Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Multi-exon Hoppa Använda Cocktail antisensoligonukleotider i Canine X-bunden muskeldystrofi

doi: 10.3791/53776 Published: May 24, 2016
* These authors contributed equally

Summary

Exon hoppa är för närvarande mest lovande behandlingsalternativ för Duchennes muskeldystrofi (DMD). Att utvidga tillämpningen för DMD-patienter och för att optimera stabiliteten / funktion av de resulterande trunkerade dystrofin proteiner, var en multi-exon hoppa tillvägagångssätt och använda cocktail antisensoligonukleotider utvecklats och vi visade system dystrofin räddning i en hundmodell.

Abstract

Duchennes muskeldystrofi (DMD) är en av de vanligaste letala genetiska sjukdomar över hela världen, orsakas av mutationer i dystrofin (DMD) -genen. Exon hoppa använder kort DNA / RNA-molekyler kallade antisensoligonukleotider (AONs) som åter läsramen och producera kortare men funktionella proteiner. Men ansikten exon hoppa terapi två stora hinder: begränsad tillämplighet (upp till endast 13% av patienterna kan behandlas med en enda AON läkemedel), och osäker funktion av stympade proteiner. Dessa frågor togs upp med en cocktail AON strategi. Medan cirka 70% av DMD patienter kan behandlas genom en enda exon hoppa (alla exoner i kombination), kan man eventuellt behandla mer än 90% av DMD patienter om flera exon hoppa med hjälp av cocktail antisens-läkemedel kan realiseras. Hundens X-bunden muskeldystrofi (CXMD) hundmodell, vars fenotyp är mer lik humana DMD patienter användes för att testa system efficACY och säkerhet av multi-exon hoppa av exoner 6 och 8. CXMD hundmodell hamnar en splitsningsställe mutation i intron 6, vilket leder till en brist av exon 7 i dystrofin mRNA. För att återställa läsramen i CXMD kräver flera exon hoppa av exon 6 och 8; Därför är CXMD en bra medelstort djurmodell för att testa effekten och säkerheten av multi-exon hoppa. I den aktuella studien var en cocktail av antisens morpholinos inriktade exon 6 och exon 8 utformade och det restaurerade dystrofin uttryck i kroppsomfattande skelettmuskulaturen. Metoder för transfektion / injektion av cocktail oligos och utvärdering av effekten och säkerheten av multi-exon hoppa i CXMD hundmodell presenteras.

Introduction

Duchennes muskeldystrofi (DMD) är en X-bunden recessiv muskelsjukdom som kännetecknas av progressiv muskelsvaghet, som först beskrevs av Dr Guillaume-Benjamin-Amand Duchenne (de Boulogne) 1. DMD är en vanlig genetisk sjukdom som drabbar omkring 1 i 3500 pojkar runt om i världen, med cirka 20.000 drabbade barn som föds varje år 2,3. Den motoriska utvecklingen är försenad och gångrubbningar ses i tidig barndom 4, följt av rullstolsberoende på om de tidiga tonåren. Döden inträffar oftast mellan åldrarna 20 och 30 på grund av andnings eller hjärtsvikt 5-8. Det finns idag inget botemedel för DMD. Behandling med glukokortikoider kan bromsa utvecklingen av muskeldegeneration till viss del, men är förknippad med betydande biverkningar, inklusive fetma och diabetes mellitus 2,7,8. DMD är resultatet av mutationer i dystrofin (DMD) genen, vilket leder till en förlust av funktionell dystrofin protein. DMD är en extremt stor gen med över 2 miljoner baspar och 79 exoner 9,10. Radering, nonsens, och dubbel mutationer som leder till out-of-frame mutationer är den vanligaste orsaken till DMD-fenotypen. De regioner i exonerna 3 - 9 och exoner 45 - 55 benämns "mutations hotspots" eftersom de flesta patienter har deletionsmutationer inom dessa delar av genen, vilket leder till icke-funktionella dystrofin i DMD-patienter 3,9,11-16. Dystrofin funktioner inom dystrofin-glykoprotein komplex (DGC), som har en viktig roll i muskelmembranstabilisering. N- och C-terminalerna är de viktigaste områdena för funktion, medan den centrala stången domänen spelar en mindre viktig roll 3,9,17. Iakttagandet av en mild fenotyp samband med Beckers muskeldystrofi (BMD), som främst härrör från i-ram mutationer i DMD-genen, inspirerade tillämpningen av exon hoppa för behandling av DMD. BMD patienter har en förkortad, men functional, dystrofin-protein som bibehåller både termini 3,6,18. Exon hoppa, i teorin, kan återställa läsramen, vilket resulterar i kortare-men-funktionella dystrofin proteiner som liknar de som ses i BMD 3,19.

Flera typer av antisensoligonukleotider (AONs) har testats i kliniska prövningar, inklusive 2'O-metylerade fosfortioater (2'OMePS) och fosforodiamidat morfolinooligomerer (PMOS). Hoppa över exonerna 51 och 53 med hjälp av dessa AONs har undersökts och medan resultaten är lovande, har en enda exon hoppa begränsad användbarhet, eftersom det är mutationsspecifik 3, 19, 20,21, 22-26. Frågor kvarstår även om stabiliteten hos de erhållna förkortade dystrofin protein från en enda exon hoppa 22,23. Dessutom kan vissa patienter kräver mer än en enda exon som ska hoppas för att återställa läsramen 3. Även tekniskt svårare, är multi-exon hoppa en metod somkan ta itu med dessa problem 3,19. Multi-exon skipping har tidigare visats i dystrofisk hund och humana cellinjer in vitro. Dessutom har mdx52 mus och hund X-länkad muskeldystrofi (CXMD) hundmodeller använts för in vivo-studier 22, 24-27. Canine X-bunden muskeldystrofi Japan (CXMD J) beaglar användes här, eftersom läsramen för CXMD J kan återställas genom multi-exon hoppa av exoner 6 och 8, eller ytterligare exoner (t.ex. exoner 3-9) (figur 1). Beagle-baserade CXMD delar samma mutation mönster som Golden Retriever muskeldystrofi (GRMD) modell, men beaglar är mindre och billigare att underhålla på grund av sin kroppsstorlek, vilket ger en användbar modell för DMD 28,29. CXMD hundar härma närmare den humana DMD-fenotypen än mindre djurmodeller, som gnagare, och är mer tillförlitliga för toxikologiska bedömningar 3,22,30,31 (Figur 2). CXMD hundar visar progressiv muskel förfall, gångrubbningar och hjärt- och andningsproblem som liknar de som ses i DMD. Jämfört med en enda exon hoppa, är multi-exon hoppa som gäller för en mycket större andel av patienterna. Bland de tre vanligaste mutationstyper (deletioner, nonsens, och dubbelarbete), 80 - kunde 98% av patienterna behandlas genom flera exon hoppa 14,32,33, medan 45% av alla DMD patienter kan dra nytta av speciellt hoppa exon 45 - 55 3,19,22,34.

Med utvecklingen av modifierade morpholinos, har effektiviteten av AON cocktails underlätta exon hoppa förbättras. Arginin-rika cellpenetrerande peptid konjugerade PMO (PPMOs), och in vivo-morpholinos (vPMOs) är AON kemi som väsentligt förbättrat cellpenetrerande förmåga och stabilitet 3,35-38. Farhågor kvarstår om långtids AON toxicitet; dock betydande framsteghar gjorts. Kemiska modifieringar som gjorts morpholinos kraftigt minska off-target effekter och prekliniska studier har rapporterat några signifikanta toxiska effekter 3,22,39,40. En kvarvarande utmaning för flera exon hoppa är det nuvarande kravet för varje enskild AON som skall testas för toxicitet ensam, som ett enda läkemedel, i stället för att tillsammans som en cocktail 3,19,22,41,42. I DMD studier med både enkel- och fler exon hoppa riktade till hjärtat, har det varit liten förbättring i dystrofisk hjärtvävnad. Effekten av morpholinos i hjärtat tros vara låg på grund av dålig cellpenetrerande förmåga. Peptid konjugerade PPMOs har förbättrat förmågan hos AONs att penetrera hjärtceller, att öka mängden av funktionellt dystrofin-protein räddas i hjärtat 3,19,38.

Här är vår AON cocktail metod som diskuteras utförligt, inklusive utformningen av AON-sekvenser med hjälp av ESEfinder programvara 43. Protocoler för hund-experiment med fler exon skipping beskrivs också. CXMD J beaglar användes för exonema 6 och 8 hoppa experiment. Multi-exon hoppa i CXMD hundmodell visar lovande resultat, men utmaningar kvarstår som måste övervinnas innan de är kliniskt relevant.

Protocol

Alla protokoll som anges nedan är i enlighet med de riktlinjer som djurvårds anges av National Center of Neurology och psykiatri (NCNP) i Japan. Alla experiment har godkänts av Institutional Animal Care och användning kommitté NCNP.

1. Utformning av antisensoligos

  1. Använd räddnings ESE och ESEfinder program för att upptäcka ESE platser 44, 45-47.
  2. Konstruktion 25 baspar (bp) sekvenser som är antisens till exoner som ska inriktas. Målgrupp exonerna 6 och 8 i hundmodell (Figur 1).
    1. Använd 25 - 30 bp sekvenser för PMO (tabell 1) eller 25 bp för 2'OMePS. Att utforma 25 bp sekvenser väljer sekvenser som ligger inom målområdet. Överväga sekundär struktur, undvikande av heterodimerer, exon skarvning enhancer motiv, och GC-halt för att skapa stabila sekvenser 43. AONs bör rikta åtminstone en av de ESE ställen som identifieras med hjälp av den ovan nämnda software.
    2. Välj AONs med GC-halt som är mindre än 65%, med färre än 4 på varandra följande 'G, och inte innehåller själv komplementära sekvenser. Använd NCBI Blast programvara för att förutsäga off-mål härdningsplatser 22,48,49.
  3. Välj ett lämpligt AON ryggrad kemi. För in vitro-experiment använder 2'O-metyl-oligonukleotider (2'OMePS) eller morpholinos. För in vivo experiment, använder 2'OMePS, morpholinos eller vPMOs. 3,19,48,50

2. In vitro-experiment (exoner 6 och 8 hoppar över i CXMD Model)

  1. 2'OMePS Transfektion av hund myoblaster
    1. Kultur CXMD myoblaster i 3 ml tillväxtmedium i 6-brunnsplattor. Seed 1-5 x 10 3 celler / cm2 med 0,5 ml / cm2 av medium för myoblaster. För tillväxtmediet, använd Dulbeccos modifierade Eagles medium (DMEM) med 10% fetalt bovint serum (FBS) och 1%penicillin / streptomycin (P / S) 40.
    2. Inkubera vid 37 ° C tills 60 till 80% sammanflytande. Detta tar cirka 12 till 24 timmar.
    3. Späd en katjonisk liposom transfekterande medel till totalt 100 pl i reducerad serummedium (2: 1-förhållande transfekterande agent: AONs, t.ex., 10 pl Lipofectin vs. 5 mikrogram AONs). Tillåt blandningen stå vid rumstemperatur under 30 - 45 min.
    4. Späd AONs (2'OMePS eller morpholinos) till en slutlig volym av 100 pl i reducerad serummedium.
    5. Kombinera den utspädda transfektion agent med utspädda AONs och inkubera vid RT under 10 - 15 min.
    6. Medan transfektion agent / AON blandning sitter vid RT, ta bort gamla medier från celler via aspiration och tvätta cellerna med media.
    7. Lägg 0,8 ml media till transfektion agent / AON blandningen och sedan lägga hela lösningen på de färska tvättade cellerna. Inkubera under 3 h vid 37 ° C.
    8. Efter inkubation, byt media med differentiation medier (DM); differentiering kan ta upp till 10 dagar. Kontrollera för att se om differentiering har inträffat med början vid omkring dag 3. differentieringsmedia är DMEM med 2% hästserum, 200 U / ml penicillin, 200 mg / ml streptomycin och 10 | ig / ml insulin.
  2. Morfolino Transfektion av hund myoblaster
    1. Kultur CXMD myoblaster i tillväxtmedium såsom beskrivs i steg 2,1.
    2. Växla till differentieringsmedium (DM), och tillsätt 0,1 mM stam morfolino till varje brunn för att göra den slutliga koncentrationen 1 pM. Värme cocktail morpholinos vid 65 ° C under 10 min före transfektion eller injektion för att undvika AON aggregering. Lägg till en peptid leverans reagens 39,51 och anpassa sig till en slutlig koncentration av 3-6 M.
    3. Efter 16-48 h inkubation, samla celler för RNA-extraktion. Tillsätt 1 ml syra guanidiniumtiocyanat-fenol-kloroform till cellerna för att lösgöra celler från plattan. Utföra RNA extracning efter detta steg.
      1. Alternativt till trypsin så att det täcker alla celler och inkubera i 2 minuter vid 37 ° C.
        Obs: Om avser att utföra immun använder chambered slide glasögon för odling. Efter differentiering, kan celler fixeras med paraformaldehyd (PFA) (4% under 10 minuter).
  3. RNA-extraktion och RT-PCR (RT-PCR)
    1. När cellerna differentieras till myotuber, ta bort medium och tillsätt 1 ml sur guanidintiocyanat-fenol-kloroform; inkubera under 10 min vid RT.
    2. Överföra till 1,5 ml rör. Kombinera med 200 | il kloroform och inkubera vid RT i 2 min tills tre separata skikt kan ses. De tre skikten från toppen till botten är: en RNA-skikt, ett DNA-skikt, och ett proteinskikt.
    3. Centrifugera vid 12000 x g under 15 min vid 4 ° C. Ta bort det översta lagret supernatanten och plats i ett rör med 500 & #181; l isopropanol (om stoppa här, lagra supernatanten vid -80 ° C). Centrifugera supernatanten vid 12000 x g under 10 min vid 4 ° C; efter centrifugering, hålla den resulterande RNA-pelleten och kassera supernatanten.
    4. Tvätta pelleten med etanol och centrifugera vid 8000 xg under 5 min vid 4 ° C. Indunsta rester av etanol genom att vända röret under 15 minuter och tillsätt sedan 15 - 30 | il RNas-fritt vatten. Kvantifiera total RNA-koncentrationen med hjälp av US / VIS-spektroskopi vid 260 nm.
    5. Kombinera de nödvändiga reagens för en RT-PCR-reaktionen: 1,5 pl 10 nM framåt primer, 1,5 pl 10 pM omvänd primer, 1 pl dNTP, 5 pl ett steg PCR-kit buffert, 0,7 pl RNas inhibitor, 1 pl enzymblandning från en- steg PCR-kit, och 200 ng av RNA. När dessa har blandats, tillsätt vatten till en slutlig volym av 25 | il.
    6. Placera blandningen i en termocykelapparat. Köra en 30 min cykel vid 50 ° C, en 15 min0; cykel vid 95 ° C, därefter 35 cykler vid 94 ° C under 1 min, 60 ° C under 1 min och 72 ° C under 1 min. Slutligen kör en 10 min cykel vid 72 ° C. Store PCR-produkten i ett kylskåp vid 4 ° C eller -20 ° C
  4. Komplementärt DNA (cDNA) Sekvensering
    1. Identifiera exon 6-9-hoppade band med hjälp av agarosgelelektrofores. Last 5 | il av varje prov i brunnar i en 1,5% agarosgel, köra 135 V genom gelén under 5 minuter, och sedan 120 V under 20 min. Därefter inkubera gelén i DNA-gel fläcken vid RT i 30 min. Visualisera banden med hjälp av bildbehandlingsprogram.
    2. Skära ut bandet av intresse med användning av ett gelextraktionskit.
      1. Skära ut DNA-fragment och lösa gelen segment med hjälp av 200 ^ NTI / 100 mg gel. Låt detta stå i 5-10 min i en 50 ° C vattenbad. Sedan överföra till kiseldioxid membranröret.
      2. Centrifugera vid 11.000 xg under 30 sek. Tvätta två gånger med 700 pl NT3 buffert innan centrifuging igen vid 11.000 xg under 30 sek.
      3. Torka kiseldioxiden membranet genom centrifugering vid 11.000 xg under 1 min.
      4. Lägg 15-30 pl NE buffert och låt det sitta vid RT under 1 minut. Sedan centrifugera vid 11.000 xg under 1 minut. Avlägsna silikagel och hålla innehållet i röret.
    3. Använda en sekvenseringssats för att bestämma sekvensen enligt tillverkarens protokoll.

3. intramuskulär injektion eller Open muskelbiopsi

  1. För underhåll av sterila förhållanden under överlevnad kirurgi, ta bort hår med hjälp av Clippers i området kring operationsstället (bakbenet). Använd jodoforer eller klorhexidin som ett desinfektionsmedel. Använd sterila draperier för operationsområdet genom att placera och fästa dem över hela djuret och operationsbordet.
    1. Bära rena skurar, ansiktsmasker, huvudbonad, sterila handskar och speciella skor för operationssalen 52,53.
    2. </ Ol>
    3. Injicera CXMD hundar med 20 mg / kg av tiopentalnatrium att söva dem. Använd veterinär salva på ögonen för att förhindra att ögonen blir uttorkade.
    4. Använd 2-3% isofluran inandning för att upprätthålla allmän anestesi (Figur 3). Kontrollera muskel reflexer och övervaka hjärta och andning för att bedöma djupet av anestesi. Den normala andningsfrekvens (RR), hjärtfrekvens (HR), och SpO 2 under narkos är följande: RR: 10 - 20 andetag / min; SpO 2: 95-100%, HR: 80 - 120 slag per minut (bpm).
    5. Med hjälp av en skalpell, skära in i huden över hjärnskenbens (CT), även känd som tibialis anterior (TA), och göra ett enda snitt ca 5 cm i längsled (för unga vuxna hundar). Att markera injektionsstället, sy den djupa fascia med hjälp av en kirurgisk nål och kirurgisk tråd och göra två stickmarkörer på 2 cm intervall.
    6. Injicera den önskade koncentrationen av AONs i muskeln med en 27 G-nål. Den önskade koncenttration varierar mellan behandlingsförhållanden. För CT, ge två injektioner av en ml volym vardera, för totalt 1,2 mg cocktail PMO (0,4 mg varje PMO) eller 0,4 mg cocktail vPMOs (0,13 mg varje vPMO). För extensor carpi ulnaris (ECU) frambens muskler, injicera två volymer 0,5 ml vardera för totalt 1,2 mg cocktail PMO (0,4 mg varje PMO) eller 0,4 mg cocktail vPMOs (0,13 mg varje vPMO). Lämna nålen i 1 min. Använd en lika stor mängd av varje AON för cocktail.
    7. Utför öppen muskelbiopsi genom att ta bort en bit av muskelvävnad ca 2 cm i längd från CT muskler med hjälp av en kirurgisk skalpell.
    8. Gå till steg 6,5 för muskel provberedning.
    9. Med hjälp av en nål, administrera en intramuskulär injektion av 0,02 mg / kg buprenorfin hydroklorid före uppvaknande från narkos. Lägg muskel fascia och hud tillbaka över muskler och sy dessa med en 3-0 absorberbar tråd och 3-0 nylontråd för muskel fascia och hud stängning, respektivEly.
    10. Håll munnen öppen, avgöra om kräkreflexen har återvänt; när kräkreflexen har återvänt, extubera hunden.
    11. Administrera 15-30 mg / kg cefazolin eller cephalexin (antibiotika) för upp till tre dagar via intravenös eller intramuskulär injektion för att förhindra infektion.
    12. Ta bort suturer inom sju dagar. Lämna inte hunden utan tillsyn tills den har återfått tillräcklig medvetenhet för att upprätthålla sternala VILA och inte låta hunden att interagera med andra djur till dess att en fullständig återhämtning sker. Hålla de endotrakeala tuber på plats så länge som möjligt och ta bort dem när djuret börjar att tugga eller svälja. Övervaka djurets hjärtfrekvens, andning, och fukt till att se till att de är stabila och inom normala gränser.
    13. För efter kirurgi vård, ge smärtlindring under 3 dagar (t.ex. buprenorfin 0,01 mg / kg) och omvårdnad support, inklusive en tyst, mörkt viloplats, lämplig sår och bandage underhåll, en mjukviloyta, rehydrering med orala eller parenterala vätskor, och en återgång till normal matning med hjälp av mycket välsmakande livsmedel eller behandlar. Om några djur kräver ytterligare medicinering, ge en intramuskulär injektion av 0,3 mg / kg av butorfanoltartrat beroende på smärta symptom.
      Obs: Hundar i smärta kan bita, scratch, eller vakta smärtsamma områden, och om den hanteras, kan vara ovanligt orolig eller aggressiv. Dessutom, smärta i ett ben resulterar vanligtvis i haltande eller hålla upp den drabbade extremiteten med försök att använda det. I sådana situationer, ge en intramuskulär injektion av 0,02 mg / kg av buprenorfinhydroklorid varje 6-8 h.

    4. Systemiska Injektioner

    Obs: Denna procedur kan upprepas varje vecka eller varannan vecka för önskat antal veckor.

    1. Hålla hundar manuellt och försiktigt genom att få hunden att ligga ner och sedan drapera armarna över axlar och höfter för att hålla hunden på plats under than förfarande.
    2. Injicera AONs; 120 - 240 mg / kg cocktail PMO (40 - 80 mg vardera AON) med användning av en venös kvarliggande nål i en lem ven (känd som en cefalisk eller en vena saphena). Mängden AON injiceras beror på den experimentella villkor. Använd en lika stor mängd av varje AON för cocktail.
    3. Använda en infusionspump eller spruta föraren att injicera 50 ml totalt med en hastighet av 2,5 ml / min under 20 min, i enlighet med tillverkarens instruktioner. Upprepade injektioner varje vecka eller varannan vecka (varannan vecka) åtminstone 5 gånger, som dystrofin uttrycket ansamlas med upprepade injektioner.
    4. Blodprov varje vecka för att undersöka toxicitet.
      1. Med hjälp av en nål, samla 3 ml blod - 0,5 ml för fullständig blodstatus (CBC) och 2,5 ml för andra - från en av de subkutana vener i fören eller bakdelen. Inkludera CBC, gamma-glutamyltransferas (GGT), aspartataminotransferas (AST), urea (BUN), alanin aminotransferase (ALT), kreatinkinas (CK), och bedömningar kreatinin när man testar det insamlade blodet, enligt tillverkarens anvisningar från blod testkit. 40,54

    5. Klinisk Bedömning av hundar

    1. Ställ upp en videokamera och spela in hund beteende och gång. Spela in hela mötet med hunden eftersom detta kommer att fungera som en referens när gradering hunden; Detta innebär varje video kommer att bli en annan längd beroende på hundens förmåga och vilja. Använda standardinspelningsparametrar. Filma skapar ett register över graderingen så att den kan granskas vid ett senare tillfälle.
    2. Grade gång och rörelsestörningar.
      1. För gång och rörelsestörningar, använd följande kvaliteter:
        grad 1 = ingen, klass 2 = sitter med bakbens förlängas, klass 3 = kanin-humle med bakbenen, grad 4 = blanda promenad, och grad 5 = oförmögen att gå.
      2. För rörlighet störningar, använd följande kvaliteter: klass 1 = ingen, grade 2 = liggande mer än normalt, klass 3 = kan inte hoppa på bakbenen, grad 4 = allt svårare att röra sig, och grad 5 = inte kan få upp och flytta runt.
    3. Hur lång tid det tar hunden att köra 15 meter. Mät ut 15 m, placera hunden vid startlinjen och uppmuntra den att köra tills 15 m märket.
    4. Bestäm muskelatrofi av extremiteten enligt följande betygsskala:
      grad 1 = ingen, klass 2 = misstänkt hårdhet, klass 3 = kan känna hårdhet eller verkar tunna, betygs 4 = mellan betygen 3 och 5, och grad 5 = extremt tunna eller hårt.
    5. Grade dreglande enligt följande skala: klass 1 = ingen, klass 2 = ibland droppar saliv när man sitter, grad 3 = några dregla när man äter och dricker, grad 4 = strängar av dregla när man äter eller dricker, och grad 5 = kontinuerlig dregla.
    6. Grade hypertrofi av tungan (macroglossia) enligt följande skala: klass 1 = ingen, klass 2 = något förstorad, klass 3 = förlängd outside tänder, grad 4 = förstorad och något tjockare, och grad 5 = förstorad och tjocknat.
    7. Grade hundens förmåga att svälja användning av följande skala: klass 1 = inga svårigheter, klass 2 = tar tid och kraft på att ta mat, klass 3 = svårt att ta mat från en tallrik, grad 4 = svårigheter att tugga, svälja eller dricka och klass 5 = inte kan äta.
    8. Beräkna totalbetyget genom att addera poängen från varje kategori (med undantag för 15 m kör test) 55.
      Obs: Studierna ska förblindas för att inte införa partiskhet.

    6. Magnetic Resonance Imaging (MRI)

    1. Använd en 3 Tesla (3T) MRT och 18 cm i diameter / 18 cm lång mänsklig extremitet spole för att erhålla T2-viktade bilder av hind-lemmar.
    2. Söva djuren genom att injicera CXMD hundar med 20 mg / kg av tiopental. Använd veterinär salva på ögonen för att förhindra att ögonen blir uttorkade. Använd 2-3% isofluran inandning för att upprätthålla narkos.
      1. Kontrollera muskel reflexer och övervaka hjärta och andning för att bedöma djupet av anestesi. Den normala andningsfrekvens (RR), hjärtfrekvens (HR) och SpO 2 under narkos är följande: RR: 10 - 20 andetag / min, SpO 2: 95-100%, HR: 80 - 120 slag per minut (bpm ).
    3. Använd följande inställningar för att få T2-viktade bilder: TR / TE = 4000/85 ms, skivtjocklek = 6 mm, skiva gap = 0 mm, synfält = 18 cm x 18 cm, matris size = 256 x 256, och antal förvärv = 3 under snabb spin eko (Figur 4).

    7. Muscle Provtagning och beredning (obduktion)

    Obs: Muskler ska provtas en eller två veckor efter den sista AON injektionen.

    1. Injicera hundar med 20 mg / kg av tiopentalnatrium att söva dem. Använda veterinär salva på ögonen under anesthetization att förhindra uttorkning av ögonen.
    2. Använd 2-3% isofluran inandning för att upprätthålla anesThesia. Kontrollera muskel reflexer och övervaka hjärta och andning för att bedöma djupet av anestesi. Den normala andningsfrekvens (RR), hjärtfrekvens (HR) och SpO 2 under narkos är följande: RR: 10 - 20 andetag / min; SpO 2: 95-100%, HR: 80-120 bpm.
      1. Avliva hundar vid blodtömning under narkos (för endast obduktion). Använd blodtappning enligt bedövning för att undvika de effekter som orsakas av blodbaserade faktorer i molekylär analys (t.ex. hjärtmuskler).
    3. Dissekera följande muskler (Figur 5): CT, extensor digitorum longus (EDL), gastrocnemius, soleus, biceps femoris, rectus femoris, biceps brachii, triceps brachii, delta ecu, extensor Carpi radialis (ECR), flexor carpi ulnaris (FCU ), flexor Carpi radialis (FCR), gracilis, intercostal, magmusklerna, diafragma, lateral dorsi, matstrupe, sternocleidomastoideus och hjärta. För att undersöka toxicitet, samla njure och liVer prover. Använd Evans och Alexander de Lahunta (2009) som en referens för dissektion teknik 56.
    4. Skär CT, EDL, gastrocnemius, soleus, biceps femoris, rectus femoris, biceps brachii, triceps brachii, delta ecu, ECR, FCU, FCR, gracilis, intercostal, magmusklerna, lateral dorsi, matstrupe, sternocleidomastoideus, hjärta, njure, och lever i små delar cirka 1-1,5 cm i längd. Vrid membranet upp och sedan skär den i 1 - 1,5 cm avsnitt 56.
    5. Placera dragantgummi, så att den är ungefär 0,5 - 1 cm tjock på korkskivor. Etikett skivor med djurets identifiering och muskel namnet på den motsatta sidan av dragantgummi.
    6. Placera muskler med sin längdaxel vinkelrät mot korken i den dragantgummi.
    7. Placera korkarna i en behållare med isopentan som sitter i flytande kväve. Flytta runt hela tiden med pincett för en min eller tills den är helt frusen. Lagra muskler på korkari flaskor vid -80 ° C. Vid transport, sätta flaskorna på torris.
    8. Förbered glas märkta med djuridentifierings / muskel namn och datum.
    9. I kyls en kryostat till -25 ° C, montera korken till stativet. Ställa in snittjockleken till den önskade nivån. Använd 8 pm för immunohistokemi och 12 pm för hematoxylin och eosin (HE) färgning. Använd 15 pm för Western blot prover. Trim ungefär en fjärdedel av muskeln för att få en platt muskel för korrekt muskel provtagning.
    10. Cutting en del av muskeln vid en tidpunkt, plats var 6: e avsnittet om samma glasskiva om planerar att använda prover för immunohistokemi eller HE-färgning. Om du använder prover för Western blöts, satte 30 - 40 avsnitt i ett rör och förvara vid -80 ° C.
    11. Efter framställning av diabilder, låt diabilder torka i 1,5 timmar vid rumstemperatur. Store glider vid -80 ° C.

    8. Immunohistokemi

    1. Ta förberedda diabilder från lagring och placera dem ien fuktkammare för att hålla objektglasen separerade och bibehålla fukt. Fylla fuktkammaren så att botten precis täcks med vatten (cirka 1 mm vatten).
    2. Lufttorka i 0,5 timmar. Rita en kvadrat som omsluter muskelprov på bilden med hjälp av en hydrofob barriär penna.
    3. Lägg 15% getserum i fosfatbuffrad saltlösning (PBS) och inkubera i 2 h vid RT I blockeringsreagens.
    4. Lägga anti dystrofin stavdomän (Dys-1) mus-monoklonal primär antikropp, eller C-terminala monoklonal antikropp (Dys-2) för hund dystrofin färgning (1: 150 utspädning). Späd med användning av ett blockeringsmedel i 1,25 ml PBS. Inkubera O / N i kylskåp ett 4 ° C.
    5. Tvätta med PBS under 5 min, upprepades tre gånger. Lägg sekundär antikropp Alexa 594 getantikropp mot mus lgG1 (för DYS-2) eller IgG2 (för DYS-1) (1: 2500). Späd med ett blockeringsreagens i PBS innehållande 0,1% oktylfenol-etoxylat. Inkubera i 0,5 h vid RT.
    6. Tvätta med PBS under 5 min, tre tIME. Låt bilden för att torka. Tillsätt 1 - 2 droppar (3 ng / ml) av 4 ', 6-diamidino-2-fenylindol (DAPI) monteringslösning. Med hjälp av pincett, placera ett glas glida över toppen av sektioner, undvika bubblor.
    7. Visa dystrophin- (Dys-1 / DYS-2) positiva fibrerna under ett fluorescerande mikroskop vid 594 nm vid 20X förstoring.

    9. Western Blotting

    1. Lägg insamlade muskelsektioner från Cryo-sektionering till 150 pl provbuffert på is.
    2. Användning av en handhomogenisator, i korthet homogenisera de proteinprover. Värme prover i ett 1,5 ml rör i värmeblock inkubator vid 95 ° C under 3-5 min. Centrifugera vid 16500 x g under 15 min och samla in supernatanten.
    3. Lagra alikvoter av supernatanten vid -70 ° C. Använd destillerat vatten för att späda till 100x.
    4. Bestämma proteinkoncentration med användning av ett kommersiellt kit enligt tillverkarens protokoll. Lägg till 2x Laemmli SDS-laddningsbuffert till prover och värme i 3 minuter och# 160; vid 95 ° C.
    5. Belastningsprover till 3-8% Tris-acetat gel innan du kör den i 3 timmar vid 150 V. Inkludera flera utspädd vildtyp (WT) prover (t.ex. 1%, 10% och 50%) för kvantifiering. Mindre än 1% WT nivåer av dystrofin ska påvisas med denna metod.
    6. Placera gelén i katodbuffert under 20 min. Under denna tid, ta nio bitar av filterpapper och sätta dem i överföringsbuffertarna (3 papper i katodbufferten [+], anoden buffert ([-], och den koncentrerade anod buffert [-], respektive) här. beskriver en halvtorr överföringsmetod som ökar känsligheten (Figur 6).
    7. Blöt en PVDF-membran i metanol under 20 sekunder och sedan placera i anoden bufferten.
      Inrättat gelén med membranet för halvtorr överföring och tillåta den att köra 1,5 h vid 400 mA i RT eller i ett kallt rum.
    8. Tvätta membranet med PBS. Inkubera membranet i en blandning av PBS med Tween 20 (PBST) och 5% mjölkpulver för 2 timmar.
    9. Späd DYS-1 (primär antikropp) i PBST och 5% mjölkpulver blandningen till en 1: 100 spädning. Lägg det till membranet och låt den inkubera i minst en timme. Tvätta tre gånger med 100 ml PBST under 15 min vardera.
    10. Lägg 65 | j, l / lane av HRP-konjugerad sekundär antikropp (anti-mus IgG2a för DYS1) vid 1: 5000 spädning under 1 h vid RT i ett mörkt område. Då, tvätta med tre gånger med 200 ml PBST under 20 min. Blanda lösningar från en detekteringssats enligt anvisningarna. Inkubera under 1 min.
    11. Utveckla film för att upptäcka band och analysera med ImageJ programvara 48,57,58.

Representative Results

Experiment in vitro

Myoblaster transfekterades med olika 2'OMePS behandlingsförhållanden för att jämföra effektiviteten hos varje AON. Enkel AON behandlingar med 600 nM vardera av Ex6A, Ex6B, Ex8A eller Ex8B utfördes, såväl som en cocktail behandling med 600 nM vardera av alla 4 AON sekvenser. RNA-prover samlades upp fyra dagar efter transfektion. Efter RT-PCR, prover för varje behandling kördes på en gel tillsammans med icke-behandlade (NT) prover. Band högre på gelén representerar out-of-frame DMD produkter; dessa band sågs i NT, Ex8A och Ex8B behandlade myoblaster. Ex6A, Ex6B, Ex8A och cocktailbehandlade myoblaster visade i-frame produkter. Cocktail och Ex6A / B visade 100% i-ram produkter, medan Ex8A visade endast 30% i-frame produkter (Figur 7). För att bekräfta exon hoppa och restaurering avläsramen, var cDNA-sekvensering utfördes; resultaten visade att exonerna 6-9 verkligen hade hoppat (Figur 7). Immunohistokemi visade att AON-behandlade hundar hade ökat dystrofin-positiva fibrer jämfört med NT prover (Figur 8).

Experiment in vivo

Att jämföra effektiviteten hos olika AON behandlingsförhållanden, CXMD hundar - var (0,5 5 år gamla) injiceras en gång med 1,2 mg Ex6A eller en cocktail av Ex6A, Ex6B och Ex8A vid olika doseringar. Två veckor efter injektionen togs muskelprover uppsamlades och färgades med DYS-1 för att jämföra antalet dystrofin-positiva fibrer. Alla cocktail-behandlade prov visade ökad dystrofin uttryck jämfört med NT prover. Dystrofin-positiva fibrer ökade med AON dosering (Figur 9). efter systemetic injektion, var vildtyp (WT), NT, och cocktail behandlade CXMD muskelprover färgades med DYS-1 (figur 10). Cocktail-behandlade CXMD hundar visade ökad dystrofin uttryck jämfört med NT CXMD hundar, både i CT och hjärtmuskelprover. Men AON behandlad skelettmuskulatur (CT) visade mycket högre uttryck av dystrofin jämfört med behandlad hjärtmuskeln. En immunoblot som jämför WT, NT, och olika morfolino cocktail-behandlade muskler ledde till samma slutsats. Det fanns också ett stort utbud av dystrofin uttryck i de behandlade skelettmuskelprover (Figur 10). Hematoxylin och eosin (HE) färgning visade att behandlad CXMD hundar visade förbättrad histopatologi, med en betydande minskning av centralt kärn fibrer (CNF) i jämförelse med NT CXMD hundar (Figur 11). Detta indikerar att det finns mer degeneration / regeneration förekommer i NT hund, ett tecken på dystrofisk muskler patologi. Dessutom behandlade hundar hade snabbarekör gånger och förbättrade poäng på den kliniska betygsskalan. Behandlade CXMD hundar visade bättre resultat än NT CXMD hundar i alla kategorier (Figur 12).

Figur 1
Figur 1. Mutation Mönster av CXMD hund och Exonerna 6 -. 8 Hoppa över strategierna genom en antisens Cocktail CXMD hundar har en punktmutation i exon 6 leder till en förlust av exon 7 i dystrofisk hund mRNA. Detta resulterar i mRNA som är ut-av-ram och dystrofin proteinproduktion är förlorad. Korta AON sekvenser är utformade för att binda till exon 6 och 8, vilket resulterar i mRNA-splitsning effektivt hoppa exonema 6 - 8. Den grå stapeln i AON cocktail-behandlade hundar representerar korta AON sekvenser. Exon 9 kodar en gångjärnsdomän och är ibland spontant splitsas ut med AONs mot exon 6 och 8. De resulterande mRNA kodar för dystrofin proteiner som är kortare men funktionenal. Klicka här för att se en större version av denna siffra.

figur 2
Figur 2. Stora kliniska symptom på en 1-årig Canine X-bunden muskeldystrofi (CXMD) Animal. A 1-årig vildtyp beagle och en CXMD hund visas. Medverkan av proximala, lem, och tids muskler typiskt observeras från 2 månaders ålder. Gemensamt kontraktur och en förskjutning av bäckenet är öppen från 4 månaders ålder. Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3. narkos en hund. A) Intramuscular injektioner och muskelbiopsier utförs under narkos med isofluran. B) Innehav av djur för system injektioner. Klicka här för att se en större version av denna siffra.

figur 4
Figur 4. Magnetic Resonance Imaging (MRI) av vildtyp, icke-behandlade CXMD och behandlades CXMD. MRT av bakbenet vid 3 månader och 5 månader i WT och NT CXMD hundar. Två exempelbilder av behandlade CXMD bakbenen MRI för- (1 vecka före den första injektionen) och efter injektion av AON visas. 2703MA behandlades 7x varje vecka med 200 mg / kg cocktail morpholinos. 2001MA behandlades med 5x vecka intravenös injektion av 120 mg / kg cocktail morpholinos. Kontroll och behandlade hundar var åldersmatchade. Behandlade hundar visar minskad T2 signaler. Bilder är ADAP Ted med tillstånd från Yokota et al. (copyright 2009, John Wiley & Sons) 40 Klicka här för att se en större version av denna siffra.

figur 5
Figur 5. muskelbiopsi ordningen för en hund. A) En nedre extremiteterna fastställs för muskelbiopsi. B) Med hjälp av pincett, är den nedre extremiteten hållas. C) CT muskeln utsätts. Öppen biopsi teknik används för att erhålla muskelprover av injicerade platser. Trådar används för att hålla biopsiprov. D) Muscle prov på dragantgummi efter dissekering. Klicka här för att se en större version av denna siffra.

/53776/53776fig6.jpg "/>
Figur 6. Halvtorr överföringsmetod. En representation av den halvtorra överföringsmetod för Western blotting presenteras. Tre papper indränkt i koncentrerad anod buffert fastställs vid minuspolen; 3 papper indränkt i anod buffert staplas ovanpå detta. Den Mb PVDF papper är indränkt i metanol och därefter anod buffert innan de lägges ovanpå de 6 papper. Gelén, som har dränkts in med katodbuffert, lägges försiktigt över den PVDF-papper. Slutligen 3 papper indränkt i katodbufferten läggs ovanpå gelén. Den positiva terminalen är inställd på toppen. För en timme, 400 mA drivs genom systemet. Klicka här för att se en större version av denna siffra.

figur 7
Figur 7. Exon Hoppa i CXMD myoblaster. et al. (Copyright 2009, John Wiley & Sons) 40. Klicka här för att se en större version av denna siffra.

Figur 8
Figur 8. Ökad Dystrophin Expression i 2'O-metylerade fosforotioat (2'OMePS) transfekterade CXMD myoblaster. CXMD myoblaster transfekterades med Ex6A ensam eller med cocktail 2'OMePS. DYS-2 (röd) och DAPI (blå) färgning visas. De behandlade myoblaster jämförs med vildtyp (WT) och icke-behandlade (NT) myoblaster. Bilderna anpassas med tillstånd från Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 50 pm. Klicka god här för att se en större version av denna siffra.

figur 9
Figur 9. Räddning av dystrofin Expression med intramuskulära injektioner av Morpholinos i CXMD Dogs. Antingen Ex6A enbart eller en cocktail av Ex6A, Ex6B och Ex8A injicerades i CT-musklerna i CXMD hundar. Dystrofin (DSY-1) färgning av vildtyp(WT), icke-behandlade (NT), och behandlade CXMD hundar visas. Hundar behandlades antingen med 1,2 mg Ex6A enbart eller 1,2 mg cocktail. Bilderna anpassas med tillstånd från Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 100 nm. Klicka god här för att se en större version av denna siffra.

Figur 10
Figur 10. Ökad dystrofin Expression Efter Systemisk Cocktail Morfolino Behandling i CXMD Dogs. Dystrofin (Dys-1) färgning användes för att jämföra dystrofin expression i vild typ (WT) (positiv kontroll), icke-behandlade (NT) (negativ kontroll), och CXMD hundar som behandlats med 120 mg / kg morfolino cocktail (40 mg / kg av varje AON). Morpholino cocktail innehöll Ex6A, Ex6B och Ex8A. Hundar injicerades intravenöst 5 gånger viekly med denna cocktail. A) En jämförelse av dystrofin uttryck i hjärn tibial (CT) musklerna i WT, NT, och behandlade hundar. B) En jämförelse av dystrofin uttryck i hjärtvävnaden mellan NT och morfolino cocktail-behandlade hundar. C) Immun för dystrofin med desmin som en laddningskontroll visas för WT, NT, och morfolino cocktail-behandlade hundar. Följande muskler visas för behandlade hundar: triceps brachii (TB), biceps brachii (BB), membran (DIA), matstrupe (ESO), CT, adductor (ADD), extensor digitorum longus (EDL), tugg (MAS), och hjärta. Bilderna anpassas med tillstånd från Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 200 pm. Klicka god här för att se en större version av denna siffra.

Figur 11
Figur11. Förbättrad Histopatologi i CXMD hundar som behandlats i 7 veckor med 240 mg / kg morfolino Cocktail. CXMD hundar som sträcker sig från ett halvår till fem år gamla injicerades intravenöst med 240 mg / kg morfolino cocktail (Ex6A, Ex6B och Ex8A) en gång vecka i 7 veckor. Fjorton dagar efter den sista injektionen, var matstrupe muskler tas och hematoxylin och eosin (HE) färgning gjordes. HE färgning av matstrupe muskler från icke-behandlade (NT) och morfolino cocktail behandlade (Behandlade) CXMD hundar (40X objektiv). Klicka här för att se en större version av denna siffra.

Figur 12
Figur 12. Förbättrade Poäng på klinisk klassificering och 15 m Längd Efter morfolino behandling. Morfolino-behandlade hundar jämfördes med icke-behandlade (NT) kulls. Felstaplar i grafen visar SEM. A) Total poäng på kliniska betygsprov beräknades före och efter behandlingen och behandlade djur jämfördes med NT syskon. B) En jämförelse av 15 m körtider av behandlade och NT hundar. C) I likhet med B; emellertid var yngre hundar användes. Bilderna anpassas med tillstånd från Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Klicka här för att se en större version av denna siffra.

Antisens-oligonukleotid nukleotidsekvens
Ex6A GTTGATTGTCGGACCCAGCTCAGG
Ex6B ACCTATGACTGTGGATGAGAGCGTT
Ex8A CTTCCTGGATGGCTTCAATGCTCAC

Tabell 1. antisensoligonukleotid design.

Discussion

Exon hoppa är en lovande terapeutisk teknik för behandling av DMD. Både in vitro och in vivo experiment har visat att flera exon hoppa är genomförbart. Här, är användningen av den CXMD hundmodell diskuteras. Först var AONs utformade med hjälp av Rescue-ESE och ESEfinder program för att rikta dystrofin exon 6 - 8. 2'OMePS AON kemi användes för CXMD myoblast transfektion och morpholino AON ryggraden kemi valdes för in vivo experiment. vPMOs är effektivare än omodifierade PMO, men på grund av deras högre toxicitet att de inte är lämpliga för systemiska injektioner. RNA-extraktion, RT-PCR, och cDNA-sekvensering utfördes på de CXMD myoblaster. Hundar som injicerats med PMO cocktail var kliniskt graderade att bedöma någon förbättring i kliniska symptom. Efter hundarna humant avlivas, var muskelprover tas och beredas för Cryo-sektionering. Halveringstiden av dystrofin protein som induceras av AONS tros vara ca 1 - 2 månader. Unga vuxna hundar användes i denna studie, även om dessa experiment kan göras med neonatala hundar och äldre hundar (> 5 år gamla). Beredda muskel sektioner användes för att utvärdera histopatologi och bedöma dystrofin protein räddning genom Western blotting och immunohistokemi 48.

Det är viktigt att se till att volymen av PMO lösning är korrekt innan injektioner; underlåta att göra detta kommer att ha en betydande inverkan på resultatet. Under intramuskulära injektioner är tillräckligt tryck som krävs för att komma in i muskelfibrerna. Övervakning av hundens hälsa och kontroll av operationsstället är viktiga för felsökning. Att övervaka djurs hälsa bör vecko tester och väger blod utföras. Efter eutanasi av djuret och beredning av muskelprover, är ett kritiskt steg för att säkerställa känslighet vid detektion av dystrofin protein för att använda både Tris-acetat gel och halvtorr blotting-metodenunder Western blotting.

Såsom visas i de representativa resultat, myoblaster behandlades med Ex6A, Ex6B, Ex8A, och cocktail (innehållande Ex6A, Ex6B, Ex8A och Ex8B) som produceras i-frame DMD produkter. Eftersom Ex8B gav inga exon-hoppade produkter, var det inte i efterföljande in vivo experiment. cDNA-sekvensering visade att exonerna 6-9 hoppar inträffat och immunocytokemi med DYS-2-färgning visade återställd dystrofin expression i behandlade prov. AON-behandlade hundar visade en signifikant ökning av dystrofin-positiva fibrer. Detta tyder på att exoner 6-8 var att hoppas över och en förkortad protein producerades. Mängden dystrofin-positiva fibrer ökar när en cocktail av AONs användes och var proportionell mot AON dosering. Immunoblot visade ökad dystrofin uttryck i system morfolino-behandlade hundar. Skelettmuskel hade varierande nivåer av dystrofin fibrer; emellertid, morfolino-behandlade hjärtvävnad visade liteförbättring av dystrofin uttryck. Eftersom dystrofin har en hög molekylvikt (427 kDa), kan detektion av låga mängder av dystrofin vara svårt. För bästa resultat, var Tris-acetat gel och den halvtorra överföringsmetod som används. HE-färgning visade förbättrad histopatologi i morpholino-behandlade hundar. Centralt, kärn fibrer (CNFs) är ett tecken på ohälsosam muskler och representerar cykler av muskeldegeneration och förnyelse. Morfolino-behandlade CXMD hundar visade en minskning i procentandelen av CNFs i jämförelse med icke-behandlade CXMD hundar. Klinisk gradering visade en förbättring av symtomen, såsom ökad gång och löpning förmåga, i morfolino-behandlade djur. Hårdheten av muskler tros spegla muskelatrofi och därmed var det ingår i betygssystemet 59. Hårdheten av låret (hind-lem) muskler utvärderades; däremot inte vi kraniala skräddarmuskeln eftersom de tenderar att uppvisa hypertrofi snarare än atrofi i CXMD. Behandlade hundar visared lägre betygsresultat och hade snabbare gånger på 15 m kör testet. Förbättrade gånger på 15 m testet indikerar förbättrad muskelfunktion 40. Högre totala betygs poäng indikerar dålig hälsa och ökad muskelatrofi.

Även om dessa resultat är lovande, fortfarande uppvisar flera exon hoppa många utmaningar som måste övervinnas innan tekniken har klinisk tillämpbarhet. Hjärtvävnad visar fortfarande reducerad upptag av AONs, sannolikt på grund av skillnaden i cellulär handel mellan hjärt- och skelettvävnad. Inga toxiska effekter har observerats hos djur enligt gällande doseringsregimer; Men, behöver mer arbete göras för att bedöma långtidstoxicitet före användningen av AON drinkar kan flytta till kliniska prövningar. Det är svårt att få godkännande för AON cocktail droger eftersom tillsynsmyndigheter definierar varje AON sekvensen som en unik drug. Detta innebär att varje sekvens i en cocktail skulle behöva vara individuellt testat för safety, vilket kräver mer tid och mer pengar. Ett annat hinder för användningen av multi-exon hoppa i en klinisk miljö är en stor mängd av mellanliggande proteinprodukter framställda med okända funktioner. Dessa proteiner kan potentiellt leda till oförutsägbara biverkningar, beroende på den enskilda mutationen 22. Dessutom är mutationsmönster som finns inom dagens dystrofa hund modeller är begränsade. Det finns få naturligt förekommande mutationer, och inte alla mutationer är användbara för att studera multi exon skipping. Den dystrofa grismodell ser ut att bli ett bra alternativ för framtida DMD exon hoppa studier 33, 34.

DMD hundmodeller har vissa fördelar jämfört med andra DMD-modeller. Att vara en större djurmodell, klinisk klassificering och MRI är möjliga, vilket möjliggör en mer detaljerad analys. Eftersom hundar är stora djur de är också mer lämpade för toxikologiska studier och närmare representerar den mänskliga sjukdomen i jämförelse med den musmodellen. hund models har också DMD gensekvenser som är mer lika människor 23, 34, 45.

Även tekniskt utmanande, kunde flera exon hoppa tillvägagångssätt i slutändan gynna> 90% av DMD patienter 24. Detta gör det till ett mycket bättre alternativ till en enda exon hoppa, som enda exon hoppa gäller endast för en liten del av patienterna. Dessutom kommer flera exon hoppa möjligt för oss att välja radering mönster som optimerar funktionaliteten av de förkortade dystrofin proteiner. Till exempel, radering av DMD exonema 45-55 är förknippad med exceptionellt milda symptom eller asymtomatiska individer 14,19,60-63. Multi-exon hoppa av exon 45 - 55 har redan visats i en musmodell av DMD med en exon 52 deletion (mdx52) med hjälp av systemiska injektioner av vPMOs 22,26. Användningen av cocktail vPMOs har också påvisats i andra former av muskeldystrofi, t.ex.som Fukuyama kongenital muskeldystrofi (FCMD). FCMD orsakas av exon infångning, där avvikande mRNA splitsning orsakas av retrotransposon insertion. vPMOs har visat att rädda skarvningsmönster i både en FCMD musmodell och i humana cellinjer 64. Nästa generations AON kemi uppvisar högre effekt och lägre toxicitet skulle underlätta en effektiv översättning av fler exon hoppa strategi i klinisk tillämpning. Dessutom kan multi-exon skipping potentiellt appliceras på andra genetiska störningar, såsom dysferlinopathies 24, 65.

Materials

Name Company Catalog Number Comments
2'OMePS Transfection of Dog Myoblasts 
3 ml 6-well plates IWAKI 5816-006
Dulbecco’s modified Eagle’s medium (DMEM)  Gibco 11965-092
Fetal bovine serum (FBS)  HyClone SH30071.01
Penicillin  Sigma-Aldrich  P4333  200 U/ml 
Lipofectin  Invitrogen  18292-011 Total volume of 100 ml in opti-MEM media at a ratio of 2:1 for lipofectin. 
10 ml lipofectin for 5 mg RNA. 
2’OMePS Eurogentec  Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC). 
Horse Serum  Gibco 16050-114 2%
streptomycin  Sigma-Aldrich P4333  200 μg/ml
Bovine serum albumin (BSA)  Sigma-Aldrich A9418 
Insulin
Morpholino transfection of dog myoblasts
All material from MePS Transfection of Dog Myoblasts for culturing
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
Endo-Porter Gene-tools
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
Chloroform Sigma-Aldrich P3803 200 μl 
1.5 ml Tubes  Eppendorf 22363204
Centrifuge  Beckman-Coulter
75% Ethanol  Sigma-Aldrich 34852
UV Spectrometer 
Forward primer in exon 5  Invitrogen CTGACTCTTGGTTTGATTTGGA                          
1.5 μl 10 μM
Reverse primer in exon 10  Invitrogen TGCTTCGGTCTCTGTCAATG                            
1.5 μl 10 μM
dNTPs Clontech 3040
One-Step RT-PCR kit  Qiagen  210210
Thermo-cycler Scinco
Complementary DNA (cDNA) Sequencing 
Gel extraction kit  Qiagen  28704
Centrifuge 
Terminator v3.1 Cycle Sequencing Kit  Applied Biosystems  4337454
Intramuscular injections or open muscle biopsy
Surgical Tools Scissors, scalpel, needle, surgical thread 
Vet Ointment 
Iodophors  webtextiles 12190-71-5
chlorohexidine Peridex 12134
Surgical Drapes 
Scrubs
Facial Mask 
Surgical Gloves 
Head Covering 
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
27 G Needles TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225
buprenorphine hydrochloride
Tongue Depressor 
cephalexin 15 to 30 mg/kg 
cefazolin 15 to 30 mg/kg 
buprenorphine  0.01 mg/kg
buprenorphine hydrochloride  0.02 mg/kg
Systemic Injections
Syringe infusion pump  Muromachi 
22 G Indwelling needles TERUMO SG3-2225 
27 G Needles  TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225 
Saline Ohtsuka-Pharmaceutical 28372
Clinical Grading of Dogs
Video Camera 
Stop watch 
Magnetic resonance imaging (MRI) 
3 Tesla MRI l 
18 cm diameter/18 cm length human extremity coil
Muscle sampling and preparation (necropsy)
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Tragacanth gum 10-20 ml
Liquid Nitrogen 
Cork Discs Iwai-kagaku  101412-806
Dry Ice
Tweezers
Poly-L-lysine–coated slides Fisher 22-037-216
Cryostat Microsystem  Leica  cm1900 
Immunohistochemistry 
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
DYS2 Novocastra  NCL-DYS2  1:150 dilutions
Alexa 594 goat antimouse IgG1  Invitrogen A-21125 1:2,500 dilutions
Alexa 594 goat antimouse IgG2  Invitrogen A-11005 1:2,500 dilutions
DAPI  Invitrogen D1306 Contains mounting agent
Goat Serum  Invitrogen 10000C 15%
PBS
Moisture chamber  Scientific Devise Laboratory  197-BL
Chamber slide  Lab-tek  154453
Cover Glasses  Fisher 12-540A
Hydrophobic barrier pen 
Fluorescent microscope  594 nm at 20X magnification. 
Western Blotting 
Distillied Water 
Hand Homogenizer 
2× Laemmli SDS-loading buffer  0.1 M Tris–HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue 
SDS gels  Bio-Rad  161-1210 5% resolving
SDS gels Invitrogen  Invitrogen, WG1601BOX 3-8%
PVDF membrane  GE 10600021
Methanol
Running buffer (10×)  250 mM of Tris-Base, 1,920 mM of Glycine
Running buffer (1×) 10% 10× buffer, 20% methanol 
0.05% PBS/Tween 20 (PBST)  2,000 ml              
3× 200 ml for washing
PBST/5% milk powder  100 ml
Protein Assay Kit BCA T9650
Tween 20  Sigma  P5927
Urea Sigma  U5378
Beta Mercaptoethanol  Millipore ES-007-E
SDS Sigma L3771
Tris-Acetate Sigma
Tris HCl Sigma T3253
Glycerol Sigma G8773
Loading/sample buffer for Western blotting NuPage Invitrogen NP007
NaCl Sigma S3014
PMSF Sigma P7626
Protease cocktail inhibitor  Roche 11836153001
Cathode Buffer 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer 0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer 0.3 M Tris base + 20% Methanol
desmin antibody  Abcam ab8592
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
ImageJ Software

DOWNLOAD MATERIALS LIST

References

  1. Duchenne, A. The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J. 14, (2), 541-542 (1867).
  2. Zellweger, H., Antonik, A. Newborn screening for Duchenne muscular dystrophy. Pediatrics. 55, (1), 30-34 (1975).
  3. Echigoya, Y., Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 24, 57-68 (2014).
  4. Bushby, R. F., Birnkrant, D. J., et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology. 9, (1), 77-93 (2010).
  5. Eagle, M., Baudouin, S. V., Chandler, C., Giddings, D. R., Bullock, R., Bushby, K. Survival in Duchenne muscular dystrophy: improvements in life expectancy since 1967 and the impact of home nocturnal ventilation. Neuromuscul. Disord. 12, (10), 926-929 (2002).
  6. Heald, A., Anderson, L. V., Bushby, K. M., Shaw, P. J. Becker muscular dystrophy with onset after 60 years. Neurology. 44, (12), 2388-2390 (1994).
  7. Stöllberger, C., Finsterer, J. Worsening of heart failure in Becker muscular dystrophy after non-steroidal anti-inflammatory drugs. Med. J. 98, (4), 478-480 (2005).
  8. Passamano, L., et al. Improvement of survival in Duchenne Muscular Dystrophy: retrospective analysis of 835 patients. Acta Myol. 31, (2), 121-125 (2012).
  9. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, (6), 919-928 (1987).
  10. Koenig, M., et al. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50, (3), 509-517 (1987).
  11. Takeshima, Y., et al. Mutation spectrum of the dystrophin gene in 442 Duchenne/Becker muscular dystrophy cases from one Japanese referral. JHG. 55, (6), 379-388 (2010).
  12. White, S. J., et al. Duplications in the DMD gene. Hum. Mutat. 27, 938-945 (2006).
  13. Yokota, T., Duddy, W., Echigoya, Y., Kolski, H. Exon skipping for nonsense mutations in Duchenne muscular dystrophy: too many mutations, too few patients. Expert Opin. Biol. Ther. 12, (9), 1141-1152 (2012).
  14. Yokota, T., Duddy, W., Partridge, T. Optimizing exon skipping therapies for DMD. Acta Myol. 26, (3), 179-184 (2007).
  15. Magri, F., et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol. 258, (9), 1610-1623 (2011).
  16. Yoshida, H. H., Ishikawa-Sakurai, M. Biochemical evidence for association of dystrobrevin with the sarcoglycan- sarcospan complex as a basis for understanding sarcogly- canopathy. Hum. Mol. Genet. 9, (7), 1033-1040 (2000).
  17. Bies, R. D., Caskey, C. T., Fenwick, R. An intact cysteine-rich domain is required for dystrophin function. J. Clin. Invest. 90, (2), 666-672 (1992).
  18. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2, (1), 90-95 (1988).
  19. Aoki, Y., Yokota, T., Wood, M. J. Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int. 2013, (402369), (2013).
  20. Cirak, V. A. -G., Guglieri, M., et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. The Lancet. 378, (9791), 595-605 (2011).
  21. Goemans, N. M., et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 364, (16), 1513-1522 (2011).
  22. Echigoya, Y., et al. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol Ther Nucleic Acids. 4, (2015).
  23. Hoffman, E. P., et al. Restoring dystrophin expression in Duchenne muscular dystrophy muscle progress in exon skipping and stop codon read through. Am J Pathol. 179, (1), 12-22 (2011).
  24. Aartsma-Rus, A., et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 74, (1), 83-92 (2004).
  25. Aartsma-Rus, A., Kaman, W. E., Weij, R., Tden Dunnen, J., van Ommen, G. J., van Deutekom, J. C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol. Ther. 14, (3), 401-407 (2006).
  26. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109, (34), 13763-13768 (2012).
  27. McClorey, G., Iversen, P. L., Moulton , H. M., Fletcher, S., Wilton, S. D. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13, (19), 1373-1381 (2006).
  28. Sharp, N. J., et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 13, (1), 115-121 (1992).
  29. Shimatsu, Y., et al. Canine X-linked muscular dystrophy in Japan (CXMDJ). Exp Anim. 52, (2), 93-97 (2003).
  30. Nguyen, F., Cherel, Y., Guigand, L., Goubault Leroux, I., Wyers, M. Muscle lesions associated with dystrophin deficiency in neonatal golden retriever puppies. J Comp Pathol. 126, (2-3), 100-108 (2002).
  31. Nakamura, A., Takeda, S. Mammalian models of Duchenne Muscular Dystrophy: pathological characteristics and therapeutic applications. J Biomed Biotechnol. 2011, (184393), (2011).
  32. Yokota, T., et al. A renaissance for anti-sense oligonucleotide drugs in neurology: Exon-skipping breaks new ground. Arch. Neurol. 66, 32-38 (2009).
  33. Aartsma-Rus, A., et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 30, (3), 293-299 (2009).
  34. Yu, X., Bao, B., Echigoya, Y., Yokota, T. Dystrophin-deficient large animal models: translational research and exon skipping. Am. J. Transl. Res. 7, (8), 1214-1231 (2015).
  35. Yin, H., Moulton, H., Betts, C., Wood, M. CPP-directed oligonucleotide exon skipping in animal models of Duchenne muscular dystrophy. Methods Mol Biol. 683, 321-338 (2011).
  36. Moulton, H. M., Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta. 1798, (12), 2296-2303 (2010).
  37. Morcos, P. A., Li, Y., Jiang, S. Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques. 45, (6), 613-614 (2008).
  38. Betts, C., et al. A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Mol Ther Nucleic Acids. 14, (1), e38 (2012).
  39. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5, (8), e12239 (2010).
  40. Yokota, T., et al. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol. 65, (6), 667-676 (2009).
  41. Melacini, P., et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromuscul. Disord. 6, (5), 367-376 (1996).
  42. Guncay, A., Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have we come and what does the future hold. Future Med. Chem. 7, (13), 1631-1635 (2015).
  43. Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Research Council (US) Committee on Pain and Distress in Laboratory Animals. Distress in Laboratory Animals . National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK32658 (1992).
  44. Guide for the Care and Use of Laboratory AnimalsPhysical Restraint. National Research Council (US) Institute for Laboratory Animal Research. National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050 (1996).
  45. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science. 297, 1007-1013 (2002).
  46. Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).
  47. Fairbrother, W. I. 11, Goldstein, P. RESCUE-ESE Web Server. MIT Burge Lab. Available from: http://genes.mit.edu/burgelab/rescue-ese/ (2016).
  48. Yokota, T., Hoffman, E., Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 709, 299-312 (2011).
  49. Jenuth, J. P. The NCBI. Publicly available tools and resources on the Web. Methods Mol Biol. 132, 301-312 (2000).
  50. Yokota, T., et al. Extensive and Prolonged Restoration of Dystrophin Expression with Vivo-Morpholino-Mediated Multiple Exon Skipping in Dystrophic Dogs. Nucleic Acid Ther. (2012).
  51. Summerton, J. E. Endo-Porter: a novel reagent for safe, effective delivery of substances into cells. Ann. N. Y. Acad. Sci. 1058, 62-75 (2005).
  52. Mangram, A. J., et al. Guideline for Prevention of Surgical Site Infection. Am J Infect Control. 27, 97-134 (1999).
  53. Reichman, D. E., Greenberg, J. A. Reducing Surgical Site Infections. A Review . Rev Obstet Gynecol. 2, 212-221 (2009).
  54. Mizuno, H., Nakamura, A., Aoki, Y., Ito, N., Kishi, S., Yamamoto, K., Sekiguchi, M., Takeda, S., Hashido, K. Identification of muscle-specific microRNAs in serum of muscular dystrophy animal models: promising novel blood-based markers for muscular dystrophy. PloS one. 6, (2011).
  55. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 145-154 (2005).
  56. Evans, H., de Lahunta, A. Guide to the Dissection of the Dog. SAUNDERS. (2009).
  57. Girish, V., Vijayalakshmi, A. Affordable image analysis using NIH Image/ImageJ. Indian J Cancer. 41, (47), (2004).
  58. Bearer, E. L., et al. Overview of image analysis, image importing, and image processing using freeware. Current protocols in molecular biology. 14, (2003).
  59. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 24, 145-1454 (2005).
  60. Beroud, C., et al. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 28, 196-202 (2007).
  61. Ferreiro, V., et al. Asymptomatic Becker muscular dystrophy in a family with a multiexon deletion. Muscle Nerve. 39, 239-243 (2009).
  62. Nakamura, A., et al. Follow-up of three patients with a large in-frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci. 15, 757-763 (2008).
  63. Yokota, T., Pistilli, E., Duddy, W., Nagaraju, K. Potential of oligonucleotide-mediated exon-skipping therapy for Duchenne muscular dystrophy. Expert Opin Biol Ther. 7, 831-842 (2007).
  64. Taniguchi-Ikeda, M., et al. Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy. Nature. 478, 127-131 (2011).
  65. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3, 144-176 (2013).
Multi-exon Hoppa Använda Cocktail antisensoligonukleotider i Canine X-bunden muskeldystrofi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).More

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter