O / N i køleskab et 4 ° C.
    5. Vask med PBS i 5 minutter, gentaget tre gange. Tilføj sekundært antistof Alexa 594 gede-antistof mod muse IgG1 (for DYS-2) eller IgG2 (for DYS-1) (1: 2.500). Fortynd med en blokerende reagens i PBS indeholdende 0,1% octyl phenol ethoxylat. Inkuber i 0,5 timer ved stuetemperatur.
    6. Vask med PBS i 5 minutter, tre tIME'er. Lad dias til tørre. Tilsæt 1 - 2 dråber (3 ng / ml) 4 ', 6-diamidino-2-phenylindol (DAPI) monterings opløsning. Med en pincet, placere en glas slip over toppen af ​​sektionerne, undgå bobler.
    7. Vis dystrophin- (DYS-1 / DYS-2) positive fibre under en fluorescerende mikroskop ved 594 nm ved 20X forstørrelse.

    9. Western Blotting

    1. Tilføj indsamlede muskel sektioner fra cryo-sektionering til 150 ul prøvebuffer på is.
    2. Ved hjælp af en hånd homogenisator kortvarigt homogenisere proteinprøver. Heat prøver i et 1,5 ml rør i en varmeblok inkubator ved 95 ° C i 3 - 5 min. Der centrifugeres ved 16.500 x g i 15 minutter og den ovenstående væske opsamles.
    3. Store portioner af supernatanten ved -70 ° C. Brug destilleret vand for at fortynde til 100x.
    4. Bestem proteinkoncentration ved anvendelse af et kommercielt kit ifølge producentens protokol. Tilføj 2x Laemmli SDS-loading buffer til prøver og varme i 3 min &# 160; ved 95 ° C.
    5. Load prøver til 3 - 8% Tris-acetat gel før du kører det i 3 timer ved 150 V. Medtag flere fortyndet vildtype (WT) prøver (f.eks 1%, 10% og 50%) for kvantificering. bør detekteres mindre end 1 vægt-% niveauer af dystrofin med denne metode.
    6. Gelen anbringes i katoden buffer i 20 min. I løbet af denne tid, tage ni stykker filterpapir og sætte dem i transfer buffere (3 papirer i katoden buffer [+], anode buffer ([-], og den koncentrerede anode buffer [-], henholdsvis) Dette. beskriver en halvtør overførselsmetode hvilket øger følsomheden (figur 6).
    7. Soak en PVDF-membran i methanol i 20 sek og derefter placere i anoden buffer.
      Opsætning af gelen med membranen for at halvtørre overførsel og lad den køre 1,5 timer ved 400 mA i RT eller i et koldt rum.
    8. Vask membranen med PBS. Inkuber membranen i en blanding af PBS med Tween 20 (PBST) og 5% mælkepulver i 2 timer.
    9. Fortynd DYS-1 (primært antistof) i PBST og 5% mælkepulver blandingen til en 1: 100 fortynding. Føje den til membranen og lad det inkubere i mindst 1 time. Vask tre gange med 100 ml PBST i 15 min hver.
    10. Tilføj 65 pl / bane af HRP konjugeret sekundært antistof (anti-muse-IgG2a for DYS1) ved 1: 5000 fortynding i 1 time ved stuetemperatur i mørke omgivelser. Derefter vaskes med tre gange med 200 ml PBST i 20 minutter. Bland løsninger fra en afsløring kit som anvist. Der inkuberes i 1 min.
    11. Udvikle film at opdage bands og analysere med ImageJ software 48,57,58.

Representative Results

In Vitro Eksperimenter

Myoblaster blev transficeret med forskellige 2'OMePS behandling betingelser for at sammenligne effektiviteten af ​​hver AON. Single Aon behandlinger med 600 nM af hver af Ex6A, Ex6B, Ex8A eller Ex8B blev gjort, samt en cocktail behandling med 600 nM af hver af alle 4 Aon sekvenser. RNA-prøver blev opsamlet fire dage efter transfektion. Efter RT-PCR, blev prøver fra hvert behandlingsregime kørt på en gel sammen med ikke-behandlede (NT) prøver. Bands højere på gelen repræsentere out-of-frame DMD produkter; disse bånd blev set i NT, Ex8A, og Ex8B behandlede myoblaster. Ex6A, Ex6B, Ex8A, og cocktail-behandlede myoblaster viste i-frame produkter. Cocktail og Ex6A / B viste 100% i-ramme produkter, mens Ex8A viste kun 30% i-ramme produkter (figur 7). For at bekræfte exon skipping og restaurering aflæserammen, blev cDNA sekventering udført; Resultaterne indikerede, at exonerne 6-9 havde faktisk blevet sprunget over (figur 7). Immunhistokemi viste at AON-behandlede hunde havde øget dystrofin-positive fibre sammenlignet med NT prøver (figur 8).

In vivo forsøg

For at sammenligne effektiviteten af ​​forskellige AON behandling betingelser, CXMD hunde - blev (0,5 5 år gamle) injiceres en gang med 1,2 mg Ex6A eller en cocktail af Ex6A, Ex6B, og Ex8A ved forskellige doseringer. To uger efter injektionen blev muskel udtaget og farvet med DYS-1 til at sammenligne antallet af dystrofin-positive fibre. Alle cocktail-behandlede prøver viste øget dystrofinekspression sammenlignet med NT prøver. Dystrofin-positive fibre steg med AON dosering (figur 9). Efter systemetic injektion blev vildtype (WT), NT, og cocktail-behandlede CXMD muskelprøver farvet med DYS-1 (figur 10). Cocktail-behandlede CXMD hunde viste øget dystrofinekspression sammenlignet med NT CXMD hunde, både i CT og hjertemuskelceller prøver. Men AON-behandlede skeletmuskel (CT) viste, meget højere ekspression af dystrofin sammenlignet med behandlede hjertemusklen. En immunoblot sammenligner WT, NT, og forskellige morpholino cocktail-behandlede muskler førte til den samme konklusion. Der var også et stort udvalg af dystrofin-ekspression i de behandlede skeletmuskel prøver (figur 10). Hematoxylin og eosin (HE) -farvning afslørede, at behandlet CXMD hunde viste forbedret histopatologi, med et signifikant fald i centralt kerneholdige fibre (CNF) i sammenligning med NT CXMD hunde (Figur 11). Dette indikerer at der er mere degeneration / regeneration forekommer i NT hund, et tegn på dystrofisk muskel patologi. Derudover behandlede hunde havde hurtigerekører tider og forbedrede resultater på den kliniske karakterskala. Behandlede CXMD hunde viste bedre score end NT CXMD hunde i alle kategorier (Figur 12).

figur 1
Figur 1. Mutation Mønster af CXMD Hund og Exon 6 -. 8 Skipping strategier via en antisense Cocktail CXMD hunde har et punkt mutation i exon 6, der fører til et tab af exon 7 i dystrofisk hund mRNA. Dette resulterer i mRNA bliver ud-af-ramme og dystrophinprotein produktionen går tabt. Korte Aon sekvenser er designet til at binde til exon 6 og 8, hvilket resulterer i mRNA-splejsning effektivt springe exon 6 - 8. Den grå bjælke i Aon cocktail-behandlede hunde betegner korte Aon sekvenser. Exon 9 koder for et hængsel domæne og er undertiden spontant splejses ud med AONs mod exon 6 og 8. De resulterende mRNA koder for dystrofin proteiner, der er kortere, men funktional. Klik her for at se en større version af dette tal.

Figur 2
Figur 2. Større kliniske symptomer på en 1-årig Canine X-bundet Muskelsvindfonden (CXMD) Animal. A 1-årig vildtype beagle og en CXMD hund vises. typisk observeres Inddragelse af proksimale og legeme, og tidsmæssige muskler fra 2 måneders alderen. Fælles kontraktur og en forskydning af bækken er åbenlys fra 4 måneders alderen. Klik her for at se en større version af dette tal.

Figur 3
Figur 3. Generel anæstesi for en hund. A) Intramuscular injektioner og muskel biopsier udføres under generel anæstesi med isofluran. B) Holding af dyret for systemiske injektioner. Klik her for at se en større version af dette tal.

Figur 4
Figur 4. Magnetic Resonance Imaging (MRI) af Wild-type, ikke-behandlede CXMD, og behandlet CXMD. MRI scanninger af bagbenet på 3 måneder og 5 måneder i WT og NT CXMD hunde. To sample billeder af behandlede CXMD bagben MRIs præ- (1 uge før den første injektion) og post-injektion af AON vises. 2703MA behandledes 7x ugentligt med 200 mg / kg cocktail morpholinoer. 2001MA blev behandlet med 5x ugentlige IV injektion af 120 mg / kg cocktail morpholinoer. Kontrol og behandlede hunde var alders-matchede. Behandlede hunde viser nedsat T2 signaler. Billeder er ADAP ted med tilladelse fra Yokota et al. (copyright 2009, John Wiley & Sons) 40 Klik her for at se en større version af dette tal.

Figur 5
Figur 5. muskelbiopsi Procedure for en hund. A) En lavere lemmer fastsættes for muskel biopsi. B) Ved hjælp af pincet, er den nedre lemmer afholdt. C) CT musklen er udsat for. Åben biopsi teknik anvendes til at opnå muskel prøver af injicerede steder. Tråde bruges til at holde biopsiprøver. D) Muscle prøver på tragacanthgummi efter dissektion. Klik her for at se en større version af dette tal.

/53776/53776fig6.jpg "/>
Figur 6. Semi-tør overførselsmetode. En repræsentation af halvtørre overførselsmetode til Western blotting præsenteres. Tre papirer lægges i blød i koncentreret anode buffer er fastlagt på den negative terminal; 3 papirer gennemvædet i anodebuffer er stablet oven på dette. Den Mb PVDF papiret er gennemvædet i methanol og derefter anode buffer inden bliver lagt oven på de 6 papirer. Gelen, der er blevet dyppet i katode buffer, lægges forsigtigt over PVDF papir. Endelig er 3 papirer gennemvædet med katode puffer lagt oven på gelen. Den positive terminal er sat på toppen. For 1 time, 400 mA køres gennem systemet. Klik her for at se en større version af dette tal.

Figur 7
Figur 7. Exon Skipping i CXMD Myoblaster. et al. (Copyright 2009, John Wiley & Sons) 40. Klik her for at se en større version af dette tal.

Figur 8
Figur 8. Øget Dystrophin Expression i 2'O-methylerede Phosphorthioat (2'OMePS) transficerede CXMD Myoblaster. CXMD myoblaster blev transficeret med Ex6A alene eller med cocktail 2'OMePS. DYS-2 (rød) og DAPI (blå) farvning er vist. De behandlede myoblaster er sammenlignet med vildtype (WT) og ikke-behandlede (NT) myoblaster. Billeder er tilpasset med tilladelse fra Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 50 um. Klik her for at se en større version af dette tal.

Figur 9
Figur 9. Redning af dystrofinekspression med intramuskulære injektioner af morpholinos i CXMD Dogs. Enten Ex6A alene eller en cocktail af Ex6A, Ex6B, og Ex8A blev injiceret i CT muskler CXMD hunde. Dystrofin (DSY-1) farvning af vildtype(WT), ubehandlet (NT), og behandlet CXMD hunde er vist. Hunde blev enten behandlet med 1,2 mg Ex6A alene eller 1,2 mg cocktail. Billeder er tilpasset med tilladelse fra Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 100 um. Klik her for at se en større version af dette tal.

Figur 10
Figur 10. Forøget dystrofinekspression efter systemisk Cocktail Morpholino Behandling i CXMD Dogs. Dystrofin (DYS-1) farvning blev anvendt til at sammenligne dystrofinekspression i vildtype (WT) (positiv kontrol), ubehandlet (NT) (negativ kontrol), og CXMD hunde behandlet med 120 mg / kg morpholino cocktail (40 mg / kg af hver AON). Morpholino cocktail indeholdt Ex6A, Ex6B, og Ex8A. Hunde blev injiceret intravenøst ​​5 gange viekly med denne cocktail. A) En sammenligning af dystrofin ekspression i kraniel tibial (CT) musklerne i WT, NT, og behandlede hunde. B) En sammenligning af dystrofinekspression i hjertet væv mellem NT og morpholino cocktail-behandlede hunde. C) Immunblot for dystrofin med desmin som en loading kontrol er vist for WT, NT, og morpholino cocktail-behandlede hunde. Følgende muskler er vist for behandlede hunde: triceps brachii (TB), biceps brachii (BB), membran (DIA), spiserør (ESO), CT, adductor (ADD), extensor digitorum longus (EDL), masseter (MAS), og hjerte. Billeder er tilpasset med tilladelse fra Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 200 um. Klik her for at se en større version af dette tal.

Figur 11
Figur11. Forbedret Histopatologi i CXMD hunde behandlet i 7 uger med 240 mg / kg Morpholino Cocktail. CXMD hunde spænder fra et halvt år til fem år blev injiceret intravenøst ​​med 240 mg / kg morpholino cocktail (Ex6A, Ex6B, og Ex8A) én gang uge i 7 uger. Fjorten dage efter den sidste injektion blev spiserør muskler taget og hematoxylin og eosin (HE) farvning blev gjort. HE farvning af spiserøret muskler fra ikke-behandlede (NT) og morpholino cocktail-behandlede (behandlet) CXMD hunde (40X objektiv). Klik her for at se en større version af dette tal.

Figur 12
Figur 12. Forbedrede Scores på Klinisk Grading og 15 m Running Time Efter Morpholino behandling. Morpholino-behandlede hunde blev sammenlignet med ikke-behandlede (NT) kulds. Fejl barer i grafen angiver SEM. A) Samlet score på den kliniske sortering eksamen blev beregnet før og efter behandling, og behandlede dyr blev sammenlignet med NT søskende. B) En sammenligning af 15 m køretider af behandlede og NT hunde. C) Svarende til B; imidlertid var yngre hunde anvendt. Billeder er tilpasset med tilladelse fra Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Klik her for at se en større version af dette tal.

antisense-oligonukleotid nucleotidsekvens
Ex6A GTTGATTGTCGGACCCAGCTCAGG
Ex6B ACCTATGACTGTGGATGAGAGCGTT
Ex8A CTTCCTGGATGGCTTCAATGCTCAC

Tabel 1. antisense-oligonucleotid Design.

Discussion

Exon skipping er en lovende terapeutisk teknik til behandling af DMD. Både in vitro og in vivo forsøg har vist, at multi-exon skipping er mulig. Her er anvendelsen af ​​CXMD hundemodel diskuteret. Først blev AONs designet Brug af Rescue-ESE og ESEfinder programmer til at målrette dystrofin exon 6 - 8. 2'OMePS AON kemi blev brugt til CXMD myoblast transfektion og morpholino AON backbone kemi blev valgt til in vivo eksperimenter. vPMOs er mere effektive end umodificerede projektstyringskontorer men på grund af deres højere toksicitet, de er ikke egnede til systemiske injektioner. RNA-ekstraktion, RT-PCR, og cDNA-sekventering blev udført på de CXMD myoblaster. Hunde injiceret med PMO cocktail var klinisk gradueret til at vurdere enhver forbedring i kliniske symptomer. Efter hundene blev humant aflivet, blev muskel udtaget og forberedt til cryo-sektionering. Halveringstiden af ​​dystrophinprotein induceret af AONS menes at være ca. 1 - 2 ud måneder. Unge voksne hunde blev anvendt i denne undersøgelse, selvom der kan gøres disse forsøg med neonatale hunde og ældre hunde (> 5 år). Tilberedte muskel snit blev anvendt til at evaluere histopatologi og vurdere dystrophinprotein redning gennem Western blotting og immunhistokemi 48.

Det er vigtigt at sikre, at volumenet af PMO opløsningen er korrekt, før injektioner; ikke at gøre dette, vil få væsentlig indvirkning på resultaterne. Under intramuskulære injektioner, er tilstrækkeligt tryk, der kræves for at komme ind muskelfibrene. Overvågning af hundens sundhed og inspektion af operationsstedet er vigtige for fejlfinding. For at overvåge dyrs sundhed, bør der udføres ugentlige blodprøver og vejning. Efter euthanization af dyret og forberedelse af muskel prøver, et afgørende skridt for at sikre følsomhed i detektering dystrophinprotein er at bruge både Tris-acetat gel og halvtør blotting metodeunder Western blotting-procedure.

Som vist i de repræsentative resultater, myoblaster behandlet med Ex6A, Ex6B, Ex8A, og cocktail (indeholdende Ex6A, Ex6B, Ex8A, og Ex8B) fremstillet i ramme DMD produkter. Da Ex8B produceret ingen exon-sprunget over produkter, blev det ikke brugt i efterfølgende in vivo forsøg. cDNA-sekventering viste, at exonerne 6-9 skipping opstod og immuncytokemi med DYS-2-farvning viste restaureret dystrofinekspression i behandlede prøver. AON-behandlede hunde udviste en signifikant stigning i dystrofin-positive fibre. Dette indikerer, at exonerne 6 - 8 blev blive sprunget over og et afkortet protein blev produceret. Mængden af ​​dystrofin-positive fibre øges, når anvendtes en cocktail af AONs og var proportional med AON dosering. Immunoblots viste øget dystrofinekspression i systemiske morpholino-behandlede hunde. Skeletal muscle havde variable niveauer af dystrofin fibre; imidlertid viste lidt morpholino-behandlede hjertevævforbedring i dystrofinekspression. Da dystrofin har en høj molekylvægt (427 kDa), kan påvisning af små mængder dystrofin være vanskelig. For de bedste resultater, blev Tris-acetat-gel og halvtørre overførselsmetode anvendes. HE farvning viste forbedret histopatologi i morpholino-behandlede hunde. Centralt-kerneholdige fibre (CNFs) er et tegn på usund muskler og repræsenterer cykler af muskel degeneration og regeneration. Morpholino-behandlede CXMD hunde viste et fald i procentdelen af ​​CNFs i sammenligning med ikke-behandlede CXMD hunde. Klinisk grading afslørede en forbedring af symptomer, såsom øget gang og løb evne, i morpholino-behandlede dyr. Hårdheden af muskler menes at afspejle muskelatrofi, blev således indgår i vurderingen skema 59. Hårdheden af ​​låret (hind-lemmer) muskler blev evalueret; Men vi udelukkede craniale Sartorius muskler fordi de har tendens til at udvise hypertrofi stedet atrofi i CXMD. Behandlede hunde visered lavere klassificering scoringer og havde hurtigere tider på 15 m kører test. Forbedrede gange på 15 m testen indikerer forbedret muskelfunktion 40. Højere samlet klassificering score indikerer dårligt helbred og øget muskel atrofi.

Mens disse resultater er lovende, multi-exon skipping præsenterer stadig mange udfordringer, der skal overvindes, før teknikken har klinisk anvendelighed. Cardiac væv viser stadig reduceret optagelse af AONs, sandsynligvis på grund af forskellen i cellulær handel mellem hjerte- og knoglevæv. Ingen toksiske virkninger er blevet observeret hos dyr under de nuværende doseringsregimer; dog brug for mere arbejde, der skal gøres for at vurdere langtidstoksicitet før brugen af ​​AON cocktails kan flytte til kliniske forsøg. Det er svært at få godkendelse til AON cocktail narkotika, fordi reguleringsorganer definere hver AON sekvens som et unikt lægemiddel. Dette betyder, at hver sekvens i en cocktail skulle være individuelt testet for safety, hvilket kræver mere tid og flere penge. En anden hindring for anvendelsen af ​​multi-exon skipping i et klinisk miljø er en stor mængde mellemprodukter proteinprodukter fremstillet med ukendte funktioner. Disse proteiner kan potentielt føre til uforudsigelige bivirkninger, afhængigt af den enkelte mutation 22. Derudover mutation mønstre tilgængelige inden for de nuværende dystrofiske hund modeller er begrænset. Der er få naturligt forekommende mutationer, og ikke alle mutationer er nyttige til at studere multi-exon skipping. Den dystrofisk grisemodel lover at være et godt alternativ for fremtiden DMD exon skipping studier 33, 34.

DMD hund modeller har nogle fordele frem for andre DMD modeller. At være en større dyremodel, klinisk sortering og MR er mulige, giver mulighed for en mere detaljeret analyse. Da hunde er store dyr er de også mere egnet til toksikologiske undersøgelser og tættere repræsenterer den humane sygdom i forhold til musemodel. Hund models har også DMD gensekvenser, der er mere ligner mennesker 23, 34, 45.

Selvom teknisk udfordrende, kunne multi-exon skipping tilgang i sidste ende gavne> 90% af DMD patienter 24. Dette gør det en langt bedre alternativ til single-exon skipping, som single-exon skipping gælder kun en lille delmængde af patienterne. Desuden vil flere exon springe muligt for os at vælge de sletning mønstre, der optimerer funktionaliteten af ​​de forkortede dystrofin proteiner. For eksempel, sletning af DMD exon 45-55 er forbundet med usædvanligt milde symptomer eller asymptomatisk individer 14,19,60-63. Den multi-exon skipping af exon 45 - 55 er allerede blevet påvist i en musemodel for DMD med en exon 52 deletion (mdx52) under anvendelse af systemiske injektioner af vPMOs 22,26. Anvendelsen af ​​cocktail vPMOs er også blevet påvist i andre former for muskeldystrofi, såsomsom Fukuyama medfødt muskelsvind (FCMD). FCMD skyldes exonindfangning, hvori aberrerende mRNA splejsning er forårsaget af retrotransposon insertion. vPMOs er blevet vist at redde splejsningsmønster i både en FCMD musemodel og i humane cellelinier 64. Næste generation AON kemier udviser højere effektivitet og lavere toksicitet ville lette en effektiv oversættelse af multi-exon skipping tilgang til klinisk anvendelse. Derudover kunne multi-exon skipping potentielt anvendes på andre genetiske sygdomme, såsom dysferlinopathies 24, 65.

Materials

Name Company Catalog Number Comments
2'OMePS Transfection of Dog Myoblasts 
3 ml 6-well plates IWAKI 5816-006
Dulbecco’s modified Eagle’s medium (DMEM)  Gibco 11965-092
Fetal bovine serum (FBS)  HyClone SH30071.01
Penicillin  Sigma-Aldrich  P4333  200 U/ml 
Lipofectin  Invitrogen  18292-011 Total volume of 100 ml in opti-MEM media at a ratio of 2:1 for lipofectin. 
10 ml lipofectin for 5 mg RNA. 
2’OMePS Eurogentec  Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC). 
Horse Serum  Gibco 16050-114 2%
streptomycin  Sigma-Aldrich P4333  200 μg/ml
Bovine serum albumin (BSA)  Sigma-Aldrich A9418 
Insulin
Morpholino transfection of dog myoblasts
All material from MePS Transfection of Dog Myoblasts for culturing
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
Endo-Porter Gene-tools
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
Chloroform Sigma-Aldrich P3803 200 μl 
1.5 ml Tubes  Eppendorf 22363204
Centrifuge  Beckman-Coulter
75% Ethanol  Sigma-Aldrich 34852
UV Spectrometer 
Forward primer in exon 5  Invitrogen CTGACTCTTGGTTTGATTTGGA                          
1.5 μl 10 μM
Reverse primer in exon 10  Invitrogen TGCTTCGGTCTCTGTCAATG                            
1.5 μl 10 μM
dNTPs Clontech 3040
One-Step RT-PCR kit  Qiagen  210210
Thermo-cycler Scinco
Complementary DNA (cDNA) Sequencing 
Gel extraction kit  Qiagen  28704
Centrifuge 
Terminator v3.1 Cycle Sequencing Kit  Applied Biosystems  4337454
Intramuscular injections or open muscle biopsy
Surgical Tools Scissors, scalpel, needle, surgical thread 
Vet Ointment 
Iodophors  webtextiles 12190-71-5
chlorohexidine Peridex 12134
Surgical Drapes 
Scrubs
Facial Mask 
Surgical Gloves 
Head Covering 
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
27 G Needles TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225
buprenorphine hydrochloride
Tongue Depressor 
cephalexin 15 to 30 mg/kg 
cefazolin 15 to 30 mg/kg 
buprenorphine  0.01 mg/kg
buprenorphine hydrochloride  0.02 mg/kg
Systemic Injections
Syringe infusion pump  Muromachi 
22 G Indwelling needles TERUMO SG3-2225 
27 G Needles  TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225 
Saline Ohtsuka-Pharmaceutical 28372
Clinical Grading of Dogs
Video Camera 
Stop watch 
Magnetic resonance imaging (MRI) 
3 Tesla MRI l 
18 cm diameter/18 cm length human extremity coil
Muscle sampling and preparation (necropsy)
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Tragacanth gum 10-20 ml
Liquid Nitrogen 
Cork Discs Iwai-kagaku  101412-806
Dry Ice
Tweezers
Poly-L-lysine–coated slides Fisher 22-037-216
Cryostat Microsystem  Leica  cm1900 
Immunohistochemistry 
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
DYS2 Novocastra  NCL-DYS2  1:150 dilutions
Alexa 594 goat antimouse IgG1  Invitrogen A-21125 1:2,500 dilutions
Alexa 594 goat antimouse IgG2  Invitrogen A-11005 1:2,500 dilutions
DAPI  Invitrogen D1306 Contains mounting agent
Goat Serum  Invitrogen 10000C 15%
PBS
Moisture chamber  Scientific Devise Laboratory  197-BL
Chamber slide  Lab-tek  154453
Cover Glasses  Fisher 12-540A
Hydrophobic barrier pen 
Fluorescent microscope  594 nm at 20X magnification. 
Western Blotting 
Distillied Water 
Hand Homogenizer 
2× Laemmli SDS-loading buffer  0.1 M Tris–HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue 
SDS gels  Bio-Rad  161-1210 5% resolving
SDS gels Invitrogen  Invitrogen, WG1601BOX 3-8%
PVDF membrane  GE 10600021
Methanol
Running buffer (10×)  250 mM of Tris-Base, 1,920 mM of Glycine
Running buffer (1×) 10% 10× buffer, 20% methanol 
0.05% PBS/Tween 20 (PBST)  2,000 ml              
3× 200 ml for washing
PBST/5% milk powder  100 ml
Protein Assay Kit BCA T9650
Tween 20  Sigma  P5927
Urea Sigma  U5378
Beta Mercaptoethanol  Millipore ES-007-E
SDS Sigma L3771
Tris-Acetate Sigma
Tris HCl Sigma T3253
Glycerol Sigma G8773
Loading/sample buffer for Western blotting NuPage Invitrogen NP007
NaCl Sigma S3014
PMSF Sigma P7626
Protease cocktail inhibitor  Roche 11836153001
Cathode Buffer 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer 0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer 0.3 M Tris base + 20% Methanol
desmin antibody  Abcam ab8592
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
ImageJ Software

DOWNLOAD MATERIALS LIST

References

  1. Duchenne, A. The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J. 14, (2), 541-542 (1867).
  2. Zellweger, H., Antonik, A. Newborn screening for Duchenne muscular dystrophy. Pediatrics. 55, (1), 30-34 (1975).
  3. Echigoya, Y., Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 24, 57-68 (2014).
  4. Bushby, R. F., Birnkrant, D. J., et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology. 9, (1), 77-93 (2010).
  5. Eagle, M., Baudouin, S. V., Chandler, C., Giddings, D. R., Bullock, R., Bushby, K. Survival in Duchenne muscular dystrophy: improvements in life expectancy since 1967 and the impact of home nocturnal ventilation. Neuromuscul. Disord. 12, (10), 926-929 (2002).
  6. Heald, A., Anderson, L. V., Bushby, K. M., Shaw, P. J. Becker muscular dystrophy with onset after 60 years. Neurology. 44, (12), 2388-2390 (1994).
  7. Stöllberger, C., Finsterer, J. Worsening of heart failure in Becker muscular dystrophy after non-steroidal anti-inflammatory drugs. Med. J. 98, (4), 478-480 (2005).
  8. Passamano, L., et al. Improvement of survival in Duchenne Muscular Dystrophy: retrospective analysis of 835 patients. Acta Myol. 31, (2), 121-125 (2012).
  9. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, (6), 919-928 (1987).
  10. Koenig, M., et al. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50, (3), 509-517 (1987).
  11. Takeshima, Y., et al. Mutation spectrum of the dystrophin gene in 442 Duchenne/Becker muscular dystrophy cases from one Japanese referral. JHG. 55, (6), 379-388 (2010).
  12. White, S. J., et al. Duplications in the DMD gene. Hum. Mutat. 27, 938-945 (2006).
  13. Yokota, T., Duddy, W., Echigoya, Y., Kolski, H. Exon skipping for nonsense mutations in Duchenne muscular dystrophy: too many mutations, too few patients. Expert Opin. Biol. Ther. 12, (9), 1141-1152 (2012).
  14. Yokota, T., Duddy, W., Partridge, T. Optimizing exon skipping therapies for DMD. Acta Myol. 26, (3), 179-184 (2007).
  15. Magri, F., et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol. 258, (9), 1610-1623 (2011).
  16. Yoshida, H. H., Ishikawa-Sakurai, M. Biochemical evidence for association of dystrobrevin with the sarcoglycan- sarcospan complex as a basis for understanding sarcogly- canopathy. Hum. Mol. Genet. 9, (7), 1033-1040 (2000).
  17. Bies, R. D., Caskey, C. T., Fenwick, R. An intact cysteine-rich domain is required for dystrophin function. J. Clin. Invest. 90, (2), 666-672 (1992).
  18. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2, (1), 90-95 (1988).
  19. Aoki, Y., Yokota, T., Wood, M. J. Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int. 2013, (402369), (2013).
  20. Cirak, V. A. -G., Guglieri, M., et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. The Lancet. 378, (9791), 595-605 (2011).
  21. Goemans, N. M., et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 364, (16), 1513-1522 (2011).
  22. Echigoya, Y., et al. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol Ther Nucleic Acids. 4, (2015).
  23. Hoffman, E. P., et al. Restoring dystrophin expression in Duchenne muscular dystrophy muscle progress in exon skipping and stop codon read through. Am J Pathol. 179, (1), 12-22 (2011).
  24. Aartsma-Rus, A., et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 74, (1), 83-92 (2004).
  25. Aartsma-Rus, A., Kaman, W. E., Weij, R., Tden Dunnen, J., van Ommen, G. J., van Deutekom, J. C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol. Ther. 14, (3), 401-407 (2006).
  26. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109, (34), 13763-13768 (2012).
  27. McClorey, G., Iversen, P. L., Moulton , H. M., Fletcher, S., Wilton, S. D. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13, (19), 1373-1381 (2006).
  28. Sharp, N. J., et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 13, (1), 115-121 (1992).
  29. Shimatsu, Y., et al. Canine X-linked muscular dystrophy in Japan (CXMDJ). Exp Anim. 52, (2), 93-97 (2003).
  30. Nguyen, F., Cherel, Y., Guigand, L., Goubault Leroux, I., Wyers, M. Muscle lesions associated with dystrophin deficiency in neonatal golden retriever puppies. J Comp Pathol. 126, (2-3), 100-108 (2002).
  31. Nakamura, A., Takeda, S. Mammalian models of Duchenne Muscular Dystrophy: pathological characteristics and therapeutic applications. J Biomed Biotechnol. 2011, (184393), (2011).
  32. Yokota, T., et al. A renaissance for anti-sense oligonucleotide drugs in neurology: Exon-skipping breaks new ground. Arch. Neurol. 66, 32-38 (2009).
  33. Aartsma-Rus, A., et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 30, (3), 293-299 (2009).
  34. Yu, X., Bao, B., Echigoya, Y., Yokota, T. Dystrophin-deficient large animal models: translational research and exon skipping. Am. J. Transl. Res. 7, (8), 1214-1231 (2015).
  35. Yin, H., Moulton, H., Betts, C., Wood, M. CPP-directed oligonucleotide exon skipping in animal models of Duchenne muscular dystrophy. Methods Mol Biol. 683, 321-338 (2011).
  36. Moulton, H. M., Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta. 1798, (12), 2296-2303 (2010).
  37. Morcos, P. A., Li, Y., Jiang, S. Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques. 45, (6), 613-614 (2008).
  38. Betts, C., et al. A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Mol Ther Nucleic Acids. 14, (1), e38 (2012).
  39. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5, (8), e12239 (2010).
  40. Yokota, T., et al. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol. 65, (6), 667-676 (2009).
  41. Melacini, P., et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromuscul. Disord. 6, (5), 367-376 (1996).
  42. Guncay, A., Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have we come and what does the future hold. Future Med. Chem. 7, (13), 1631-1635 (2015).
  43. Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Research Council (US) Committee on Pain and Distress in Laboratory Animals. Distress in Laboratory Animals . National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK32658 (1992).
  44. Guide for the Care and Use of Laboratory AnimalsPhysical Restraint. National Research Council (US) Institute for Laboratory Animal Research. National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050 (1996).
  45. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science. 297, 1007-1013 (2002).
  46. Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).
  47. Fairbrother, W. I. 11, Goldstein, P. RESCUE-ESE Web Server. MIT Burge Lab. Available from: http://genes.mit.edu/burgelab/rescue-ese/ (2016).
  48. Yokota, T., Hoffman, E., Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 709, 299-312 (2011).
  49. Jenuth, J. P. The NCBI. Publicly available tools and resources on the Web. Methods Mol Biol. 132, 301-312 (2000).
  50. Yokota, T., et al. Extensive and Prolonged Restoration of Dystrophin Expression with Vivo-Morpholino-Mediated Multiple Exon Skipping in Dystrophic Dogs. Nucleic Acid Ther. (2012).
  51. Summerton, J. E. Endo-Porter: a novel reagent for safe, effective delivery of substances into cells. Ann. N. Y. Acad. Sci. 1058, 62-75 (2005).
  52. Mangram, A. J., et al. Guideline for Prevention of Surgical Site Infection. Am J Infect Control. 27, 97-134 (1999).
  53. Reichman, D. E., Greenberg, J. A. Reducing Surgical Site Infections. A Review . Rev Obstet Gynecol. 2, 212-221 (2009).
  54. Mizuno, H., Nakamura, A., Aoki, Y., Ito, N., Kishi, S., Yamamoto, K., Sekiguchi, M., Takeda, S., Hashido, K. Identification of muscle-specific microRNAs in serum of muscular dystrophy animal models: promising novel blood-based markers for muscular dystrophy. PloS one. 6, (2011).
  55. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 145-154 (2005).
  56. Evans, H., de Lahunta, A. Guide to the Dissection of the Dog. SAUNDERS. (2009).
  57. Girish, V., Vijayalakshmi, A. Affordable image analysis using NIH Image/ImageJ. Indian J Cancer. 41, (47), (2004).
  58. Bearer, E. L., et al. Overview of image analysis, image importing, and image processing using freeware. Current protocols in molecular biology. 14, (2003).
  59. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 24, 145-1454 (2005).
  60. Beroud, C., et al. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 28, 196-202 (2007).
  61. Ferreiro, V., et al. Asymptomatic Becker muscular dystrophy in a family with a multiexon deletion. Muscle Nerve. 39, 239-243 (2009).
  62. Nakamura, A., et al. Follow-up of three patients with a large in-frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci. 15, 757-763 (2008).
  63. Yokota, T., Pistilli, E., Duddy, W., Nagaraju, K. Potential of oligonucleotide-mediated exon-skipping therapy for Duchenne muscular dystrophy. Expert Opin Biol Ther. 7, 831-842 (2007).
  64. Taniguchi-Ikeda, M., et al. Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy. Nature. 478, 127-131 (2011).
  65. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3, 144-176 (2013).
Multi-exon Skipping Brug Cocktail antisenseoligonukleotider i Canine X-bundet Muskelsvindfonden
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).More

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter