Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Multi-אקסון דילוג שימוש אנטיסנס קוקטייל של ניוון השרירים הצמוד X לכלבים

doi: 10.3791/53776 Published: May 24, 2016
* These authors contributed equally

Summary

דילוג על אקסונים הוא כרגע אופציה טיפולית מבטיחה ביותר בניוון שרירים דושן (DMD). כדי להרחיב את תחולת לחולים DMD וכדי לייעל את יציבות / פונקציה של חלבונים בדיסטרופין מקוצץ וכתוצאה מכך, גישה-אקסון רב דילוג באמצעות מולקולות אנטיסנס קוקטייל פותחה הראינו הצלה בדיסטרופין מערכתית במודל הכלב.

Abstract

ניוון שרירים דושנו (DMD) הוא אחת המחלות הגנטיות הקטלנות הנפוצות ביותר בעולם, נגרמים על ידי מוטציות בגן בדיסטרופין (DMD). דילוג על אקסונים מעסיק דנ"א קצר / מולקולות דמויות RNA שנקראים מולקולות אנטיסנס (AONs) כי לשחזר את מסגרת הקריאה ולייצר חלבונים קצרים אך פונקציונליים. עם זאת, טיפול דילוג אקסון ניצבת בפני שני מכשולים עיקריים: תחולה מוגבלת (עד רק 13% מהחולים יכול להיות מטופלים עם תרופה אחת AON), ותפקוד ודאית של חלבונים קטועים. טופלו נושאים אלו עם גישה AON קוקטייל. בעוד כ 70% מחולי DMD יכולים להיות מטופלים על ידי דילוג אקסון בודד (כל אקסונים המשולבים), אפשר לטפל פוטנציאל ליותר מ -90% מחולי DMD אם אקסון המרובה דילוג באמצעות תרופות antisense קוקטייל יכול להתממש. הכלב X-linked ניוון שרירים מודל כלב (CXMD), פנוטיפ אשר דומה יותר בחולים אנושיים DMD, שימש כדי לבדוק את effic מערכתיתחרדה ובטיחות של דילוג רב אקסון של אקסונים 6 ו -8 מודל הכלב CXMD נמלי מוטצית אתר שחבור ב אינטרון 6, מוביל חוסר אקסון 7 ב mRNA בדיסטרופין. כדי לשחזר את מסגרת הקריאה CXMD דורש דילוג אקסון-רב של אקסונים 6 ו -8; ולכן, CXMD הוא מודל חיה בגודל בינוני טוב לבדיקת היעילות והבטיחות של דילוג רב אקסון. במחקר הנוכחי, קוקטייל של morpholinos antisense מיקוד אקסון 6 ו אקסון 8 תוכנן וזה החזיר ביטוי בדיסטרופין בשרירי שלד-רחב גוף. שיטות transfection / הזרקה של oligos קוקטייל והערכה של היעילות והבטיחות של דילוג רב אקסון במודל כלב CXMD מוצגים.

Introduction

ניוון שרירים דושן (DMD) היא מחלה שרירים רצסיבי צמודי X שמתאפיין בחולשת שרירים מתקדמת, תוארה לראשונה על ידי ד"ר גיום-בנימין-אמאנד דושן (בולון) 1. DMD היא מחלה גנטית נפוצה המשפיעה על 1 ב -3,500 נערים ברחבי העולם, עם כ -20,000 ילדים מושפעים הנולדים בכל שנה 2,3. התפתחות מוטורית מתעכבת והפרעות בהליכה נראות בתחילת ילדות 4, ואחריו תלות גלגלים בערך העשרה המוקדמים. המוות מתרחש בדרך כלל בין הגילאים 20 ו -30 בשל כשל נשימתי או לבבי 5-8. אין כרגע תרופה DMD. טיפול עם גלוקוקורטיקואידים יכול להאט את התקדמות ניוון שרירים מסוים אך קשור לתופעות לוואי משמעותיות, כגון: השמנת יתר וסוכרת 2,7,8. DMD הנובעת מוטציות בגן בדיסטרופין (DMD), שמוביל לאובדן של protei בדיסטרופין פונקציונליn. DMD הוא גן גדול מאוד עם יותר מ -2 מיליון זוגות בסיסים ו -79 אקסונים 9,10. מחיקה, שטויות, ומוטציות שכפולות המוביל מוטציות מחוץ למסגרת הן הסיבה השכיחה ביותר של פנוטיפ DMD. האזורים של אקסונים 3 - 9 וגם אקסונים 45 - 55 מכונים "נקודות חמות מוטציה" כמו שיש רוב החולים מוטציות מחיקות בתוך חלקים אלה של הגן, מה שמוביל בדיסטרופין שאינו פונקציונלי בחולי DMD 3,9,11-16. בדיסטרופין פונקציות במתחם גליקופרוטאין-בדיסטרופין (DGC), אשר יש תפקיד מרכזי בייצוב קרום השריר. N- ו- C-Termini הם התחומים החשובים ביותר לתפקוד, בעוד תחום המוט המרכזי ממלא 3,9,17 תפקיד חשוב פחות. השמירה על פנוטיפ קל הקשורים בניוון שרירי בקר (BMD), שתוצאתה בעיקר מוטציות בתוך המסגרת בתוך גן DMD, בהשראת היישום של אקסון דילוג לטיפול DMD. חולי BMD שיהיו לך מקוצר, אבל functional, חלבון בדיסטרופין מקיים הוא טרמיני 3,6,18. אקסון מדלג, בתאוריה, ניתן לשחזר את מסגרת הקריאה, וכתוצאה מכך חלבונים בדיסטרופין מקוצרים-אבל-תפקודיים דומים לזו של BMD 3,19.

סוגים שונים של מולקולות אנטיסנס (AONs) נבדקו במחקרים קליניים, כולל phosphorothioates-מפוגל 2'O (2'OMePS) ו oligomers morpholino phosphorodiamidate (PMOS). אקסונים דילוג 51 ו -53 באמצעות AONs אלה נבדקים תוך ותוצאות מבטיחות, דילוג חד אקסון יש תחולה מוגבלת, כפי שהוא מוטציה ספציפית 3, 19, 20,21, 22-26. שאלות גם להישאר על היציבות של חלבונים בדיסטרופין מקוצר וכתוצאה המופק-אקסון בודד דילוג 22,23. בנוסף, חולים מסוימים דורשים יותר מאשר אקסון בודד שברצונכם לדלג עליו כדי להחזיר את מסגרת הקריאה 3. למרות שמבחינה טכנית קשה יותר, מדלגים-אקסון רב היא אחת השיטות כייכול לטפל בבעיות אלה 3,19. דילוג רב-אקסון הודגם בעבר כלב דיסטרופי ואת שורות תאים אנושיות במבחנה. בנוסף, ניוון שרירים צמוד X העכבר כלבי mdx52 (CXMD) מודלי כלב שמשו במשך במחקרים vivo 22, 24-27. X-linked כלבים ניוון שרירים יפן (CXMD J) כלבי ציד שימשו כאן, כמו את מסגרת הקריאה של CXMD J ניתן לשחזר על ידי דילוג רב אקסון של אקסונים 6 ו -8, או אקסונים נוספים (למשל, אקסונים 3 - 9) (איור 1). ביגל המבוסס CXMD חולקת אותו דפוס המוטציה כמו ניוון שרירי גולדן רטריבר (GRMD) המודל, אבל כלבי ציד קטנים וזולים יותר כדי לשמור על עקב גודל גופם, ובכך לספק מודל שימושי DMD 28,29. כלבי CXMD לחקות באופן הדוק יותר את הפנוטיפ DMD האנושי מאשר במודלים של בעלי חיים קטנים, כמו מכרסמים, והם אמינים יותר להערכות טוקסיקולוגית 3,22,30,31 (איור 2). כלבי CXMD להציג ריקבון שרירים מתקדם, הפרעות בהליכה, ובעיות לב ונשימה דומה לאלה שראו DMD. לעומת דילוג חד אקסון, מדלגים-אקסון רב ישימים חלק הרבה יותר גדולה של חולים. בין שלושת סוגי המוטציה הנפוצה ביותר (מחיקות, שטויות, כפילויות), 80 - 98% מהחולים יכולים להיות מטופלים באמצעות רב אקסון דילוג 14,32,33, בעוד 45% מכלל חולי DMD יכול להפיק תועלת אקסונים דילוג במיוחד 45 - 55 3,19,22,34.

עם התפתחותה של morpholinos השונה, את היעילות של קוקטיילי AON להקל דילוג אקסון השתפרה. ארגינין עשיר PMOS פפטיד מצומדות חודר תאים (PPMOs), ו vivo-morpholinos (vPMOs) הם כימיות AON ששיפרו משמעותית חודר תאים היכולת ויציבות 3,35-38. חששות להישאר על רעילות ארוכי טווח AON; עם זאת, התקדמות משמעותיתנעשה. שינויים כימיים שבוצעו morpholinos להקטין באופן משמעותי השפעות חוץ-היעד של סקרי טרום קליניים דיווחו ללא תופעות רעילות משמעותית 3,22,39,40. אתגר הנותרים עבור דילוג רב אקסון היא הדרישה הנוכחית עבור כל אחת AON להיבדק לרעילות לבד, כתרופה יחידה, במקום יחד כמו קוקטייל 3,19,22,41,42. במחקרי DMD המעורבים הוא-אקסון רב יחיד מדלגים ממוקדת בלב, חל שיפור קטן ברקמת לב דיסטרופי. יעילותה של morpholinos בלב הוא חשב להיות נמוך בגלל היכולת החודרת-תא עני. פפטיד מצומדות PPMOs שיפרו את היכולת של AONs לחדור תאי לב, הגדלת כמות החלבון בדיסטרופין פונקציונלי הצילה בלב 3,19,38.

הנה, גישת קוקטייל AON שלנו נדונה בהרחבה, לרבות עיצוב רצפי AON באמצעות ESEfinder תוכנה 43. ProtocOLS עבור ניסויים בכלבים עם דילוג רב אקסון מתואר גם. CXMD J כלבי ציד שימשו אקסונים 6 ו -8 ניסויים מדלגים. Multi-אקסון דילוג במודל כלב CXMD מראה תוצאות מבטיחות, אך אתגרים להישאר להיות להתגבר שהצורך לפני שהם קליניים ישימים.

Protocol

כל הפרוטוקולים המפורטים להלן הנם בהתאם להנחיות הטיפול בבעלי החיים שנקבעו על ידי המרכז הלאומי לנוירולוגיה ופסיכיאטריה (NCNP) ביפן. כל הניסויים אושרו על ידי ועדת הטיפול בבעלי החיים המוסדיים שימוש NCNP.

עיצוב 1. אנטיסנס oligos

  1. השתמש ESE הצלה ותוכניות ESEfinder כדי לזהות אתרים ESE 44, 45-47.
  2. זוג בסיס עיצוב 25 (נ"ב) רצפים כי הם antisense כדי אקסונים כי הם להיות ממוקדים. אקסונים יעד 6 ו -8 במודל הכלב (איור 1).
    1. השתמש 25 - 30 רצפים נ"ב עבור PMOS (טבלה 1) או 25 נ"ב עבור 2'OMePS. כדי לעצב 25 רצפים נ"ב, בחר רצפים נמצאים באזור היעד. שקול מבנה משני, הימנעות heterodimers, מוטיבים משפרים שחבור אקסון, ותוכן GC ליצור 43 רצפים יציבים. AONs צריך למקד לפחות באחד מאתרי ESE כפי שהוגדרו על ידי sof הנ"לtware.
    2. AONs בחר עם תוכן GC כי הוא פחות מ -65%, עם פחות מ -4 ברציפות 'G של, ואינם מכילים רצפי עצמית משלימים. השתמש בתוכנת פיצוץ צמח שדה לחזות אתרי חישול מחוץ יעד 22,48,49.
  3. בחר כימית עמוד שדרת AON מתאימה. בניסויים במבחנה להשתמש oligonucleotides 2'O-מתיל (2'OMePS) או morpholinos. בניסויים in vivo, השתמש 2'OMePS, morpholinos או vPMOs. 3,19,48,50

2. בניסויים במבחנה (אקסונים 6 ו -8 דילוג במודל CXMD)

  1. 2'OMePS Transfection של כלב myoblasts
    1. myoblasts תרבות CXMD ב 3 מ"ל של מדיום הגידול 6 צלחות היטב. זרע 1 - 5 x 10 תאים 3/2 ס"מ עם 0.5 מ"ל / 2 ס"מ של המדיום עבור myoblasts. עבור מדיום הגידול, להשתמש במדיום של הנשר השונה של Dulbecco (DMEM) עם 10% בסרום שור עוברי (FBS) ו -1%פניצילין / סטרפטומיצין (P / S) 40.
    2. לדגור על 37 מעלות צלזיוס עד 60 - ומחוברות 80%. זה לוקח בערך 12 עד 24 שעות.
    3. לדלל סוכן Transfecting ליפוזום קטיוני לסך של 100 μl במדיום סרום מופחת (2: סוכן 1 יחס Transfecting: AONs, למשל, 10 μl lipofectin לעומת 5 מיקרוגרם AONs). אפשר לתערובת לעמוד ב RT במשך 30 - 45 דקות.
    4. לדלל AONs (2'OMePS או morpholinos) לנפח סופי של 100 μl במדיום סרום מופחת.
    5. מערבבים את סוכן transfecting מדולל AONs בדילול לדגור על RT במשך 10 - 15 דקות.
    6. בעוד סוכן transfection / תערובת AON יושבת ב RT, להסיר תקשורת ישנה מתאיים באמצעות שאיפה ולשטוף תאים עם התקשורת.
    7. להוסיף 0.8 מיליליטר תקשורת לסוכן transfection / תערובת AON ולאחר מכן להוסיף את הפתרון כולו התאים הטריים השטופים. דגירה של 3 שעות ב 37 מעלות צלזיוס.
    8. לאחר דוגרים, להחליף התקשורת עם differentiatתקשורת יון (DM); בידול יכול להימשך עד 10 ימים. בדוק אם בידול התרחשה החל בסביבות יום 3. התקשורת בידול הוא DMEM עם סרום סוס 2%, 200 פניצילין U / ml, 200 מ"ג / מ"ל ​​סטרפטומיצין, ו -10 מיקרוגרם / מ"ל ​​אינסולין.
  2. Morpholino Transfection של כלב myoblasts
    1. תרבות CXMD myoblasts במדיום הגידול כמתואר בשלב 2.1.
    2. Switch to בינוני בידול (DM), ולהוסיף 0.1 morpholino המניות מ"מ היטב כל כדי להפוך את הריכוז הסופי 1 מיקרומטר. morpholinos הקוקטייל מחמם על 65 מעלות צלזיוס למשך 10 דקות לפני transfection או הזרקה כדי למנוע צבירת AON. הוסף מגיב משלוח פפטיד 39,51 ולהתאים לריכוז סופי של 3 - מיקרומטר 6.
    3. אחרי 16 - 48 שעות של דגירה, לאסוף תאים להפקת RNA. הוסף 1 מ"ל חומצה guanidinium thiocyanate-פנול, כלורופורם לתאים לנתק תאים מהצלחת. בצע RNA extraction לאחר שלב זה.
      1. לחלופין, להוסיף טריפסין כך שהוא מכסה את כל תאי דגירה במשך 2 דקות על 37 מעלות צלזיוס.
        הערה: אם מתוך כוונה לבצע immunochemistry, להרכיב משקפי שקופיות תאיים עבור culturing. לאחר התמיינות, התאים ניתן לתקן באמצעות paraformaldehyde (PFA) (4% למשך 10 דקות).
  3. הפקת רנ"א תגובת שרשרת פולימראז הפוך תמלול (RT-PCR)
    1. לאחר התאים הם מובחנים לתוך myotubes, להסיר בינוני ולהוסיף 1 מ"ל חומצה guanidinium thiocyanate-פנול, כלורופורם; דגירה של 10 דקות ב RT.
    2. העברת צינורות 1.5 מיליליטר. מערבבים עם 200 μl כלורופורם לדגור על RT במשך 2 דקות עד שלוש שכבות נפרדות שניתן לראות. השלוש השכבות מלמעלה למטה הן: שכבת RNA, שכבת DNA, ושכבת חלבון.
    3. צנטריפוגה ב g 12,000 × במשך 15 דקות ב 4 ° C.. הסר את supernatant השכבה העליונה ומכניסים צינור עם 500 & #181; l isopropanol (אם לעצור כאן, לאחסן את supernatant ב -80 ° C). צנטריפוגה supernatant ב g 12,000 × במשך 10 דקות ב 4 מעלות צלזיוס; לאחר צנטריפוגה, לשמור על גלולה RNA וכתוצאה וזורקים supernatant.
    4. שטפו את הכדור עם אתנול ו צנטריפוגות ב 8000 XG במשך 5 דקות ב 4 ° C. להתאדות אתנול שיורית על ידי צינור היפוך במשך 15 דקות ולאחר מכן להוסיף -15 - 30 μl של RNase ללא מים. לכמת ריכוז RNA סך באמצעות ספקטרוסקופיית ארה"ב / VIS ב 260 ננומטר.
    5. מערבבים את ריאגנטים הנדרשים לצורך קבלת התגובה RT-PCR: 1.5 μl 10 פריימר מיקרומטר קדימה, 1.5 μl 10 מיקרומטר פריימר הפוכה, 1 μl dNTP, 5 μl חיץ ערכת צעד אחד PCR, 0.7 μl מעכב RNase, 1 μl תערובת האנזים מן חד צעד ערכת PCR, ו -200 ננוגרם של רנ"א. פעם אלה היו מעורבים, מוסיפים מים עד נפח סופי של 25 μl.
    6. מניח תערובת Cycler-תרם. הפעל מחזור 30 דקות ב 50 מעלות צלזיוס, 15 דקות0; מחזור ב 95 מעלות צלזיוס, אז 35 מחזורים של 94 מעלות צלזיוס במשך 1 דקות, 60 מעלות צלזיוס במשך 1 דקות, ו -72 מעלות צלזיוס במשך 1 דקות. לבסוף, להפעיל מחזור 10 דקות ב 72 מעלות צלזיוס. מוצר בחנות PCR במקרר ב 4 מעלות צלזיוס או -20 ° C
  4. DNA משלים (cDNA) רצף
    1. זהה אקסון 6 - 9-דילוג על להקות באמצעות ג'ל אלקטרופורזה agarose. טען 5 μl של כל דגימה לתוך הבארות של ג'ל agarose 1.5%, לרוץ 135 V דרך ג'ל למשך 5 דקות, ולאחר מכן 120 V עבור 20 דקות. לאחר מכן, דגירה ג'ל הכתם ג'ל DNA ב RT במשך 30 דקות. דמיינו את הלהקות באמצעות תוכנת הדמיה.
    2. ובלו הלהקה של עניין באמצעות ערכת ג'ל חילוץ.
      1. והבלו שבר דנ"א solubilize הפרוסה ג'ל באמצעות ג'ל 200 μl NTI / 100 מ"ג. תן זה לשבת במשך 5 עד 10 דקות באמבט מים C ° 50. ואז להעביר סיליקה צינור הממברנה.
      2. צנטריפוגה ב 11,000 XG במשך 30 שניות. שטפו פעמיים עם 700 חיץ NT3 μl לפני centrifuging שוב 11,000 XG במשך 30 שניות.
      3. לייבש את הממברנה סיליקה ידי centrifuging ב 11,000 XG דקות 1.
      4. הוסף -15 - 30 μl חיץ NE ולאפשר לו לשבת ב RT עבור 1 דקות. לאחר מכן, צנטריפוגות ב 11,000 XG דקות 1. הסר את הג'ל סיליקה ולשמור את התוכן בצינור.
    3. השתמש ערכת רצף לקבוע את הרצף פי הפרוטוקול של היצרן.

זריקה תוך שרירית 3. או ביופסיה של שריר להרחיב

  1. עבור תחזוקה של תנאים סטריליים במהלך ניתוח הישרדות, להסיר שיער באמצעות קוצץ באזור שמסביב באתר הניתוח (האיבר האחורי). השתמש iodophors או chlorohexidine כמו חיטוי. השתמש בסדינים מעוקרים עבור האתר כירורגית על ידי הצבה והאבטחה אותם על החיה כולה שולחן הניתוחים.
    1. תלבש סקראבס נקי, מסכות פנים, כיסוי ראש, כפפות סטריליות, ונעליים מיוחדות בחדר הניתוח 52,53.
    2. </ Ol>
    3. להזריק לכלבים CXMD עם 20 מ"ג / ק"ג של נתרן thiopental להרדים אותם. השתמש במשחה הווטרינר על העיניים כדי למנוע את העיניים מהתייבשות.
    4. השתמש 2 - 3% משאיפת isoflurane לשמור הרדמה כללית (איור 3). בדקו רפלקסים שרירים לפקח לב קצב נשימה כדי להעריך את עומק ההרדמה. קצב הנשימה הרגיל (RR), קצב לב (HR), ואת SpO 2 בהרדמה כללית הם כדלקמן: דמ: 10 - 20 נשימות / דקה; SpO 2: 95 - 100%, HR: 80 - 120 פעימות לדקה (BPM).
    5. באמצעות אזמל, לחתוך את העור לאורך השוקה גולגולתי (CT), המכונה גם הקדמי tibialis (ת"א), ולעשות חתך אחד כ 5 ס"מ אורכי (עבור כלבים בוגרים צעירים). כדי לסמן את המוזרקים, לתפור את fascia העמוק באמצעות מחט כירורגית חוט כירורגי ולעשות שני סמני תפר ב 2 מרווחי סנטימטר.
    6. להזריק את הריכוז הרצוי של AONs לתוך השריר עם מחט 27 G. Concen הרצויtration משתנה בין תנאי הטיפול. עבור CT, לתת שתי זריקות של נפח 1 מ"ל כל אחד, עבור סכום כולל של 1.2 מ"ג של PMOS קוקטייל (0.4 מ"ג לכל PMO) או 0.4 מ"ג של vPMOs קוקטייל (0.13 מ"ג כל vPMO). עבור ulnaris קארפי פושטי שריר forelimb (ECU), להזריק בשני כרכים של 0.5 מ"ל כל עבור סכום כולל של 1.2 מ"ג של PMOS קוקטייל (0.4 מ"ג לכל PMO) או 0.4 מ"ג של vPMOs קוקטייל (0.13 מ"ג כל vPMO). השאר את מחט דקות 1. השתמש בסכום שווה של כל AON לקוקטייל.
    7. בצע ביופסיה של השריר פתוח על ידי הסרת פיסת רקמת שריר כ 2 ס"מ באורך השריר CT באמצעות אזמל כירורגי.
    8. עבור לשלב 6.5 להכנת מדגם שריר.
    9. באמצעות מחט, לנהל זריקה תוך שרירית של 0.02 מ"ג / hydrochloride עצירות קילו לפני שהתעורר מהרדמה כללית. נח fascia שרירים ועור חזרה מעל השריר לתפור אלה באמצעות חוט 3-0 ו 3-0 ניילון חוט נספג עבור fascia שריר וסגירת עור, respectivאיליי.
    10. תוך כדי לחיצה על הפה פתוח, לקבוע אם רפלקס ההקאה שב; כאשר רפלקס ההקאה שב, extubate הכלב.
    11. נהל 15 עד 30 מ"ג / ק"ג Cefazolin או cephalexin (אנטיביוטיקה) עד 3 ימים באמצעות הזרקה תוך ורידית או תוך שרירית כדי למנוע הידבקות.
    12. סר תפרים בתוך שבעה ימים. אל תשאירו את הכלב ללא השגחה עד שהוא שב להכרתו מספיק כדי לשמור שכיבה sternal ואינו מאפשר את הכלב כדי אינטראקציה עם בעלי חיים אחרים עד החלמה מלאה נעשית. שמור את צינורות endotracheal במקום זמן רב ככל האפשר ולהסיר אותם כאשר החיה מתחילה ללעוס או לבלוע. לפקח על הידרציה קצב לב, נשימה, ואת הבהמה כדי לוודא שהם יציבים בתוך גבולות הנורמה.
    13. לקבלת טיפול שלאחר ניתוח, לספק שיכוך כאבים במשך 3 ימים (למשל, עצירות 0.01 מ"ג / קילו) ותמיכת סיעוד, כולל מקום מנוחה שקט, חשוך, פצע מתאים ותחזוקת תחבושת, רךמשטח המנוח, התייבשות עם נוזלים דרך פה או parenteral, וחזרנו האכלה רגילה באמצעות מזון או חטיפים מאוד טעימים. אם כל החיות דורשות תרופות נוספות, לתת זריקה תוך שרירית של 0.3 מ"ג / ק"ג של tartrate butorphanol תלוי בסימפטומים כאבים.
      הערה: כלבי כאב עלולים לנשוך, לשרוט, או לשמור אזורים כואבים, ואם מטופל, עלול להיות מודאג או תוקפני באופן חריג. בנוסף, כאב באיבר אחד בדרך כלל התוצאה היא צולעת או למעלה מחזיק של האיבר הפגוע עם ניסיונות להשתמש בו. במצבים כאלה, לתת זריקה תוך שרירית של 0.02 מ"ג / ק"ג של hydrochloride עצירות כל 6 - שעה 8.

    4. זריקות מערכתיות

    הערה: הליך זה ניתן לחזור שבועי או דו שבועי עבור המספר הרצוי של שבועות.

    1. לרסן כלבים ידני בעדינות על ידי מקבל את הכלב לשכב ואז לעטוף נשק על הכתפיים והירכיים להחזיק את הכלב במקום לאורך tההליך הוא.
    2. להזריק AONs; 120 - 240 מ"ג / PMOS קוקטייל ק"ג (40 - 80 מ"ג כל AON) באמצעות מחט שכינת ורידי לווריד איבר (המכונה וריד כאפאליך או saphenous). כמות AON מוזרק תלוי תנאי הניסוי. השתמש בסכום שווה של כל AON לקוקטייל.
    3. השתמש משאבת עירוי או מזרק הנהג להזריק 50 מ"ל הכולל במשק בשיעור של 2.5 מ"ל / דקה במשך 20 דקות, בעקבות הוראות היצרן. הזרקות חוזרות שבועי או דו שבועי (אחת לשבועיים) לפחות 5 פעמים, כביטוי בדיסטרופין יצטברו עם זריקות חוזרות ונשנות.
    4. בצע בדיקות דם שבועי לבחון רעיל.
      1. באמצעות מחט, לאסוף 3 מ"ל של דם - 0.5 מ"ל עבור ספירת דם מלאה (CBC) ו -2.5 מ"ל עבור אחרים - מאחד ורידים תת עורית של קדמי או hindlimb. כלול CBC, transferase גמא glutamyl (GGT), aminotransferase aspartate (AST), חנקן אוריאה בדם (BUN), aminotra אלאניןnsferase (ALT), קריאטין קינאז (CK), והערכות קריאטינין כאשר בודקים את הדם שנאסף, בעקבות הוראות היצרן ערכות בדיקת דם. 40,54

    5. דירוג קליני של כלבים

    1. הגדרת מצלמת וידאו התנהגות כלב שיא הליכה. רשום את המפגש כולו עם הכלב כמו זו תפעל כהפניה כאשר לדירוג הכלב; זה אומר כל וידאו יהיה באורך שונה תלוי ביכולות והנכונות של הכלב. שימוש בפרמטרים הקלטה מחדל. צילומים יוצרים תיעוד של לדירוג כך שהוא יכול להיבדק במועד מאוחר יותר.
    2. הפרעות הליכה ותנועה כיתה.
      1. עבור הפרעות הליכה ותנועה, להשתמש בכיתות הבאות:
        כיתת 1 = אף אחד, כיתה 2 = יושבת עם מורחבת גפיים אחוריים, כיתת 3 = ארנב-כשות עם גפיים אחוריים, כיתת 4 = בהילוך מרושל, כיתה 5 = מסוגל ללכת.
      2. עבור הפרעה ניידות, להשתמש בכיתות הבאות: כיתת 1 = אף אחד, גרADE 2 = בשכיבה יותר מרגיל, כיתה 3 = לא יכול לקפוץ על גפיים אחוריים, כיתה 4 = קושי גדל והולך הסתובבות, כיתה 5 = מסוגל לקום ולהסתובב.
    3. זמן כמה זמן זה לוקח את הכלב לרוץ 15 מטר. מדדו את 15 מ ', למקם את הכלב על קו הזינוק ולעודד אותו לפעול עד סימן 15 מ'.
    4. לקבוע ניוון שרירים של הגפה באמצעות הסולם לדירוג הבא:
      כיתת 1 = אף אחד, כיתה 2 = קשיות חשודות, כיתה 3 = יכול להרגיש קשיות או מופיע 4 = רזה, כיתה בין ציוני 3 ו -5, כיתת 5 = דק מאוד או קשה.
    5. כיתת ריר שימוש בסולם שלהלן: כיתה 1 = אף אחד, כיתה 2 = מדי פעם מטפטף רוק כשיושב, בדרגה 3 = כמה ריר כאשר אוכל ושותה, כיתה 4 = מחרוזות של ריר כאשר אכילה או שתייה, כיתה 5 = ריר רציף.
    6. כיתה היפרטרופיה של הלשון (macroglossia) תוך שימוש בסולם שלהלן: כיתה 1 = אף אחד, כיתה 2 = מעט מוגדל, בדרגה 3 = outsi המורחבתשיניים דה, כיתה 4 = מוגדלים מעובה מעט, כיתה 5 = מוגדלים מעובה.
    7. כיתת היכולת של הכלב לבלוע באמצעות הסולם הבא: הכיתה 1 = שום קושי, כיתת 2 = לוקח זמן ומאמץ לקחת אוכל, בדרגה 3 = קושי לקחת אוכל מצלחת, כיתת 4 = קושי בלעיסה, בליעה, או שתייה , כיתת 5 = מסוגל לאכול.
    8. חישוב ציון הכולל על ידי הוספת עשרות מכל קטגוריה (למעט בדיקת ריצת 15 מ ') 55.
      הערה: מחקרים צריך להיות עיוור כדי לא להציג את ההטיה.

    6. הדמיית תהודה מגנטית (MRI)

    1. השתמש 3 טסלה (3T) MRI ו -18 ס"מ קוטר / 18 ס"מ אורך סליל האדם הגפיים כדי להשיג תמונות משוקלל T2 של הגפיים האחוריות.
    2. להרדים בעלי חיים על ידי הזרקת כלבים CXMD עם 20 מ"ג / ק"ג של thiopental. השתמש במשחה הווטרינר על העיניים כדי למנוע את העיניים מהתייבשות. השתמש 2-3% משאיפת isoflurane לשמור הרדמה כללית.
      1. בדקו רפלקסים שרירים לפקח לב קצב נשימה כדי להעריך את עומק ההרדמה. קצב הנשימה הרגיל (RR), קצב לב (HR) ו SpO 2 בהרדמה כללית הם כדלקמן: דמ: 10 - 20 נשימות / דקה, SpO 2: 95 - 100%, HR: 80 - 120 פעימות לדקה (bpm ).
    3. השתמש בהגדרות הבאות כדי להשיג תמונות משוקלל T2: TR / TE = 4,000 / 85 msec, עובי פרוסה = 6 מ"מ, פרוסה הפער = 0 מ"מ, שדה הראיה = 18 ס"מ x 18 ס"מ, גודל מטריצה ​​= 256 x 256, ו מספר הרכישות = 3 במהלך הד ספין מהיר (איור 4).

    7. שרירי דגימה כנה (Necropsy)

    הערה: שרירים צריכים להיות שנדגמו שבוע או שבועות לאחר הזרקת AON האחרונה.

    1. להזריק לכלבים עם 20 מ"ג / ק"ג של נתרן thiopental להרדים אותם. השתמש במשחת וטרינר על העיניים במהלך הרדמה כדי למנוע התייבשות של העיניים.
    2. השתמש 2 - 3% משאיפת isoflurane לשמור Anesthesia. בדקו רפלקסים שרירים לפקח לב קצב נשימה כדי להעריך את עומק ההרדמה. קצב הנשימה הרגיל (RR), קצב לב (HR) ו SpO 2 בהרדמה כללית הם כדלקמן: דמ: 10 - 20 נשימות / דקה; SpO 2: 95 - 100%, HR: 80 - 120 BPM.
      1. להרדים כלבים ידי exsanguination בהרדמה כללית (עבור necropsy בלבד). השתמש exsanguination בהרדמה כללית עמוקה כדי למנוע את ההשפעות שנגרמו על ידי גורמים שמקורם בדם בניתוח המולקולרי (למשל, שרירים של לב).
    3. לנתח את השרירים הבאים (איור 5): CT, longus digitorum פושטי (EDL), הגסטרוקנמיוס, soleus, femoris שרירי, femoris rectus, שרירי brachii, זרוע אחורית brachii, deltoid, ECU, קארפי פושטי radialis (ECR), ulnaris קארפי מכופף (FCU ), radialis קארפי המכופף (FCR), gracilis, צלעי, שרירי בטן, סרעפת, dorsi, ושט, sternocleidomastoid, ולב לרוחב. כדי לבחון רעיל, לאסוף כליות liדגימות Ver. השתמש אוונס ואלכסנדר דה Lahunta (2009) כנקודת התייחסות טכניקה לנתיחה 56.
    4. חותכים את CT, אדי, הגסטרוקנמיוס, soleus, femoris שרירי, femoris rectus, שרירי brachii, זרוע אחורית brachii, deltoid, ECU, ECR, FCU, FCR, gracilis, צלעי, שרירי הבטן, הגב הרחיב לרוחב, הוושט, sternocleidomastoid, לב, כליות, והכבד למקטעים קטנים כ 1 - 1.5 ס"מ אורך. מגלגלים את הסרעפת למעלה ולאחר מכן לחתוך אותו לתוך 1 - 1.5 ס"מ סעיפים 56.
    5. מניחים tragacanth מסטיק כך שזה כ 0.5 - 1 ס"מ עובי על דיסקים הפקק. דיסקים תווית עם שם זיהוי השריר של החיה בצד השני של מסטיק נכאת.
    6. מניח שרירים עם ציר האורך שלהם בניצב פקק המסטיק נכאת.
    7. מניח את הפקקים במכל של איזופנטאן כי יושב בחנקן נוזלי. זוזו סביב כל הזמן עם פינצטה דקות 1 או עד קפוא לחלוטין. שרירי חנות על פקקיםצלוחיות ב -80 מעלות צלזיוס. בעת ההובלה, לשים צלוחיות על קרח יבש.
    8. כן שקופיות זכוכית ועליה שמו חית זיהוי / שריר ותאריך.
    9. בתוך cryostat מקורר -25 ° C, לעגן את הפקק אל הדוכן. הגדר את עובי סעיף לרמה הרצויה. השתמש 8 מיקרומטר אימונוהיסטוכימיה ו -12 מיקרומטר עבור hematoxylin ו eosin (HE) מכתים. השתמש 15 מיקרומטר עבור דגימות כתם מערביות. חתוך כרבע של השריר להשיג שריר שטוח לדגימת שרירים נכונה.
    10. קטע שריר חיתוך אחד בכל פעם, במקום כל סעיף 6 ה באותו שקופיות זכוכית במידה ואתם מתכננים להשתמש דגימות אימונוהיסטוכימיה או HE מכתים. אם באמצעות דגימות עבור כתמים מערביים, לשים 30 - 40 פרקים, צינור ולאחסן ב -80 מעלות צלזיוס.
    11. לאחר הכנה של שקופיות, בואו שקופיות להתייבש במשך 1.5 שעות ב RT. חנות שקופיות ב -80 ° C.

    8. אימונוהיסטוכימיה

    1. סר שקופיות מוכנות מאחסון ומניח אותםבתא לחות כדי לשמור את השקופיות מופרדים לשמור על לחות. ממלא את החדר הלח כך התחתון הוא מכוסה רק עם מים (כ 1 מ"מ של מים).
    2. אוויר יבש במשך 0.5 שעות. צייר ריבוע התוחם את מדגם השרירים בשקופית באמצעות עט מחסום הידרופובי.
    3. הוסף 15% נסיוב עז בופר פוספט (PBS) ו דגירה של שעה 2 ב RT בחסימת מגיב.
    4. הוסף דומיין מוט אנטי בדיסטרופין (פרע-1) עכבר נוגדן ראשוני חד שבטי, או נוגדנים חד שבטיים C- מסוף (פרע-2) עבור מכתים בדיסטרופין כלב (1: 150 דילול). לדלל באמצעות סוכן חסימת 1.25 מ"ל של PBS. דגירה O / N בתוך המקרר כדי רווח 4 ° C..
    5. לשטוף עם PBS במשך 5 דקות, חזר על עצמו שלוש פעמים. להוסיף משני נוגדנים אלקסה 594 עז נוגדנים נגד IgG1 העכבר (עבור פרע-2) או IgG2 (עבור פרע-1) (1: 2,500). לדלל עם ריאגנט חסימת PBS המכיל 0.1% octyl ethoxylate פנול. דגירה של 0.5 שעות ב RT.
    6. לשטוף עם PBS במשך 5 דקות, שלוש tIMEs. אפשר שקופיות לייבוש. להוסיף 1 - 2 טיפות (3 ng / ml) של 4 ', 6-diamidino-2-phenylindole (DAPI) פתרון גובר. בעזרת פינצטה, במקום להחליק זכוכית מעל אחד מהסעיפים, הימנעות בועות.
    7. צפה dystrophin- (פרע-1 / פרע-2) סיבים חיוביים תחת מיקרוסקופ פלואורסצנטי ב 594 ננומטר בהגדלה 20X.

    9. מערבי סופג

    1. הוספת סעיפים שריר שנאספו מ קריו-חתך 150 μl של חיץ מדגם על הקרח.
    2. באמצעות homogenizer יד, homogenize דגימות חלבון בקצרה. דגימות מחממי צינור 1.5 מיליליטר חממת בלוק חימום על 95 מעלות צלזיוס במשך 3 - 5 דקות. צנטריפוגה ב g 16,500 × במשך 15 דקות לאסוף את supernatant.
    3. חנות aliquots של supernatant ב -70 ° C.. השתמשו במים מזוקקים כדי לדלל את 100x.
    4. קביעת ריכוז חלבון באמצעות ערכה מסחרית על פי הפרוטוקול של היצרן. הוסף חוצץ SDS-פירוק Laemmli 2x דגימות חום למשך 3 דקות &# 160; על 95 מעלות צלזיוס.
    5. דגימות טען לתוך 3 - 8% ג'ל טריס-אצטט לפני הפעלת אותו במשך 3 שעות ב -150 V. כוללים מספר wild-type מדולל (WT) דגימות (למשל, 1%, 10%, ו -50%) עבור כימות. פחות מ -1% WT הרמות בדיסטרופין צריכות להתגלות בשיטה זו.
    6. מניחים את הג'ל במאגר קטודה במשך 20 דקות. במהלך תקופה זו, לצלם תשע חתיכות של נייר סינון ולשים אותם מאגרי ההעברה (3 ניירות למאגר קטודה [+], למאגר האנודה ([-], ואת חיץ האנודה המרוכז [-], בהתאמה) זו. מתאר שיטת העברה-יבש למחצה אשר מגבירה את הרגישות (איור 6).
    7. משרי קרום PVDF מתנול במשך 20 שניות ולאחר מכן למקם למאגר האנודה.
      הגדר את הג'ל עם קרום להעברת חצי יבש ולאפשר לו לרוץ 1.5 שעות ב 400 מילי-אמפר ב RT או בחדר קר.
    8. לשטוף את הממברנה עם PBS. דגירה הממברנה בתערובת של PBS עם Tween 20 (PBST) ואבקת חלב 5% עבור 2 שעות.
    9. לדלל פרע-1 (נוגדן ראשוני) ב PBST תערובת אבקת חלב 5% עד דילול 1: 100. להוסיף אותו הקרום ולתת לו דגירה של לפחות שעה 1. לשטוף שלוש פעמים עם 100 מ"ל PBST במשך 15 דקות כל אחד.
    10. להוסיף 65 μl / השביל של נוגדנים משני מצומדות HRP (אנטי עכבר IgG2a עבור DYS1) בשעה 1: 5,000 דילול עבור שעה 1 ב RT באזור חשוך. לאחר מכן, לשטוף עם שלוש פעמים עם 200 מ"ל PBST במשך 20 דקות. מערבבים פתרונות מתוך ערכת זיהוי על פי ההנחיות. דגירה של 1 דק '.
    11. לפתח את הסרט כדי לזהות להקות ולנתח עם ImageJ תוכנה 48,57,58.

Representative Results

בניסויים במבחנה

Myoblasts היה transfected עם תנאי טיפול שונים 2'OMePS כדי להשוות את היעילות של כל AON. טיפולים AON יחיד עם 600 ננומטר אחד Ex6A, Ex6B, Ex8A, או Ex8B נעשו, כמו גם טיפול קוקטייל עם 600 ננומטר כל אחד 4 כל רצפי AON. דגימות רנ"א נאספו ארבעה ימים לאחר transfection. לאחר RT-PCR, דגימות עבור כל טיפול נוהלו על ג'ל יחד עם דגימות שאינם מטופלים (NT). להקות גבוהות על הג'ל מייצג מחוץ למסגרת מוצרי DMD; להקות אלה נראו NT, Ex8A, ו Ex8B מטופלים myoblasts. Ex6A, Ex6B, Ex8A, ואת myoblasts שטופל הקוקטייל הראו מוצרים בתוך המסגרת. קוקטייל ו Ex6A / B הראה 100% ב-מסגרת מוצרים, תוך Ex8A הראה ל 30% ב-מסגרת מוצרים (איור 7). כדי לאשר אקסון מדלגים ושיקוםאת מסגרת הקריאה, רצף cDNA בוצע; הממצאים הצביעו על כך אקסונים 6 - 9 כבר דילג אכן (איור 7). אימונוהיסטוכימיה הראה כי כלבים שטופלו AON עלו סיבים חיוביים בדיסטרופין לעומת דגימות NT (איור 8).

בניסויים Vivo

כדי להשוות את היעילות של תנאי טיפול שונים AON, כלבי CXMD (0.5 - 5 שנים) הוזרקו פעם עם 1.2 מ"ג Ex6A או קוקטייל של Ex6A, Ex6B, ו Ex8A במינונים שונים. שבועיים לאחר ההזרקה, דגימות שריר נאספו מוכתם פרע-1 כדי להשוות את מספר סיבי חיובי בדיסטרופין. כל הדגימות שטופלו הקוקטייל הראו ביטוי בדיסטרופין מוגבר לעומת דגימות NT. בדיסטרופין חיוב סיבים מוגברים עם AON מינון (איור 9). המערכת הבאההזרקת ic, wild-type (WT), NT, דגימות שריר CXMD שטופלו קוקטייל הוכתמו פרע-1 (איור 10). קוקטייל שטופל כלבי CXMD והראו גדילת ביטוי בדיסטרופין לעומת כלבי NT CXMD, הן CT דגימות שריר לב. עם זאת, שרירי השלד שטופלו AON (CT) הראה הרבה ביטוי גבוה בדיסטרופין לעומת שריר הלב ומטופל. Immunoblot השוואת WT, NT, ו שוני שרירי morpholino שטופל קוקטייל הוביל לאותה המסקנה. היה שם גם מגוון גדול של ביטוי בדיסטרופין בדגימות שרירי השלד שטופלו (איור 10). Hematoxylin ו eosin (HE) מכתים גילה כי מטופלים CXMD כלבים הראה histopathology משופרת, עם ירידה משמעותית סיבי-גרעיני מרכזי (CNF) בהשוואה לכלבים NT CXMD (איור 11). זה מצביע שיש ניוון יותר / התחדשות המתרחשים כלב NT, סימן פתולוגיה שריר dystrophic. בנוסף, כלבים שטופלו היו מהרפועל פעמים ועשרות משופרת על סולם לדירוג קליני. כלבי מטופלי CXMD הראו ציונים טובים יותר מאשר כלבי NT CXMD בכל הקטגוריות (איור 12).

איור 1
תבנית מוטציה באיור 1. של CXMD כלב וגם אקסונים 6 -. 8 אסטרטגיות דילוג שימוש קוקטייל אנטיסנס כלבים CXMD יש מוטציה טעם אקסון 6 שמוביל לאובדן של אקסון 7 ב mRNA כלב דיסטרופי. זו התוצאה של mRNA להיות מחוץ למסגרת וייצור חלבון בדיסטרופין הולך לאיבוד. רצפי AON קצרים נועדו להיקשר אקסון 6 ו -8, שתוצאתה שחבור mRNA דילוג ביעילות אקסונים 6 - 8. הסרגל האפור כלבי הקוקטייל שטופל AON מייצג רצפי AON קצרים. אקסון 9 מקודד תחום ציר ולפעמים עובר שחבור החוצה באופן ספונטני עם AONs נגד אקסון 6 ו -8 הקודים mRNA שנוצר עבור בדיסטרופין חלבונים כי הם קצרים אך פונקציהal. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2. תסמינים קליניים רחבי היקף של בעלי חיים 1 בן ניוון שרירים כלב X-צמודות (CXMD). ביגל wild-type 1 בן וכלב CXMD מוצגים. המעורבות הפרוקסימלי, איבר, ושרירים זמניים בדרך כלל הם נצפו מ 2 חודשים של גיל. התכווצות משותפת הסטה של האגן גלוי מגיל 4 חודשים של גיל. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור 3. הרדמה כללית על כלב. א) Intramusculזריקות ar וביופסיות שריר מתבצעים תחת הרדמה כללית עם isoflurane. B) קיום חית זריקות מערכתיות. נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 4
איור 4. דימות תהודה מגנטית (MRI) של wild-type, שאינם מטופלים CXMD, והתייחסו CXMD. סריקות MRI של הגפיים האחוריות לאחר 3 חודשים ו -5 חודשים ב WT וכלבים NT CXMD. שתי תמונות מדגם של טרום בבדיקות MRI הגפיים האחוריות CXMD מטופלים (1 שבוע לפני הזריקה הראשונה) ו לאחר ההזרקה של AON מוצגים. 2703MA טופל שבועי 7x עם 200 מ"ג / morpholinos קוקטייל הק"ג. 2001MA טופל הזרקת IV שבועית 5x של 120 מ"ג / morpholinos קוקטייל קילו. שליטה והכלבים מטופלים היו שוות גיל. כלבי מטופלים מראים ירידת אותות T2. תמונות ADAP טד באישור ואח יוקוטה. (זכויות יוצרים 2009, John Wiley & Sons) 40 אנא לחצו כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 5
שרירי איור 5. נוהל ביופסיה עבור כלב. א) גפיים תחתונים הוא קבוע עבור ביופסיה של שריר. B) בעזרת מלקחיים, הגפה התחתונה מתקיימת. ג) שריר CT חשוף. טכניקת ביופסיה להרחיב משמשת להשיג דגימות שריר אתרים מוזרקים. אשכולות משמשים כדי להחזיק דגימות ביופסיה. D) דגימות שריר על מסטיק tragacanth לאחר דיסקציה. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

/53776/53776fig6.jpg "/>
איור 6. שיטת העברה חצי יבשים. ייצוג של שיטת ההעברה-יבש למחצה עבור מערבי סופג מוצג. שלושה עיתונים ספוגים חיץ האנודה מרוכז מוטלים למטה במסוף השלילי; 3 ניירות טבולים חיץ האנודה נערמים על גבי זו. העיתון PVDF Mb הוא שרוי בתוך חיץ האנודה מתנול ולאחר מכן בטרם הניח על גבי 6 בעיתונים. הג'ל, אשר כבר ספוג חיץ קתודה, הוא הניח בעדינות על נייר PVDF. לבסוף, 3 ניירות טבולים חיץ קטודה מוטלים על גבי הג'ל. המסוף החיובי מוגדר על גבי. במשך שעה 1, 400 mA מנוהלת באמצעות המערכת. אנא לחצו כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 7
איור 7. אקסון דילוג ב CXMD myoblasts. et al. (זכויות יוצרים 2009, John Wiley & Sons) 40. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

הספרה 8
איור 8. מוגברת Dystropהביטוי הין ב 2'O-מפוגל Phosphorothioate (2'OMePS) transfected CXMD myoblasts. myoblasts CXMD היו transfected עם Ex6A לבד או עם 2'OMePS קוקטייל. פרע-2 (אדום) ו DAPI (כחול) מכתים מוצגים. Myoblasts מטופלים מושווים wild-type (WT) ואת שאינם מטופלים myoblasts (NT). תמונות מותאמות באישור יוקוטה et al. (זכויות יוצרים 2009, John Wiley & Sons) 40. בר = 50 מיקרומטר. לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 9
הצלת איור 9. ביטוי בדיסטרופין עם תוך שרירית זריקות של Morpholinos ב CXMD כלבים. כך או Ex6A לבד או קוקטייל של Ex6A, Ex6B, ו Ex8A הוזרקה שרירי CT של כלבי CXMD. בדיסטרופין (DSY-1) מכתים של wild-type(WT), שאינם מטופלים (NT), והתייחסו כלבים CXMD מוצגים. כלבים טופלו או עם 1.2 מ"ג Ex6A לבד או 1.2 קוקטייל מ"ג. תמונות מותאמות באישור יוקוטה et al. (זכויות יוצרים 2009, John Wiley & Sons) 40. בר = 100 מיקרומטר. לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 10
איור 10. גברת ביטוי בדיסטרופין לאחר קוקטייל מערכתי טיפול Morpholino ב CXMD כלבים. בדיסטרופין (פרע-1) מכתים שמש להשוות ביטוי בדיסטרופין ב סוג בר (WT) (בקרה חיובית), שאינו מטופלים (NT) (שליטה שלילית), כלבים CXMD שטופלו 120 מ"ג / ק"ג morpholino קוקטייל (40 מ"ג / ק"ג של כל AON). קוקטייל morpholino הכלול Ex6A, Ex6B, ו Ex8A. כלבים היו מוזרק לווריד 5 פעמים אנוekly עם הקוקטייל הזה. א) השוואת ביטוי בדיסטרופין ב שוקה גולגולתי (CT) שרירי WT, NT, וכלבי מטופלים. ב) השוואת ביטוי בדיסטרופין ברקמת לב בין NT ו morpholino כלבים שטופל קוקטייל. C) immunoblot עבור בדיסטרופין עם desmin כביקורת הטעינה יוצג למשך WT, NT, ו morpholino כלבים שטופלו קוקטייל. השרירים הבאים מוצגים לכלבים מטופלים: triceps brachii (TB), שרירי brachii (BB), הסרעפת (DIA), הוושט (ESO), CT, adductor (ADD), longus digitorum פושטי (EDL), masseter (MAS), ולב. תמונות מותאמות באישור יוקוטה et al. (זכויות יוצרים 2009, John Wiley & Sons) 40. בר = 200 מיקרומטר. לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 11
דמות11. שיפור Histopathology ב CXMD כלבים שטופלו 7 שבועות עם 240 מ"ג / ק"ג Morpholino קוקטייל. כלבים CXMD החל חצי שנה עד חמש שנים היו מוזרק לווריד עם 240 מ"ג / ק"ג קוקטייל morpholino (Ex6A, Ex6B, ו Ex8A) פעם בשבוע במשך 7 שבועות. ארבעה עשר יום לאחר הזריקה האחרונה, שרירי הוושט נלקחו hematoxylin ו eosin (HE) מכתים נעשה. HE מכתים של שרירי הוושט מן שטופלו הלא (NT) ואת morpholino קוקטייל שטופלו (צבוע) כלבים CXMD (40X עדשה אובייקטיבי). נא ללחוץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 12
איור 12. ציונים משופרים על דירוג קליני 15 מ 'ריצת זמן לאחר Morpholino הטיפול. כלבים שטופלו Morpholino הושוו שאינם מטופלים (NT) להמלטהים. ברי שגיאה בגרף עולים SEM. א) ניקוד כולל בבחינה לדירוג הקלינית חושב לפני ואחרי טיפול חיות שטופלו הושוו עם להמלטת NT. ב) השוואה של 15 מ 'פעמים ריצה של כלבים מטופלים NT. C) דומה ל- B; עם זאת, כלבים צעירים שימשו. תמונות מותאמות באישור יוקוטה et al. (זכויות יוצרים 2009, John Wiley & Sons) 40. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

אנטיסנס oligonucleotide רצף נוקליאוטידים
Ex6A GTTGATTGTCGGACCCAGCTCAGG
Ex6B ACCTATGACTGTGGATGAGAGCGTT
Ex8A CTTCCTGGATGGCTTCAATGCTCAC

טבלת 1. עיצוב מולקולת אנטיסנס קצר.

Discussion

דילוג על אקסונים הוא טכניקה טיפולית מבטיחה לטיפול DMD. הן במבחנה בניסויים vivo הראו כי דילוג רב אקסון אינו ריאלי. כאן, השימוש במודל כלב CXMD נדון. ראשית, AONs תוכננו באמצעות התוכנית Rescue-ESE ותוכניות ESEfinder למקד אקסונים בדיסטרופין 6 - 8. כימיה 2'OMePS AON שימש transfection myoblast CXMD והכימיה עמוד השדרה AON morpholino נבחר לניסויים in vivo. vPMOs הם יעיל יותר מאשר PMOS ללא שינוי אך בשל הרעילות הגבוהה שלהם הוא אינם מתאימים זריקות מערכתיות. מיצוי RNA, RT-PCR, וסדר cDNA בוצעו על myoblasts CXMD. הכלבים מוזרקים עם קוקטייל PMO דורגו קליני להעריך כל שיפור בתסמינים קליניים. לאחר שהכלבים היו מורדמים אנושיים, דגימות שריר נלקחו והוכנו-חתך cryo. זמן מחצית החיים של חלבון הדיסטרופין המושרה על ידיONS הוא האמין להיות כ 1 - 2 חודשים. כלבים בוגרים צעירים שימשו במחקר זה, אם כי ניסויים אלה ניתן לעשות עם כלבים ילודים כלבים מבוגרים (> בן 5 שנים). סעיפי שריר מוכנים שמשו להעריך histopathology ולהעריך חלבון הצלה בדיסטרופין באמצעות מערבי סופג אימונוהיסטוכימיה 48.

חשוב להבטיח כי היקף פתרון PMO נכון לפני זריקות; אי לעשות זאת תהיה השפעה משמעותית על תוצאות. במהלך זריקה תוך שרירית, לחץ מספיק נדרש להזין סיבי השריר. ניטור של כלב בריאות ובדיקה של אתר הניתוח חשוב לפתרון בעיות. כדי לפקח על בריאות בעלי חיים, בדיקות דם שבועיות ומשקל צריכות להתבצע. לאחר euthanization של החיה והכנה דגימות שריר, צעד חיוני להבטחת רגישות באיתור חלבון בדיסטרופין הוא להשתמש בשני הג'ל טריס-יצטט ושיטה סופג חצי יבשהבמהלך ההליך המערבי סופג.

כפי שניתן לראות בתוצאות הנציג, myoblasts שטופל Ex6A, Ex6B, Ex8A, ואת הקוקטייל (המכיל Ex6A, Ex6B, Ex8A, ו Ex8B) מיוצר מסגרת מוצרי DMD. מאז Ex8B הניבה שום מוצרים אקסון-דלג, זה לא היה בשימוש לאחר בניסויי vivo. רצף cDNA הראה כי אקסונים 6 - דילוג 9 התרחשה immunocytochemistry עם מכתים פרע-2 הראה משוחזר ביטוי בדיסטרופין בדגימות מטופל. AON שטופלו כלבים הראו עלייה משמעותית בסיבים בדיסטרופין חיובי. זה מצביע על כך אקסונים 6 - 8 היו מדלגים עליו לבין חלבון מקוצר הופק. כמות הסיבים בדיסטרופין החיובי מוגברת כאשר קוקטייל של AONs שמש והייתה פרופורציונאלי מינון AON. Immunoblots והראה גדילת ביטוי בדיסטרופין בכלבים מערכתיים שטופל morpholino. שרירי שלד היו רמות משתנות של סיבים בדיסטרופין; עם זאת, רקמת לב שטופלו morpholino הראה מעטשיפור הביטוי בדיסטרופין. מאז בדיסטרופין יש משקל מולקולרי גבוה (427 KDA), זיהוי של כמויות נמוכות בדיסטרופין יכול להיות קשה. לקבלת התוצאות הטובות ביותר, ג'ל טריס-יצטט ואת שיטת ההעברה-יבש למחצה היו בשימוש. HE מכתים הראה histopathology השתפר כלבים שטופלו morpholino. מרכזי-גרעיני סיבים (CNFs) הם סימן של שריר בריא ולייצג מחזורים של ניוון שרירים והתחדשות. Morpholino שטופלו כלבים CXMD נרשמה ירידה באחוז CNFs בהשוואה לכלבים CXMD שאינם מטופלים. לדירוג קליני גילה שיפור בתסמינים, כגון הליכה מוגברת ויכולת לרוץ, בחיות שטופלו morpholino. הקשיות של השרירים הוא האמין כדי לשקף ניוון שרירים, ובכך, הוא נכלל בתכנית לדירוג 59. הקשיות של ירך (אחורי-איבר) שרירים הוערכה; עם זאת, לא כללנו שרירים גולגולתי סארטוריוס כי הן נוטות להציג היפרטרופיה ולא ניוון ב CXMD. המטופלים כלבים להראותאד ציונים לדירוג נמוכים והיו פעמים מהר על מבחן הריצה 15 מ '. פעמים משופרות במבחן 15 מ 'מעידות על תפקוד שרירים משופר 40. עשרות לדירוג כוללים גבוהים מצביעים בריאות לקויה וניוון שרירים מוגבר.

למרות שתוצאות אלה אינן מבטיחות, מדלגים-אקסון רב עדיין מציבה בפנינו אתגרים רבים כי יהיה צורך להתגבר לפני יש את הטכניקה ישימות קלינית. ברקמת לב עדיין מציגה ספיגה מופחתת של AONs, ככל הנראה בשל ההבדל בסחר הסלולר בין רקמת לב שלד. אין השפעות רעילות נצפו בבעלי חיים תחת משטרי מינון נוכחיים; עם זאת, יותר עבודה שצריך לעשות על מנת להעריך רעילות ארוכי טווח לפני והשלכת בקבוקי AON יכול לעבור ניסויים קליניים. קשה לקבל אישור לתרופות קוקטייל AON כי רשויות רגולטוריות להגדיר כל רצף AON כתרופה ייחודית. משמעות הדבר היא כי כל רצף קוקטייל היה צריך להיבדק בנפרד עבור Safety, הדורשים יותר זמן ויותר כסף. מחסום נוסף על שימוש דילוג רב אקסון בסביבה קלינית הוא כמות גדולה של מוצרי חלבון הביניים מיוצרים עם פונקציות ידועות. חלבונים אלה עלולים לגרור פעולות תופעות לוואי בלתי צפוי, תלוי מוטצית פרט 22. בנוסף, דפוסי המוטציה הזמינים בתוך מודלי כלב דיסטרופי הנוכחיים מוגבלים. ישנם כמה מוטציות טבעיות המתחוללות, ולא כל המוטציות הן שימושיות לחקר דילוג אקסון-רב. מודל חזיר דיסטרופי מבטיח להיות אלטרנטיבה טובה עבור אקסון בעתיד DMD דילוג מחקרים 33, 34.

המודלים כלב DMD יש כמה יתרונות על פני מודלים DMD אחרים. להיות לדירוג קליני, במודל חיה גדול ו- MRI אפשרי, המאפשר ניתוח מפורט יותר. מאז כלבים הם בעלי חיים גדולים הם גם יותר מתאימים מחקרי רעלים ועוד מקרוב מייצגי המחלה האנושית בהשוואה למודל העכבר. כלב מodels גם יש רצפי גנים DMD, כי הם יותר דומים לבני אדם 23, 34, 45.

למרות שטכנית מאתגר, גישת הדילוג הרב אקסון יכולה בסופו של דבר ליהנות> 90% מחולי DMD 24. זה עושה את זה אלטרנטיבה הרבה יותר טובה כדי דילוג חד אקסון, כמו דילוג חד אקסון הוא חל רק על קבוצה קטנה של חולים. בנוסף, דילוג רב אקסון יאפשר לנו לבחור את דפוסי המחיקה המביאות למרב את הפונקציונליות של חלבונים בדיסטרופין מקוצר. לדוגמא, מחיקת DMD אקסונים 45 - 55 קשורים לסימפטומים קלים במיוחד או אנשים ללא תסמינים 14,19,60-63. את מדלגת רב אקסון של אקסונים 45 - 55 כבר הודגמה במודל של עכברים של DMD עם המחיקה 52 אקסון (mdx52) באמצעות זריקות מערכתית של 22,26 vPMOs. שימוש קוקטייל vPMOs גם הודגם צורות אחרות של ניוון שרירים, כגוןניוון שרירים מולד פוקויאמה (FCMD). FCMD נגרמת על ידי לכידת אקסון, שבו שחבור mRNA סוטה נגרם על ידי החדרת retrotransposon. vPMOs הוכח להציל את דפוס השחבור בשני מודל עכבר FCMD וב שורות תאים אנושיים 64. כימיות AON הדור הבא מציגות יעילות גבוהה רעילות נמוכה תקלנה על התרגום היעיל של גישת דילוג הרב אקסון לתוך יישום קליני. בנוסף, דילוג רב אקסון שעלול להיות מיושם על הפרעות גנטיות אחרות, כגון dysferlinopathies 24, 65.

Materials

Name Company Catalog Number Comments
2'OMePS Transfection of Dog Myoblasts 
3 ml 6-well plates IWAKI 5816-006
Dulbecco’s modified Eagle’s medium (DMEM)  Gibco 11965-092
Fetal bovine serum (FBS)  HyClone SH30071.01
Penicillin  Sigma-Aldrich  P4333  200 U/ml 
Lipofectin  Invitrogen  18292-011 Total volume of 100 ml in opti-MEM media at a ratio of 2:1 for lipofectin. 
10 ml lipofectin for 5 mg RNA. 
2’OMePS Eurogentec  Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC). 
Horse Serum  Gibco 16050-114 2%
streptomycin  Sigma-Aldrich P4333  200 μg/ml
Bovine serum albumin (BSA)  Sigma-Aldrich A9418 
Insulin
Morpholino transfection of dog myoblasts
All material from MePS Transfection of Dog Myoblasts for culturing
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
Endo-Porter Gene-tools
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
Chloroform Sigma-Aldrich P3803 200 μl 
1.5 ml Tubes  Eppendorf 22363204
Centrifuge  Beckman-Coulter
75% Ethanol  Sigma-Aldrich 34852
UV Spectrometer 
Forward primer in exon 5  Invitrogen CTGACTCTTGGTTTGATTTGGA                          
1.5 μl 10 μM
Reverse primer in exon 10  Invitrogen TGCTTCGGTCTCTGTCAATG                            
1.5 μl 10 μM
dNTPs Clontech 3040
One-Step RT-PCR kit  Qiagen  210210
Thermo-cycler Scinco
Complementary DNA (cDNA) Sequencing 
Gel extraction kit  Qiagen  28704
Centrifuge 
Terminator v3.1 Cycle Sequencing Kit  Applied Biosystems  4337454
Intramuscular injections or open muscle biopsy
Surgical Tools Scissors, scalpel, needle, surgical thread 
Vet Ointment 
Iodophors  webtextiles 12190-71-5
chlorohexidine Peridex 12134
Surgical Drapes 
Scrubs
Facial Mask 
Surgical Gloves 
Head Covering 
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
27 G Needles TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225
buprenorphine hydrochloride
Tongue Depressor 
cephalexin 15 to 30 mg/kg 
cefazolin 15 to 30 mg/kg 
buprenorphine  0.01 mg/kg
buprenorphine hydrochloride  0.02 mg/kg
Systemic Injections
Syringe infusion pump  Muromachi 
22 G Indwelling needles TERUMO SG3-2225 
27 G Needles  TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225 
Saline Ohtsuka-Pharmaceutical 28372
Clinical Grading of Dogs
Video Camera 
Stop watch 
Magnetic resonance imaging (MRI) 
3 Tesla MRI l 
18 cm diameter/18 cm length human extremity coil
Muscle sampling and preparation (necropsy)
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Tragacanth gum 10-20 ml
Liquid Nitrogen 
Cork Discs Iwai-kagaku  101412-806
Dry Ice
Tweezers
Poly-L-lysine–coated slides Fisher 22-037-216
Cryostat Microsystem  Leica  cm1900 
Immunohistochemistry 
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
DYS2 Novocastra  NCL-DYS2  1:150 dilutions
Alexa 594 goat antimouse IgG1  Invitrogen A-21125 1:2,500 dilutions
Alexa 594 goat antimouse IgG2  Invitrogen A-11005 1:2,500 dilutions
DAPI  Invitrogen D1306 Contains mounting agent
Goat Serum  Invitrogen 10000C 15%
PBS
Moisture chamber  Scientific Devise Laboratory  197-BL
Chamber slide  Lab-tek  154453
Cover Glasses  Fisher 12-540A
Hydrophobic barrier pen 
Fluorescent microscope  594 nm at 20X magnification. 
Western Blotting 
Distillied Water 
Hand Homogenizer 
2× Laemmli SDS-loading buffer  0.1 M Tris–HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue 
SDS gels  Bio-Rad  161-1210 5% resolving
SDS gels Invitrogen  Invitrogen, WG1601BOX 3-8%
PVDF membrane  GE 10600021
Methanol
Running buffer (10×)  250 mM of Tris-Base, 1,920 mM of Glycine
Running buffer (1×) 10% 10× buffer, 20% methanol 
0.05% PBS/Tween 20 (PBST)  2,000 ml              
3× 200 ml for washing
PBST/5% milk powder  100 ml
Protein Assay Kit BCA T9650
Tween 20  Sigma  P5927
Urea Sigma  U5378
Beta Mercaptoethanol  Millipore ES-007-E
SDS Sigma L3771
Tris-Acetate Sigma
Tris HCl Sigma T3253
Glycerol Sigma G8773
Loading/sample buffer for Western blotting NuPage Invitrogen NP007
NaCl Sigma S3014
PMSF Sigma P7626
Protease cocktail inhibitor  Roche 11836153001
Cathode Buffer 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer 0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer 0.3 M Tris base + 20% Methanol
desmin antibody  Abcam ab8592
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
ImageJ Software

DOWNLOAD MATERIALS LIST

References

  1. Duchenne, A. The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J. 14, (2), 541-542 (1867).
  2. Zellweger, H., Antonik, A. Newborn screening for Duchenne muscular dystrophy. Pediatrics. 55, (1), 30-34 (1975).
  3. Echigoya, Y., Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 24, 57-68 (2014).
  4. Bushby, R. F., Birnkrant, D. J., et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology. 9, (1), 77-93 (2010).
  5. Eagle, M., Baudouin, S. V., Chandler, C., Giddings, D. R., Bullock, R., Bushby, K. Survival in Duchenne muscular dystrophy: improvements in life expectancy since 1967 and the impact of home nocturnal ventilation. Neuromuscul. Disord. 12, (10), 926-929 (2002).
  6. Heald, A., Anderson, L. V., Bushby, K. M., Shaw, P. J. Becker muscular dystrophy with onset after 60 years. Neurology. 44, (12), 2388-2390 (1994).
  7. Stöllberger, C., Finsterer, J. Worsening of heart failure in Becker muscular dystrophy after non-steroidal anti-inflammatory drugs. Med. J. 98, (4), 478-480 (2005).
  8. Passamano, L., et al. Improvement of survival in Duchenne Muscular Dystrophy: retrospective analysis of 835 patients. Acta Myol. 31, (2), 121-125 (2012).
  9. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, (6), 919-928 (1987).
  10. Koenig, M., et al. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50, (3), 509-517 (1987).
  11. Takeshima, Y., et al. Mutation spectrum of the dystrophin gene in 442 Duchenne/Becker muscular dystrophy cases from one Japanese referral. JHG. 55, (6), 379-388 (2010).
  12. White, S. J., et al. Duplications in the DMD gene. Hum. Mutat. 27, 938-945 (2006).
  13. Yokota, T., Duddy, W., Echigoya, Y., Kolski, H. Exon skipping for nonsense mutations in Duchenne muscular dystrophy: too many mutations, too few patients. Expert Opin. Biol. Ther. 12, (9), 1141-1152 (2012).
  14. Yokota, T., Duddy, W., Partridge, T. Optimizing exon skipping therapies for DMD. Acta Myol. 26, (3), 179-184 (2007).
  15. Magri, F., et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol. 258, (9), 1610-1623 (2011).
  16. Yoshida, H. H., Ishikawa-Sakurai, M. Biochemical evidence for association of dystrobrevin with the sarcoglycan- sarcospan complex as a basis for understanding sarcogly- canopathy. Hum. Mol. Genet. 9, (7), 1033-1040 (2000).
  17. Bies, R. D., Caskey, C. T., Fenwick, R. An intact cysteine-rich domain is required for dystrophin function. J. Clin. Invest. 90, (2), 666-672 (1992).
  18. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2, (1), 90-95 (1988).
  19. Aoki, Y., Yokota, T., Wood, M. J. Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int. 2013, (402369), (2013).
  20. Cirak, V. A. -G., Guglieri, M., et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. The Lancet. 378, (9791), 595-605 (2011).
  21. Goemans, N. M., et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 364, (16), 1513-1522 (2011).
  22. Echigoya, Y., et al. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol Ther Nucleic Acids. 4, (2015).
  23. Hoffman, E. P., et al. Restoring dystrophin expression in Duchenne muscular dystrophy muscle progress in exon skipping and stop codon read through. Am J Pathol. 179, (1), 12-22 (2011).
  24. Aartsma-Rus, A., et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 74, (1), 83-92 (2004).
  25. Aartsma-Rus, A., Kaman, W. E., Weij, R., Tden Dunnen, J., van Ommen, G. J., van Deutekom, J. C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol. Ther. 14, (3), 401-407 (2006).
  26. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109, (34), 13763-13768 (2012).
  27. McClorey, G., Iversen, P. L., Moulton , H. M., Fletcher, S., Wilton, S. D. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13, (19), 1373-1381 (2006).
  28. Sharp, N. J., et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 13, (1), 115-121 (1992).
  29. Shimatsu, Y., et al. Canine X-linked muscular dystrophy in Japan (CXMDJ). Exp Anim. 52, (2), 93-97 (2003).
  30. Nguyen, F., Cherel, Y., Guigand, L., Goubault Leroux, I., Wyers, M. Muscle lesions associated with dystrophin deficiency in neonatal golden retriever puppies. J Comp Pathol. 126, (2-3), 100-108 (2002).
  31. Nakamura, A., Takeda, S. Mammalian models of Duchenne Muscular Dystrophy: pathological characteristics and therapeutic applications. J Biomed Biotechnol. 2011, (184393), (2011).
  32. Yokota, T., et al. A renaissance for anti-sense oligonucleotide drugs in neurology: Exon-skipping breaks new ground. Arch. Neurol. 66, 32-38 (2009).
  33. Aartsma-Rus, A., et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 30, (3), 293-299 (2009).
  34. Yu, X., Bao, B., Echigoya, Y., Yokota, T. Dystrophin-deficient large animal models: translational research and exon skipping. Am. J. Transl. Res. 7, (8), 1214-1231 (2015).
  35. Yin, H., Moulton, H., Betts, C., Wood, M. CPP-directed oligonucleotide exon skipping in animal models of Duchenne muscular dystrophy. Methods Mol Biol. 683, 321-338 (2011).
  36. Moulton, H. M., Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta. 1798, (12), 2296-2303 (2010).
  37. Morcos, P. A., Li, Y., Jiang, S. Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques. 45, (6), 613-614 (2008).
  38. Betts, C., et al. A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Mol Ther Nucleic Acids. 14, (1), e38 (2012).
  39. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5, (8), e12239 (2010).
  40. Yokota, T., et al. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol. 65, (6), 667-676 (2009).
  41. Melacini, P., et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromuscul. Disord. 6, (5), 367-376 (1996).
  42. Guncay, A., Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have we come and what does the future hold. Future Med. Chem. 7, (13), 1631-1635 (2015).
  43. Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Research Council (US) Committee on Pain and Distress in Laboratory Animals. Distress in Laboratory Animals . National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK32658 (1992).
  44. Guide for the Care and Use of Laboratory AnimalsPhysical Restraint. National Research Council (US) Institute for Laboratory Animal Research. National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050 (1996).
  45. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science. 297, 1007-1013 (2002).
  46. Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).
  47. Fairbrother, W. I. 11, Goldstein, P. RESCUE-ESE Web Server. MIT Burge Lab. Available from: http://genes.mit.edu/burgelab/rescue-ese/ (2016).
  48. Yokota, T., Hoffman, E., Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 709, 299-312 (2011).
  49. Jenuth, J. P. The NCBI. Publicly available tools and resources on the Web. Methods Mol Biol. 132, 301-312 (2000).
  50. Yokota, T., et al. Extensive and Prolonged Restoration of Dystrophin Expression with Vivo-Morpholino-Mediated Multiple Exon Skipping in Dystrophic Dogs. Nucleic Acid Ther. (2012).
  51. Summerton, J. E. Endo-Porter: a novel reagent for safe, effective delivery of substances into cells. Ann. N. Y. Acad. Sci. 1058, 62-75 (2005).
  52. Mangram, A. J., et al. Guideline for Prevention of Surgical Site Infection. Am J Infect Control. 27, 97-134 (1999).
  53. Reichman, D. E., Greenberg, J. A. Reducing Surgical Site Infections. A Review . Rev Obstet Gynecol. 2, 212-221 (2009).
  54. Mizuno, H., Nakamura, A., Aoki, Y., Ito, N., Kishi, S., Yamamoto, K., Sekiguchi, M., Takeda, S., Hashido, K. Identification of muscle-specific microRNAs in serum of muscular dystrophy animal models: promising novel blood-based markers for muscular dystrophy. PloS one. 6, (2011).
  55. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 145-154 (2005).
  56. Evans, H., de Lahunta, A. Guide to the Dissection of the Dog. SAUNDERS. (2009).
  57. Girish, V., Vijayalakshmi, A. Affordable image analysis using NIH Image/ImageJ. Indian J Cancer. 41, (47), (2004).
  58. Bearer, E. L., et al. Overview of image analysis, image importing, and image processing using freeware. Current protocols in molecular biology. 14, (2003).
  59. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 24, 145-1454 (2005).
  60. Beroud, C., et al. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 28, 196-202 (2007).
  61. Ferreiro, V., et al. Asymptomatic Becker muscular dystrophy in a family with a multiexon deletion. Muscle Nerve. 39, 239-243 (2009).
  62. Nakamura, A., et al. Follow-up of three patients with a large in-frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci. 15, 757-763 (2008).
  63. Yokota, T., Pistilli, E., Duddy, W., Nagaraju, K. Potential of oligonucleotide-mediated exon-skipping therapy for Duchenne muscular dystrophy. Expert Opin Biol Ther. 7, 831-842 (2007).
  64. Taniguchi-Ikeda, M., et al. Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy. Nature. 478, 127-131 (2011).
  65. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3, 144-176 (2013).
Multi-אקסון דילוג שימוש אנטיסנס קוקטייל של ניוון השרירים הצמוד X לכלבים
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).More

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter