Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Köpek X-bağlantılı Musküler Distrofi Kokteyl Antisens oligonükleotidleri kullanılarak atlanıyor Çok ekson

doi: 10.3791/53776 Published: May 24, 2016
* These authors contributed equally

Summary

Ekson atlama şu anda Duchenne kas distrofi (DMD) için en umut verici bir tedavi seçeneğidir. DMD hastalarında için uygulanabilirlik genişletmek için ve sonuçta elde edilen kesilmiş distrofin protein stabilitesi / fonksiyonu optimize etmek için, kokteyl antisens oligonükleotidler kullanılarak bir yaklaşım atlama çok ekson geliştirilmiş ve bir köpek modelinde sistemik distrofin kurtarma gösterilmiştir.

Abstract

Duchenne müsküler distrofi (DMD), dünya çapında, distrofin (DMD) genindeki mutasyonlar neden olduğu en sık görülen ölümcül genetik hastalıklardan biridir. Ekson atlama okuma çerçevesini yeniden ve daha kısa ama fonksiyonel proteinleri üretmesi antisens oligonükleotidler (AON'ler) olarak adlandırılan kısa DNA / RNA benzeri molekülleri kullanır. (Tek bir AON ilaçla tedavi edilebilir hastaların sadece% 13 kadar) sınırlı uygulanabilirlik ve kesik proteinlerin belirsiz fonksiyonu: Ancak, ekson atlama tedavisi iki önemli engellerle karşı karşıyadır. Bu sorunlar bir kokteyl AON yaklaşımla ele alındı. DMD hastalarının yaklaşık% 70'i tek ekson atlama tarafından (kombine tüm ekson) tedavi edilebilir olsa da kokteyl antisens ilaçlar kullanarak atlama birden ekson fark edilebilir eğer bir potansiyel DMD hastalarının% 90'ından fazlasını tedavi olabilir. köpek X-bağlantılı kas distrofisi (CXMD) köpek modeli, olan bir fenotip, insan DMD hastalarında daha benzerdir, sistemik effic test etmek için kullanıldıAcy ve ekson 6 ve 8'de CXMD köpek modeli çoklu ekson atlama güvenlik distrofin mRNA ekson 7 eksikliğine yol intron 6 bir ek bölge mutasyon barındırır. CXMD okuma çerçevesini geri ekson 6 ve 8 multi-ekson atlama gerektirir; Bu nedenle, CXMD çoklu ekson atlama etkinliğini ve güvenilirliğini test etmek için iyi bir orta boyutlu hayvan modelidir. Bu çalışmada, ekzon 6 ve ekson 8 hedefleyen antisens morpholinos bir kokteyl tasarlanmış ve vücut genelinde iskelet kaslarında distrofin ifade restore edilmiştir. transfeksiyon / kokteyl oligo enjeksiyon ve etkinliği ve CXMD köpek modelinde çoklu-ekson atlama güvenlik değerlendirilmesi için yöntemler sunulmaktadır.

Introduction

Duchenne müsküler distrofi (DMD) ilk Dr. Guillaume-Benjamin-Amand Duchenne (de Boulogne) 1 tarafından açıklanan ilerleyici kas güçsüzlüğü ile karakterize X'e bağlı resesif kas hastalığıdır. DMD her yıl 2,3 doğumlu yaklaşık 20.000 etkilenen çocuklarla, dünya çapında yaklaşık 1 3.500, çocuklar etkileyen yaygın bir genetik bir hastalıktır. Motor gelişim gecikir ve yürüyüş bozuklukları erken gençler yaklaşık olarak tekerlekli sandalye bağımlılık, ardından erken çocukluk 4 görülmektedir. Ölüm genellikle bağlı solunum veya kalp yetmezliği 5-8 20 ve 30 yaşları arasında ortaya çıkar. DMD için bir tedavi şu anda yok. Glukokortikoid ile tedavi, bir dereceye kadar, kas dejenerasyonu ilerlemesini yavaşlatmak, ancak, obezite ve diyabet mellitus 2,7,8 dahil ciddi yan etkiler ile ilişkilidir. DMD fonksiyonel distrofin Protei kaybına yol açan, distrofin (DMD) genindeki mutasyonlar sonucun. DMD 2 milyon baz çifti ve 79 ekson 9,10 ile son derece geniş bir gen olduğunu. out-of-frame mutasyonlar lider Silme, saçma ve çoğaltılması mutasyonlar DMD fenotip en sık nedenidir. 9 ve ekzon 45 - - ekzon 3 bölgeleri hastaların çoğu genin bu kısımları içinde silinmesi mutasyonlara sahip olduğu 55, DMD hastalarında 3,9,11-16 işlevsel olmayan distrofin yol "mutasyon noktaları" olarak adlandırılmaktadır. kas zarı stabilizasyonu önemli bir role sahip distrofin-glikoprotein kompleks (DGC), içinde distrofin fonksiyonları. Merkezi çubuk alan, daha az önemli bir rol 3,9,17 çalış N- ve C-termini, işlev için önemli alandır. Çoğunlukla DMD geninde çerçeve mutasyonlar sonucu Becker kas distrofisi (BMD) ile ilişkili hafif fenotip gözetilmesi, DMD tedavisi için atlama ekson uygulanmasını ilham kaynağı oldu. BMD hastaları kısaltılmış, ama functionA vartermini 3,6,18 hem muhafaza l, distrofin proteini. Ekzon atlatma, teorik olarak, kemik mineral yoğunluğu 3,19 görülen benzer kısaltılır-büt-fonksiyonel distrofinin protein ile sonuçlanan, okuma çerçevesi geri.

Antisens oligonükleotitlerin (AON'ler) birden fazla tür 2'O-metillenmiş fosforotioatların (2'OMePS) ve fosforodiamidat morfolino oligomerleri (PMO) de dahil olmak üzere klinik çalışmalarda, test edilmiştir. Bu AON kullanarak atlanıyor ekzon 51 ve 53 incelenmiş ve sonuçlar umut verici olsa da bu mutasyon özgü 3, 19, 20,21, 22-26 olduğu gibi tek ekson atlama, uygulanabilirliği sınırlıdır. Sorular da tek ekson 22,23 atlama üretilen sonuçlanan kısaltılmış distrofin proteinin istikrar kalır. Buna ek olarak, bazı hastalarda tek bir ekson daha okuma çerçevesi 3 geri yüklemek için atlanması gerekir. Teknik olarak daha zor olsa da, çoklu ekzon atlatma için bir yöntem olup buBu sorunları 3,19 ele alabilir. Çok ekzon atlatma önce distrofik köpek ve in vitro olarak insan hücre hatları gösterilmiştir. Buna ek olarak, mdx52 fare ve köpek X-bağlantılı kas distrofisi (CXMD) köpek modelleri, in vivo kullanılmıştır 22, 24-27 inceler. Köpek X'e bağlı müsküler distrofi Japonya (CXMD J) CXMD J okuma çerçevesi ekson 6 ve 8, veya ek ekson (örneğin, ekson 3-9) multi-ekson atlama tarafından restore edilebilir av köpekleri, burada kullanıldı (Şekil 1). Beagle-merkezli CXMD Golden Retriever müsküler distrofi (GRMD) modeli ile aynı mutasyon deseni paylaşır, ancak av köpekleri böylece DMD 28,29 için yararlı bir model sağlayan dolayı vücut büyüklüğü küçük ve bakımı ucuzdur. CXMD köpekler daha yakından kemirgen gibi, küçük hayvan modellerinde daha insan DMD fenotip taklit ve toksikolojik değerlendirmeler 3,22,30,31 için daha güvenilir (Şekil 2)> yukarı. CXMD köpekler DMD görülen benzer progresif kas çürüme, yürüyüş bozuklukları ve kalp ve solunum problemleri gösterir. tek ekson atlama ile karşılaştırıldığında, çok-ekzon atlatma hasta çok daha büyük bir oranda uygulanabilir. En yaygın üç mutasyon tipleri (silmeler, saçma ve mükerrer) arasında 80 - tüm DMD hastalarının% 45'i yararlanabilir iken hastaların% 98'i, özellikle atlama ekson 45, çoklu-ekson 14,32,33 atlama ile tedavi edilebilir - 55 3,19,22,34.

modifiye morpholinos gelişmesiyle birlikte, ekson atlama kolaylaştırma AON kokteyl etkinliği artmıştır. -Arginin açısından zengin hücre-nüfuz peptide konjuge PMO (PPMOs) ve in vivo morpholinos (vPMOs) önemli ölçüde hücre nüfuz kabiliyeti ve istikrar 3,35-38 geliştirilmiş AON kimyaları bulunmaktadır. Endişeler uzun vadeli AON toksisite hakkında kalır; Ancak, önemli bir ilerlemeyapıldı. Morpholinos yapılan kimyasal değişimleri büyük ölçüde hedef dışı etkilerini azaltmak ve ön-klinik çalışmalar, önemli bir toksik etki 3,22,39,40 bildirilmiştir. Çoklu ekson atlama için bir diğer zorluk, her bir AON'in şu anki gereksinimi bir kokteyl 3,19,22,41,42 olarak yerine birlikte tek bir ilaç olarak tek başına, toksisite için test edilecek olan. kalp hedefleyen atlama tek ve hem de çoklu ekson içeren DMD çalışmalarda, distrofik kalp dokusunda küçük bir iyileşme olmamıştır. merkezinde morpholinos etkinliği nedeniyle düşük hücre nüfuz kabiliyeti düşük olduğu düşünülmektedir. Peptit-konjuge PPMOs kalp 3,19,38 kurtarıldı fonksiyonel distrofin proteini miktarını artırarak, kalp hücreleri nüfuz AON yeteneğini geliştirmiştir.

Burada, bizim AON kokteyl yaklaşım ESEfinder yazılımını 43 kullanılarak AON dizilerinin tasarımı da dahil olmak üzere, uzun uzadıya tartışıldı. ProtocÇoklu-ekson atlama köpek deneyler için OLS de tarif edilmiştir. CXMD J av köpekleri ekson 6 ve 8 atlama deneyleri için kullanılmıştır. CXMD köpek modelinde atlama Çok ekson umut verici sonuçlar gösterir, ancak zorluklar bunlar klinik uygulanabilir önce ihtiyaç aşılması kalır.

Protocol

Aşağıda listelenen tüm protokoller Japonya'da Ulusal Nöroloji Merkezi ve Psikiyatri (DKMP) tarafından belirlenen hayvan bakımı kurallarına uygun olarak bulunmaktadır. Tüm deneyler DKMP Kurumsal Hayvan Bakım ve Kullanım Kurulu tarafından kabul edildi.

Antisens oligo 1. Tasarım

  1. , 45-47 ESE siteleri 44 algılamak için kurtarma ESE ve ESEfinder programlarını kullanın.
  2. hedeflenecek olan ekson antisens olan tasarım 25 baz çifti (bp) sekansı. Hedef ekzon 6 ve köpek modelinde 8 (Şekil 1).
    1. PMOS 30 bp dizileri (Tablo 1) veya 2'OMePS 25 bp - 25 kullanın. 25 bp dizileri tasarlamak için, hedef bölge içinde olan dizileri seçin. Istikrarlı dizileri 43 oluşturmak için ikincil bir yapı, heterodimerlerinin kaçınma, ekson yapıştırma arttırıcı motifleri, ve GC içeriği göz önünde bulundurun. Yukarıda sözü edilen SOF tarafından tanımlanan şekilde AON'ler ESE sitelerin en az birine hedeflemelidirtware.
    2. daha az arka arkaya 4 'G ve içermeyen kendi kendini tamamlayan diziler ile, en az% 65 GC içeriğine sahip seçin AON'ler. Off-hedef tavlama siteleri 22,48,49 tahmin NCBI Blast yazılımı kullanın.
  3. Uygun bir AON omurga kimyası seçin. In vitro deneyler için 2'O-metil oligonükleotidleri (2'OMePS) ya da morpholinos kullanımı. İn vivo deneyler için, 2'OMePS, morpholinos ya vPMOs kullanımı. 3,19,48,50

Vitro Deneyler 2. (ekzon 6 ve 8 CXMD Modeli atlanıyor)

  1. Köpek miyoblastların 2'OMePS transfeksiyonu
    1. 6 oyuklu plakalarda büyüme ortamı 3 ml kültür CXMD miyoblastlar. Tohum 1-5 x 10 3 hücre / cm2 0,5 ml / miyoblastların için ortamın cm2. büyüme ortamı için,% 10 cenin sığır serumu (FBS) ve% 1 ile Dulbecco modifiye edilmiş Eagle ortamı (DMEM) kullanımıpenisilin / streptomisin (P / S) 40.
    2. % 80 konfluent - 60 kadar, 37 ° C'de inkübe edin. Bu, yaklaşık 12 ila 24 saat sürer.
    3. (: 1 oranında nakil maddesi: AON'lere, örneğin, vs lipofektin 10 ul 5 mg AON'ler 2) düşük serum ortamında 100 ul toplam bir katyonik lipozom transfeksiyon ajanı ile seyreltilir. 45 dakika - Karışım 30 RT'de bekletin.
    4. düşük serum ortamı içinde 100 ul son hacim olması için AON (2'OMePS ya morpholinos) seyreltin.
    5. seyreltilmiş AON'lere ile seyreltildi transfekte maddeyi bir araya getirin ve 10, oda sıcaklığında inkübe edin - 15 dakika.
    6. transfeksiyon ajan / AON karışımı oda sıcaklığında otururken, aspirasyon yoluyla hücrelerden eski medya kaldırmak ve medya ile hücreleri yıkayın.
    7. transfeksiyon ajan / AON karışıma 0.8 ml medya ekleyin ve sonra taze yıkanmış hücrelere tüm çözüm ekleyin. 37 ° C'de 3 saat süreyle inkübe edilir.
    8. kuluçka sonra, differentiat ile medyayı değiştirmekiyon medya (DM); farklılaşma 10 gün kadar sürebilir. yaklaşık bir gün 3. farklılaşma medya başlayan farklılaşma meydana olup olmadığını görmek için kontrol% 2 at serumu içeren DMEM, 200 U / ml penisilin, 200 mg / ml streptomisin ve 10 ug / ml insülindir.
  2. Köpek miyoblastların Morfolino transfeksiyonu
    1. Adım 2.1 'de açıklandığı gibi kültür CXMD büyüme ortamında miyoblastları.
    2. farklılaşma ortamı (DM) geçin ve nihai konsantrasyon 1 uM yapmak için her kuyuya 0.1 mM stok morfolino ekleyin. Transfeksiyon veya enjekte edilmeden önce, 10 dakika süreyle 65 ° C'de ısı kokteyli morpholinos AON bir araya toplanmasının engellenmesi için. Bir peptit dağıtım reaktif 39,51 ilave edin ve 3 arasında nihai bir konsantrasyona kadar ayarlayın - 6 uM.
    3. 16 Sonra - inkübasyondan 48 saat, RNA ekstraksiyonu için hücreleri toplamak. plaka hücreleri ayırmak için hücrelere 1 mi asit guanidinyum thiosiyanat-fenol-kloroform ekleyin. RNA Extrac gerçekleştirinBu aşamadan sonra yon.
      1. Seçenek olarak ise, tüm hücreleri kapsar şekilde tripsin ekleyip 37 ° C'de 2 dakika süreyle inkübe edin.
        Not: immunokimya gerçekleştirmek kültür için odacıklı slayt gözlük kullanmak isteyen varsa. farklılaşma sonra hücreler paraformaldehid (PFA) (10 dakika boyunca% 4) ile tespit edilebilir.
  3. RNA Ekstraksiyonu ve ters transkripsiyon polimeraz zincir reaksiyonu (RT-PCR)
    1. Hücreler myotubes farklılaştırılmış sonra, orta kaldırmak ve 1 ml asit guanidinyum tiyosiyanat-fenol-kloroform ekleyin; Oda sıcaklığında 10 dakika inkübe edilir.
    2. 1.5 ml tüpler aktarın. 200 ul kloroform ile bir araya getirin ve üç ayrı tabakalar görülene kadar 2 dakika boyunca oda sıcaklığında inkübe edilir. yukarıdan aşağıya doğru üç tabaka vardır: bir RNA tabaka bir DNA tabakası ve bir protein tabakası.
    3. 4 ° C'de 15 dakika boyunca 12,000 x g'de santrifüjleyin. 500 & # ile bir tüp üst katman süpernatant ve yer çıkarın181 l izopropanol (burada durdurma eğer, -80 ° C'de süpernatant saklayın). Santrifüj, 4 ° C'de 10 dakika boyunca 12,000 x g'de süpernatan; santrifüj sonra, ortaya çıkan RNA pelet tutmak ve supernatant atın.
    4. 4 ° C'de 5 dakika boyunca 8000 x g'de, etanol ve santrifüj ile pelet yıkayın. 15 dakika boyunca tüp ters çevrilerek kalıntı etanol buharlaştırılmakta ve daha sonra 15 ekleyin - RNaz içermeyen su 30 ul. 260 nm'de ABD / VIS spektroskopisi kullanılarak toplam RNA konsantrasyonu ölçmek.
    5. 1.5 ul 10 uM ters primer, 1 ul dNTP, 5 ul tek-aşamalı PCR kiti tamponu, 0.7 ul RNaz inhibitörü, 1 ul enzim karışımı ile ilgili bir, 1.5 ul 10 uM ileri primer: RT-PCR reaksiyonu için gerekli ayıraçlar birleştirin PCR kiti, ve RNA 200 ng adım. Bu karıştırıldıktan sonra, 25 ul bir son hacme kadar su ilave edilir.
    6. termo-cycler karışımı yerleştirin. 50 ° C'de, 15 dakika ile 30 dakika döngüsü başlat0; 95 ° C döngü, daha sonra 1 dakika boyunca 94 ° C'de 35 döngü, 1 dakika için 60 ° C ve 1 dakika için 72 ° C. Son olarak, 72 ° C'de 10 dakika yıkama işlemi. 4 ° C ya da -20 ° C'de bir buzdolabında saklayın PCR ürünü,
  4. Tamamlayıcı DNA (cDNA) Dizileme
    1. agaroz jel elektroforezi kullanılarak 9-atlanan bantları - ekson 6 tanımlayın. Yük, 20 dakika sonra da 120 V 5,% 1.5 agaroz jeli oyuklarına Her numunenin ul, 5 dakika boyunca jelden 135 V çalıştırmak ve. Daha sonra, 30 dakika boyunca oda sıcaklığında DNA jel leke jel inkübe edin. görüntüleme yazılımı kullanılarak bantları gözünüzde canlandırın.
    2. Bir jel özütleme kiti kullanılarak söz konusu bant tüketim.
      1. DNA parçasını tüketim ve 200 ul NED / 100 mg jel kullanılarak jel dilim çözünür. Bu 50 ° C su banyosu içinde 5 ile 10 dakika bekletin. Daha sonra membran boru silika aktarın.
      2. 30 saniye için 11,000 x g'de santrifüjleyin. ce önce 700 ul NT3 tamponu ile iki kez yıkayın30 saniye için 11,000 x g'de tekrar ntrifuging.
      3. 1 dakika boyunca 11,000 x g'de santrifüj ile silis membranı kurutun.
      4. 30 ul NE tampon ve 1 dakika boyunca oda sıcaklığında bekletin - 15 ekleyin. Daha sonra, 1 dakika için 11,000 x g'de santrifüjlenir. Silika jel çıkarın ve tüp içinde içeriğini tutmak.
    3. üreticinin protokolüne göre sırasını belirlemek için bir sıralama kiti kullanarak.

3. İntramüsküler enjeksiyonlar veya Açık kas biyopsisi

  1. hayatta kalma ameliyat sırasında steril şartlarda bakımı için cerrahi sitesine (arka bacak) çevredeki makası kullanarak tüylerden. bir dezenfektan olarak iyodoforların veya klorheksidin kullanın. yerleştirerek ve tüm hayvan ve ameliyat masasına onları güvence altına alarak cerrahi site için steril örtüler kullanın.
    1. Ameliyathane 52,53 temiz önlük, yüz maskeleri, türban, steril eldiven ve özel ayakkabılar giyin.
    2. </ Ol>
    3. 20 mg CXMD köpekleri enjekte / tiyopental sodyum kg onları uyutmak için. kurumasını gözleri önlemek için gözleri veteriner merhem kullanın.
    4. Genel anestezi (Şekil 3) korumak için% 3 izofluran inhalasyon - 2 kullanın. kas refleksleri kontrol edin ve kalbi izlemek ve solunum hızı anestezi derinliğini değerlendirmek için. RR: aşağıdaki gibidir: Genel anestezi altında, normal solunum hızı (RR), kalp atım hızı (KAH), ve SpO2 olan 10-20 nefes / dk; SpO 2: 95 -% 100, HR: 80 - dakika (bpm) başına 120 vuruş.
    5. Bir neşter kullanılarak, aynı zamanda tibialis anterior (TA) olarak bilinen kranial tibia (BT), üzerinde deri kesme ve (genç yetişkin köpekler için) yaklaşık 5 cm boyuna tek kesim yapmak. Enjeksiyon siteleri işaretlemek için, bir cerrahi iğne ve cerrahi iplik kullanarak derin fasya dikiş ve 2 cm aralıklarla iki dikiş işaretlerini yapmak.
    6. 27 G iğne ile kas içine AON'lere istenen konsantrasyonu enjekte edilir. istenen yoğunlaştırmatrasyonu işleme koşulları arasında değişir. CT için, kokteyl PMOS 1.2 mg'lık bir toplam (0.4 mg, her PMO) ya da kokteyl vPMOs 0.4 mg (0.13 mg, her vPMO) için, 1 ml hacim, her iki enjeksiyon verir. ekstansör karpi ulnaris (ECU) ön ayakları kas için, kokteyl PMOS 1.2 mg'lık bir toplam (0.4 mg, her PMO) ya da kokteyl vPMOs 0.4 mg (0.13 mg, her vPMO) 0.5 ml'lik iki hacim enjekte edilir. 1 dakika boyunca iğne in bırakın. kokteyl, her AON eşit miktarda kullanın.
    7. cerrahi neşter kullanılarak BT kas kas dokusunun bir parçayı uzunluğu yaklaşık 2 cm kaldırarak açık kas biyopsi.
    8. kas numune hazırlama için 6.5 adıma gidin.
    9. Bir iğne kullanarak, genel anesteziden uyanan önce / kg buprenorfin hidroklorür 0.02 mg intramüsküler enjeksiyon. geri kas üzerinde kas dokularını ve cildi Lay ve kas fasya ve cilt kapatılması, respectiv için 3-0 emilebilir iplik ve 3-0 naylon iplik kullanarak bu dikişely.
    10. ağzı açık tutarken, öğürme refleksi döndü belirlemek; öğürme refleksi döndüğünde, köpek ekstübe.
    11. enfeksiyonu önlemek için intravenöz veya kas içi enjeksiyon yoluyla 15 mg / 3 güne kadar kg sefazolin veya cephalexin (antibiyotikler) 30 uygulayınız.
    12. yedi gün içinde sütür çıkarın. sternal yatma korumak için yeterli kendine geldi ve tam bir iyileşme yapılıncaya kadar köpek, diğer hayvanlarla etkileşime izin vermez kadar köpek sahipsiz bırakmayın. mümkün olduğunca uzun süre yerde endotrakeal tüpler tutun ve hayvan çiğnemek veya yutma başladığında bunları kaldırın. Onlar kararlı ve normal sınırlar içinde olduğundan emin olmak için hayvanın kalp atışı, solunum ve hidrasyon izleyin.
    13. Ameliyat sonrası bakım, sessiz, karanlık dinlenme yeri, uygun yara ve bandaj bakım, yumuşak olmak üzere 3 gün (örneğin, buprenorfin 0.01 mg / kg) ve hemşirelik desteği için analjezi sağlamakdinlenme yüzeyi oral veya parenteral sıvılarla rehidrasyon ve çok lezzetli gıda veya muamele aracılığıyla normal beslenme bir geri dönüş. Herhangi bir hayvan ek ilaç gerekiyorsa, ağrı semptomları bağlı butorfanol tartarat 0.3 mg / kg kas içi enjeksiyon vermek.
      Not: ağrı Köpekler, ısırmak çizik veya ağrılı bölgeleri korumak ve kullanılırsa, alışılmadık endişeli veya agresif olabilir. Buna ek olarak, bir uzuv ağrı genellikle topallama veya kullanmak için girişimleri etkilenen ekstremitenin tutarak-up ile sonuçlanır. 8 saat - Bu gibi durumlarda, buprenorfin hidroklorür, 0.02 mg / kg 6 kas içi enjeksiyonu.

    4. Sistemik Enjeksiyonlar

    Not: Bu prosedür hafta istenen sayıda haftalık veya iki haftada bir tekrarlanabilir.

    1. yatmak için köpek alarak elle ve yavaşça köpekler dizginlemek ve daha sonra t boyunca yerinde köpek tutmak için omuzlar ve kalçalar üzerinde silah asmakO prosedürü.
    2. AON enjekte; 120-240 mg / kg kokteyl PMO'lar - (sefalik veya safenöz ven olarak da bilinir) bir kol damarına bir venöz kalıcı iğne kullanılarak (40 80 mg, her AON). Enjekte AON miktarı deneysel durumuna bağlıdır. kokteyl, her AON eşit miktarda kullanın.
    3. Üreticinin talimatlarını takip 20 dakika / dakika 2.5 ml'lik bir oranda 50 mL toplam enjekte bir infüzyon pompası ya da bir şırınga sürücü kullanın. iki haftada bir haftalık veya tekrarlayın enjeksiyonları distrofin ifade tekrarlanan enjeksiyonları ile birikir olarak (her iki haftada bir) en az 5 kez.
    4. toksisite incelemek için haftalık kan testleri yapın.
      1. Tam kan sayımı (CBC) 0.5 ml ve diğerleri için 2.5 ml - - ön veya arka bacağın deri altından damarlar biri bir iğne kullanarak, kan 3 ml toplar. CBC, gama-glutamil transferaz (GGT), aspartat aminotransferaz (AST), kan üre azotu (BUN) gibi, alanin aminotransferase (ALT), kreatin kinaz (CK) ve kreatinin değerlendirmeler kan testi kitleri üreticinin talimatları izleyerek, toplanan kan testi. 40,54

    Köpekler 5. Klinik Değerlendirme

    1. Bir video kamera ve kayıt köpek davranış ve yürüyüş ayarlayın. köpek notlandırma bu bir referans olarak hareket edecek şekilde köpek ile tüm karşılaşma kaydedin; Bu her video köpeğin yetenekleri ve istekleri doğrultusunda farklı uzunlukta olacağı anlamına gelir. Varsayılan kayıt parametrelerini kullanın. bu daha sonraki bir tarihte gözden geçirilmesi, böylece Çekimler derecelendirme kaydını oluşturur.
    2. Sınıf yürüyüş ve hareket bozuklukları.
      1. yürüyüş ve hareket bozuklukları için aşağıdaki notları kullanın:
        grade 1 = hiçbiri, arka bacak ile oturan sınıf 2 = genişletilmiş, grade 3 = arka bacaklarda ile tavşan-şerbetçiotu, derece 4 = karıştırma yürüyüş ve sınıf 5 = yürüyemiyor.
      2. gr grade 1 = hiçbiri,: hareketlilik bozukluğu için aşağıdaki notları kullanınade 2 = =, normalden daha fazla arka bacaklarda, sınıf 4 geçemiyoruz notu 3 = yatarak hareket zorluğu ve sınıf 5 = kalkmak ve dolaşmak mümkün artar.
    3. 15 m çalıştırmak için köpek ne kadar uzun zaman oldu. , 15 m dışarı ölçmek başlangıç ​​çizgisinde köpek koyun ve 15 m işareti kadar çalıştırmak için teşvik ediyoruz.
    4. Aşağıdaki derecelendirme ölçeği kullanılarak ekstremitenin kas atrofisi belirleyin:
      grade 1 = hiçbiri, sınıf 2 = şüpheli sertlik, grade 3 = sertlik hissetmek ya da sınıflar 3 ve 5 arasında ince notu 4 = görünür ve olabilir notu 5 = son derece ince veya sert.
    5. Sınıf aşağıdaki ölçek kullanılarak drooling: grade 1 = hiçbiri, evre 2 = yeme ya da içme ve evre 5 = sürekli saçmalamak zaman, sınıf 3 = bazı yeme saçmalamak ve içme, notu 4 = saçmalamak dizeleri otururken bazen tükürük sürüyor.
    6. dil (makroglossi) aşağıdaki ölçeği kullanarak Grade hipertrofisi: grade 1 = hiçbiri, derece 2 = biraz genişlemiş, grade 3 = genişletilmiş Ambassadore Hde Diş dizilerinin, grad 4 = genişlemiş ve hafif kalınlaştırılmış ve sınıf 5 = genişlemiş ve kalınlaşmış.
    7. Sınıf aşağıdaki ölçeği kullanılarak yutmak için köpeğin yeteneği: grade 1 = hiçbir zorluk, sınıf 2 =, çiğneme bir tabak, derece 4 = zorluk yiyecek alarak gıda, grade 3 = zorluk alarak yutma zaman ve çaba gerektirir, ya da içme yemek ve grade 5 = yapamaz.
    8. 55 (15 m koşu testi hariç) her kategoride puanları ekleyerek toplam notu hesaplayın.
      Not: önyargı tanıtmak şekilde değil çalışmalar kör olmalıdır.

    6. Manyetik Rezonans Görüntüleme (MRG)

    1. arka-bacaklarda T2 ağırlıklı görüntüler elde etmek için 3 Tesla (3T) MRG ve 18 cm çapında / 18 cm uzunluğunda insan ekstremite bobini kullanın.
    2. tiyopental 20 mg / kg CXMD köpekler enjekte hayvanların anestezisi. kurumasını gözleri önlemek için gözleri veteriner merhem kullanın. genel anestezi korumak için% 2-3 izofluran inhalasyon kullanın.
      1. kas refleksleri kontrol edin ve kalbi izlemek ve solunum hızı anestezi derinliğini değerlendirmek için. 95-100%, HR: 80 - Dakikada 120 vuruş (bpm: - RR: 20 nefes / dk, SpO 2 10 aşağıdaki gibi normal solunum hızı (RR), kalp atım hızı (KAH) ve genel anestezi altında SpO 2 olan ).
    3. T2 ağırlıklı görüntüler elde etmek için aşağıdaki ayarları kullanın: TR / TE = 4,000 / 85 msn, dilim kalınlığı = 6 mm, dilim boşluk = 0 mm, view = 18 cm alan x 18 cm, matris boyutu = 256 x 256, ve hızlı spin eko (Şekil 4) sırasında satın almalar = 3 sayısıdır.

    7. Kas Örnekleme ve Hazırlama (Nekropsi)

    Not: Kas Son AON enjeksiyonundan sonra bir ya da iki haftada bir örneklenir.

    1. 20 mg köpekleri enjekte / tiyopental sodyum kg onları uyutmak için. gözlerin kurumasını önlemek için anesthetization sırasında gözleri veteriner merhem kullanın.
    2. Anes korumak için izofluran inhalasyon% 3 - 2 kullanınhipestezi. kas refleksleri kontrol edin ve kalbi izlemek ve solunum hızı anestezi derinliğini değerlendirmek için. RR: aşağıdaki gibidir: Genel anestezi altında, normal solunum hızı (RR), kalp atım hızı (KAH) ve SpO2 olan 10-20 nefes / dk; SpO 2: 95 -% 100, HR: 80-120 bpm.
      1. (Nekropsi için) genel anestezi altında kansız bırakılarak köpekler öldürülür. Moleküler analiz kan kaynaklı faktörler (örneğin, kalp kasları) neden etkilerinden kaçınmak için derin genel anestezi altında kan kaybından kullanın.
    3. Teşrih aşağıdaki kaslar (Şekil 5): BT, ekstansör digitorum longus (EDL), gastroknemius, soleus, biceps femoris, rektus femoris, biseps, triseps braki, deltoid, ECU, ekstansör karpi radialis (ECR), fleksör karpi ulnaris (FCU ), fleksör karpi radialis (FCR), gracilis, interkostal, karın kasları, diyafram, yanal dorsi, yemek borusu, sternokleidomastoid ve kalp. toksisitesini incelemek için, böbrek ve li toplamakVer örnekler. Kullanım Evans ve diseksiyon tekniği 56 için bir referans olarak Alexander de Lahunta (2009).
    4. Kes CT, EDL, gastroknemius, soleus, biceps femoris, rektus femoris, biseps, triseps braki, deltoid, ECU, ECR, FCU, FCR, grasilis, interkostal, karın kasları, yan dorsi, yemek borusu, sternokleidomastoid, kalp, böbrek, ve küçük bölümler, yaklaşık 1 içine karaciğer - uzunluğunda 1,5 cm. Diyaframı yuvarlayın ve daha sonra 1 içine kesti - 1,5 cm bölümleri 56.
    5. mantar diskler üzerinde 1 cm kalınlığında - yaklaşık 0.5 olacak şekilde kitre sakızı yerleştirin. kitre zamkı karşı tarafta hayvanın kimlik ve kas adıyla etiket diskler.
    6. kitre zamkı içinde mantar dik onların boyuna ekseni ile kasları yerleştirin.
    7. sıvı nitrojen içinde oturan izopentan bir kap içinde mantarların yerleştirin. 1 dakika boyunca veya tamamen donmuş kadar cımbız ile sürekli olarak etrafında hareket ettirin. mantar mağaza kasları-80 ° C'de şişeler içinde. taşırken, kuru buz üzerinde şişeleri koydu.
    8. hayvan kimlik / kas adı ve tarihi ile etiketli cam slaytlar hazırlayın.
    9. Bir kriyostat -25 ° C'ye kadar soğutulmuş, stand mantar monte edin. istenilen seviyeye bölüm kalınlığı ayarlayın. immünohistokimya için 8 um ve hematoksilen ve eozin (HE) boyama 12 mikron kullanın. Western Blot örnekleri için 15 mm kullanın. Doğru kas örnekleme için düz bir kas elde etmek için kasın yaklaşık dörtte biri kesin.
    10. Planlama immünohistokimya için numune kullanmak veya HE boyama eğer bir defada kas bir bölüm Kesme, aynı cam slayt her 6. bölümüne yerleştirin. -80 ° C de, bir tüp ve deposunda 40 bölümleri - Western blotlar için örnek kullanılırsa, 30 koydu.
    11. Slaytlar hazırlanmasından sonra, slaytlar oda sıcaklığında 1.5 saat kuruması. Mağaza -80 ° C kayar.

    8. İmmünhistokimya

    1. depolama hazırlanan slaytlar çıkarın ve koyunBir nem odası ayrı slaytlar tutmak ve nemi korumak için. taban, sadece, su (su yaklaşık olarak 1 mm) ile kaplanır, böylece neme bölmesini doldurmak.
    2. Hava kuru 0.5 saat. hidrofobik bir bariyer kalem kullanarak slayt kas örneği kuşatan bir kare çizin.
    3. fosfat tamponlu salin (PBS) içinde% 15 keçi serumu ekleyin ve bloke edici ayıracı olarak, oda sıcaklığında 2 saat süreyle inkübe edin.
    4. (: 150 dilüsyon 1) köpek distrofin boyama önleyici distrofin çubuk alan (dis-1) fare monoklonal primer antikor veya C-terminali monoklonal antikor (dis-2) eklenir. PBS, 1.25 ml bir bloke etme maddesi kullanılarak seyreltilir. O / N buzdolabında 4 ° C inkübe edin.
    5. 5 dakika boyunca PBS ile yıkayın, üç kez tekrarlandı. (: 2,500 1) (dis-1) ya da IgG2 (dis-2), fare IgG1 karşı ikincil bir antikor Alexa 594 keçi antikoru ilave edin. PBS içinde bloke edici ayıracı fenol etoksilat oktil,% 0.1 ihtiva eden seyreltin. Oda sıcaklığında 0.5 saat süreyle inkübe edin.
    6. 5 dakika sonra, üç t PBS ile yıkayınimes. slayt kurumasını bekleyin. 2 damla 4 (3 ng / ml) ', 6-diamidino-2-fenilindol (DAPI), montaj çözeltisi - 1 eklenir. cımbız kullanarak, kabarcıklar kaçınarak, bölümlerin üstünden cam kayma yerleştirin.
    7. Görünüm dystrophin- (DYS-1 / DYS-2) 20X büyütme 594 nm'de floresan mikroskop altında pozitif lifler.

    9. Western Blot

    1. cryo-kesit buz üzerinde örnek tampon 150 ul için toplanan kas bölümleri ekleyin.
    2. bir el homojenleştirici kullanarak, kısa bir süre için, protein örnekleri homojenize. 5 dakika - 3, 95 ° C'de bir ısıtma bloğu inkübatör 1.5 ml bir tüp içinde ısı örnekleri. Santrifüj ve 15 dakika boyunca 16.500 x g'de supernatant toplamak.
    3. -70 ° C'de süpernatan saklayın alikotları. 100x sulandırmak için distile su kullanın.
    4. imalatçının protokolüne göre, ticari bir kit kullanarak protein konsantrasyonunu belirleyin. 3 dakika boyunca örnekleri ve ısı 2x Laemmli SDS-yükleme tamponu ekleyin ve# 160; 95 ° C de.
    5. 3'e Numuneleri - 150 V, 3 saat boyunca çalıştırmadan önce% 8 Tris-asetat jeli çok seyreltilmiş vahşi tip (WT) örnekleri dahil (örneğin,% 1,% 10 ve% 50) miktar tayini için. distrofin 1'den az ağırlıkça% seviyeleri bu yöntem ile tespit edilmelidir.
    6. 20 dakika boyunca katod tamponu içinde jel yerleştirin. ) Bu sırasıyla. Bu süre zarfında, filtre kağıdı dokuz adet almak ve katot tamponu [+], anot tampon ((transfer tamponlarda 3 bildiri koydu - - [] [], ve konsantre anot tampon hassasiyeti (Şekil 6) artan bir yarı-kuru bir aktarma yöntemi tarif etmektedir.
    7. 20 sn için, metanol içinde bir PVDF zarı emmek ve anot tamponu içinde yer.
      yarı-kuru transferi için membran ile jel kurmak ve RT veya soğuk bir odada 400 mA 1.5 saat çalışmasına izin.
    8. PBS ile membran yıkayın. 2 st için Tween 20 (PBST) ve% 5 süt tozu içeren PBS karışımı içinde membran inkübe edin.
    9. PBST DYS-1 (birincil antikor) seyreltin ve 1-5% süt tozu karışımı: 100 seyreltide kullanıldı. zara ekleyin ve en az 1 saat süreyle inkübe izin verin. Her biri 15 dakika süreyle 100 mL PBST ile üç kez yıkayın.
    10. 1 ile 65 ul / HRP ile konjüge edilmiş sekonder antikor (DYS1 anti-fare IgG2a) ve şerit ekleyin: 5000 seyreltme karanlık bir yerde, oda sıcaklığında 1 saat karıştırıldı. Daha sonra, 20 dakika boyunca 200 mi PBST ile üç kez yıkayın. yönlendirildiği gibi bir algılama kiti çözümlerini karıştırın. 1 dakika boyunca inkübe edin.
    11. Bantları algılar ve ImageJ yazılım 48,57,58 ile analiz filmi geliştirin.

Representative Results

In vitro deneyler

Miyoblastlar her AON etkinliğini karşılaştırmak amacıyla çeşitli 2'OMePS tedavi koşulları ile transfekte edildi. 600 nM'de Ex6A, Ex6B, Ex8A veya Ex8B her biri ile tek AON tedaviler 600 nM'de her 4 AON dizilerin her bir kokteyl tedavisi olarak, hem de yapıldı. RNA örnekleri, dört gün sonra transfeksiyon toplanmıştır. RT-PCR sonra, her muamele için örnekler işlenmemiş (NT) örnekleri ile birlikte jel üzerinde çalışıldı. Jel üzerinde yüksek bantlar out-of-frame DMD ürünlerini temsil eder; Bu bantlar NT, Ex8A görüldü ve Ex8B miyoblastları tedavi. Ex6A, Ex6B, Ex8A ve kokteyli ile tedavi edilen miyoblastlar çerçeve ürünleri göstermektedir. Ex8A sadece% 30 çerçeve ürünler (Şekil 7) gösterdi kokteyli ve Ex6A / B,% 100 çerçeve ürünleri göstermektedir. ekson atlama ve restorasyon onaylamak içinokuma çerçevesi, bir cDNA dizilimi yapılmıştır; 9 gerçekten (Şekil 7) atlanır olmuştu - sonuçları ekzon 6 belirtti. İmmünohistokimya AON ile tedavi edilen köpekler NT örneklerinde (Şekil 8) göre distrofin pozitif lifler arttığını gösterdi.

In vivo deneyler

Çeşitli AON tedavi koşulları verimliliğini karşılaştırmak için, CXMD köpekleri (0,5-5 yaş) 1.2 mg Ex6A veya farklı dozajlarda Ex6A, Ex6B ve Ex8A bir kokteyl ile bir kez enjekte edildi. İki hafta enjeksiyonundan sonra, kas örnekleri alındı ​​ve distrofin-pozitif elyaf sayısını karşılaştırmak için DYS-1 ile boyandı. Tüm kokteyli ile tedavi edilen örnekler NT örneklere göre artan distrofin ekspresyonu gösterdi. Distrofin pozitif lifler AON doz (Şekil 9) ile birlikte arttı. aşağıdaki sistemIC enjeksiyonu, vahşi tip (WT), NT, ve kokteyl ile muamele CXMD kas örnekleri Dys-1 (Şekil 10) ile boyanmıştır. Kokteyl ile muamele CXMD köpekler CT ve kalp kas örnekleri, hem NT CXMD köpeklere kıyasla distrofin ekspresyonunda artış gösterdi. Bununla birlikte, AON ile tedavi edilen iskelet kası (BT) ile muamele kalp kası ile karşılaştırıldığında distrofin daha yüksek ekspresyonu gösterdi. WT, NT, ve çeşitli morfolino kokteyli ile tedavi edilen kaslar karşılaştıran bir bağışıklık aynı sonuca yol açtı. Tedavi iskelet kası örneklerinde dystrophin ifade geniş bir ürün yelpazesi (Şekil 10) da vardı. Hematoksilen ve eosin (HE) boyama CXMD tedavi olduğunu göstermiştir Köpekler NT CXMD köpekler (Şekil 11) ile karşılaştırıldığında merkezi-çekirdekli liflerin (CNF) önemli bir azalma ile geliştirilmiş histopatoloji gösterdi. Bu NT köpek meydana daha dejenerasyon / rejenerasyon, distrofik kas patolojisi bir işareti olmadığını gösterir. Buna ek olarak, tedavi edilen köpekler daha hızlı vardıKlinik dereceleme ölçeğinde süreleri ve geliştirilmiş puanları koşuyor. Arıtılmış CXMD köpekler tüm kategorilerde NT CXMD köpekler (Şekil 12) daha iyi skorlar gösterdi.

Şekil 1
CXMD köpek ve ekzon 6 Şekil 1. mutasyon örneği -., Bir antisens kokteyl ile 8 Atlama Stratejileri CXMD köpekler distrofik köpek mRNA ekson 7'nin bir kaybına yol açan ekson 6 bir nokta mutasyonu vardır. Bu mRNA kaybolur dışı çerçeve ve distrofin proteini üretimi ile sonuçlanır. AON kokteyl ile tedavi edilen köpeklerde gri çubuk kısa AON dizileri temsil 8. - Kısa AON dizileri etkin bir 6 ekson atlama mRNA ekleme sonuçlanır 6 ve 8, ekson bağlamak için tasarlanmıştır. Ekson 9 menteşe alanını kodlar ve bazen kendiliğinden kısadır proteinler ancak işlevini distrofin için ekson 6 ve 8 karşı AON ile sonuçlanan mRNA kodları eklenmiş olanark. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

şekil 2
1 yaşındaki Canine X'e bağlı Musküler Distrofi (CXMD) Animal Şekil 2. Başlıca Klinik belirtiler. A 1 yaşındaki vahşi tip beagle ve CXMD köpek gösterilir. proksimal, uzuv ve temporal kasların tutulumu genellikle 2 aylıktan itibaren gözlenir. Eklem kontraktürü ve pelvis bir değişen yaş 4 ay açık bulunmaktadır. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
) Intramuscul bir köpek. A Şekil 3. Genel Anesteziar enjeksiyonlar ve kas biyopsileri izofluran ile genel anestezi altında yapılmaktadır. B) Sistemik enjeksiyonlar için hayvanın Holding. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 4,
Yabani-tip Şekil 4. Manyetik Rezonans Görüntüleme (MRI), CXMD işlenmemiş ve CXMD tedavi. Arka bacak MRG 3 ay VT ve NT CXMD köpeklerde 5 ay. ve AON sonrası enjeksiyon (ilk enjeksiyondan önce 1 hafta) tedavi CXMD arka bacak MRG öncesi iki örnek resimler gösterilir. 2703MA 200 mg / kg bir kokteyl morpholinos 7x haftalık muamele edilmiştir. 2001MA 120 mg / kg bir kokteyl morpholinos 5x haftada IV enjeksiyon ile muamele edilmiştir. Kontrol ve tedavi köpekler yaş olarak eşleştirilmiş edildi. Arıtılmış köpekler T2 sinyalleri azalma göstermektedir. Görüntüler adap vardır Yokota ve ark izniyle ted. (copyright 2009, John Wiley & Sons) 40 bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 5,
Şekil 5. Kas Köpek. A Biyopsi Prosedürü) bir alt ekstremite kas biyopsisi için sabittir. B) forseps yardımıyla, alt ekstremite tutulur. C) BT kas maruz kalmaktadır. Açık biyopsi tekniği enjekte sitelerin kas örnekleri elde etmek için kullanılır. Konu biyopsi örnekleri tutmak için kullanılır. Diseksiyonu sonrası kitre zamkı D) Kas örnekleri. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

/53776/53776fig6.jpg "/>
Şekil 6. Yarı-kuru Transfer Metodu. Western blot yarı kuru transfer yönteminin bir temsili sunulmuştur. Konsantre anot tampon batırılmış üç kağıtları negatif ucundan aşağı koyulur; anot tampon batırılmış 3 bildiri bunun üzerine dizilir. MB PVDF kağıt 6 kağıtları üzerine yerleştirilir önce ve sonra metanol ve anot tamponu içinde ıslatılır. katot tampon batırılmış olan jel, PVDF kağıt üzerinde hafifçe yatırılır. Son olarak, katod tamponu ile ıslatılmış 3 kağıt jel üzerine serilir. pozitif terminali üstünde yer almaktadır. 1 saat, mA sistemi aracılığıyla çalıştırılır 400. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 7,
Şekil 7. CXMD miyoblastların de ekson Atlama. ve ark. Izniyle uyarlanmıştır (telif hakkı 2009 John Wiley & Sons) 40. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 8,
Şekil 8. Artan Dystrop2'O-metillenmiş fosforotioat (2'OMePS) 'de hin ifadesi nakil CXMD miyoblastlar. CXMD miyoblastlar, tek başına Ex6A veya kokteyl 2'OMePS ile transfekte edilmiştir. DYS-2 (kırmızı) ve DAPI (mavi) boyama gösterilmiştir. tedavi miyoblastlar vahşi tip (WT) ve tedavi edilmeyen (NT) iskelet hücreleri karşılaştırılmıştır. Görüntüler Yokota ve ark izni ile uyarlanmıştır. (Copyright 2009, John Wiley & Sons) 40. Bar = 50 um. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 9,
İntramüsküler yalnız CXMD Köpekler. Ya Ex6A içinde morpholinos arasında enjeksiyonları veya Ex6A, Ex6B ve Ex8A bir kokteyl ile distrofin İfade Şekil 9. Kurtarma CXMD köpeklerin BT kas içine enjekte edildi. yabani tip Distrofin (DSY-1) boyama(WT), (NT) muamele edilmemiş, ve işlenmiş CXMD köpekler gösterilmiştir. Köpekler, ya tek başına 1.2 mg Ex6A veya 1.2 mg kokteyli ile tedavi edildi. Görüntüler Yokota ve ark izni ile uyarlanmıştır. (Copyright 2009, John Wiley & Sons) 40. Bar = 100 mikron. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 10,
CXMD köpekler. Distrofin sistemik kokteyl Morfolino Tedavi (dis-1) sonra, Şekil 10. Artan distrofin ekspresyonu boyama, (NT) (negatif kontrol) muamele edilmemiş, vahşi tip (WT) (pozitif kontrol) distrofin ifade karşılaştırmak için kullanıldı ve CXMD köpek / kg morfolino kokteyli (her AON'in 40 mg / kg), 120 mg. morfolino kokteyli Ex6A, Ex6B ve Ex8A ihtiva etmiştir. Köpekler damardan 5 kez enjekte edildi bizBu kokteyl ile ekly. A) distrofin WT, NT kranial tibia (BT) kaslarda ifade ve tedavi edilen köpeklerde karşılaştırılması. B) NT ve morfolino kokteyli ile tedavi edilen köpekler arasında kalp dokusunda distrofin ifade bir karşılaştırması. bir yükleme kontrolü olarak desmin ile distrofin C) İmmünoblot WT, NT, ve morfolino kokteyli ile tedavi edilen köpekler için gösterilir. Aşağıdaki kasları tedavi köpekler için gösterilmiştir: triceps brachii (TB), biseps (BB), diyafram (DIA), özofagus (ESO), BT, adduktor (ADD), ekstansör digitorum longus (EDL), masseter (MAS), ve kalp. Görüntüler Yokota ve ark izni ile uyarlanmıştır. (Copyright 2009, John Wiley & Sons) 40. Bar = 200 mikron. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 11,
şekilCXMD Köpeklerde Histopatolojisi Geliştirilmiş 11. 240 mg / kg Morfolino Kokteyli ile 7 hafta boyunca tedavi. Yarım yıl beş yaş arasında değişen CXMD köpekler kez 240 mg / kg morfolino kokteyl (Ex6A, Ex6B ve Ex8A) intravenöz 7 hafta boyunca haftada. Ondört gün son enjeksiyondan sonra, yemek borusu kasları alındı ​​ve hematoksilen ve eozin (HE) boyama yapıldı. HE olmayan tedavi (NT) gelen yemek borusu kas boyama ve morfolino kokteyl ile tedavi edilen (Tedavi) CXMD köpekleri (40X objektif lens). Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 12,
Klinik Vermedeki üzerinde Şekil 12. Geliştirilmiş Skorlar ve Morfolino Tedavisi. Morfotmo tedavi edilen köpeklerde sonra Çalışma Süresi 15 m olmayan tedavi (NT) yavru ile karşılaştırılmıştırs. Grafikteki Hata çubukları SEM'i göstermektedir. A) Klinik tasnif sınav Toplam skor tedavi öncesi ve sonrası hesaplandı ve tedavi edilen hayvanların NT littermates ile karşılaştırıldı. B) ile muamele edilmiş ve NT köpeklerin 15 m yürütülmesini kez bir karşılaştırması. B'ye benzer ° C); Ancak, genç köpekler kullanıldı. Görüntüler Yokota ve ark. Izniyle uyarlanmıştır (telif hakkı 2009 John Wiley & Sons) 40. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Antisens oligonükleotit Nükleotid Dizisi
Ex6A GTTGATTGTCGGACCCAGCTCAGG
Ex6B ACCTATGACTGTGGATGAGAGCGTT
Ex8A CTTCCTGGATGGCTTCAATGCTCAC

Tablo 1. Anti-duyu oligonükleotid tasarımı.

Discussion

Ekzon atlatma DMD tedavisi için gelecek vaat eden bir tedavi yöntemidir. Hem in vitro ve in vivo deneylerde, çok-ekzon atlatma mümkün olduğunu göstermiştir. Burada, CXMD köpek modelinin kullanımı ele alınmaktadır. 2'OMePS AON kimyası CXMD miyoblast transfeksiyon ve morfolino AON omurga kimyası in vivo deneyler için seçilmiştir kullanıldı 8 - İlk olarak, AON'ler distrofin Ekson 6 hedeflemek için kurtarma-ESE ve ESEfinder programları kullanılarak dizayn edilmiştir. vPMOs modifiye edilmemiş PMOS daha verimli olan ancak daha yüksek bir toksisite nedeniyle sistemik enjeksiyonlar için uygun değildir. RNA ekstraksiyonu, RT-PCR ve cDNA dizileme CXMD miyoblastların üzerinde gerçekleştirilmiştir. PMO kokteyl enjekte Köpekler klinik semptomlar herhangi bir iyileşme değerlendirmek için klinik kademeli idi. Köpekler insanca kurban edilmiştir sonra kas örnekleri alındı ​​ve kriyo-ayırma için hazırlandı. A tarafından uyarılan distrofin proteininin yarım ömrü2 ay - ons yaklaşık 1 olduğuna inanılıyor. Bu deneyler, neonatal köpekler ve (5 yaşında>) yaşlı köpeklerde ile yapılabilir, ancak küçük, yetişkin köpekler, bu çalışmada kullanılmıştır. Hazırlanan kas bölümleri histopatolojik değerlendirilmesi ve Western blot ve immünohistokimyasal 48 ile distrofin proteini kurtarma değerlendirmek için kullanıldı.

PMO çözeltinin hacmi enjeksiyonu önce doğru olduğundan emin olmak için önemlidir; Bunu yapmak için başarısız sonuçlarla üzerinde önemli etkileri olacaktır. kas içi enjeksiyonlar sırasında, yeterli basınç ve kas liflerini girmek için gereklidir. Köpek sağlığı ve cerrahi sitenin denetim izleme, sorun giderme için önemlidir. hayvan sağlığını izlemek için, haftalık kan testleri ve tartı yapılmalıdır. hayvan ve kas numune hazırlama euthanization sonra distrofin proteini tespit hassasiyeti sağlamak için kritik bir aşama Tris-asetat jel ve yarı kuru emme yöntemi hem kullanmaktırWestern lekeleme prosedürü esnasında.

Örnek sonuçlar gösterildiği gibi, miyoblastlar çerçeve DMD ürünler imal Ex6A, Ex6B, Ex8A ve kokteyl (Ex6A, Ex6B, Ex8A ihtiva eden ve Ex8B) ile muamele edilmiştir. Ex8B ekson-atlanan ürünler imal yana, bu in vivo deneylerde daha sonra kullanılmamıştır. 9 atlama meydana gelmiş ve DYS-2 boyanma ile immünsitokimya tedavi numunelerde distrofin ifade restore gösterdi - cDNA sıralama ekzon 6 gösterdi. AON ile tedavi edilen köpekler distrofin pozitif lifler önemli bir artış göstermiştir. 8 atlanmış ediliyordu ve kısaltılmış bir protein üretildi - Bu ekzon 6 belirtir. Distrofin pozitif elyafların miktarı AON'lere bir kokteylinin kullanıldığı zaman artan AON doz ile orantılıdır. Imünoblotların sistemik morfolino tedavi edilen köpeklerde distrofin ifade artış gösterdi. İskelet kas distrofin liflerinin değişken düzeyleri; Bununla birlikte, morfolino-muamele edilmiş kalp dokusu küçük gösterdidystrophin ifade gelişme. Distrofin yüksek bir moleküler ağırlığa (427 kDa) sahip olduğu için, distrofin düşük miktarlarda tespiti zor olabilir. En iyi sonuçlar için, Tris-asetat jeli ve yarı-kuru transfer yöntemi kullanılmıştır. HE morfolino-tedavi edilen köpeklerde geliştirilmiş histopatoloji gösterdi boyama. Merkezi-çekirdekli fiberler (CNFs) sağlıksız kas bir göstergesidir ve kas dejenerasyonu ve yenilenme döngülerini temsil etmektedir. Morfolino-muamele CXMD köpekler işlenmemiş CXMD köpeklere kıyasla CNFs yüzdesinde bir azalma olduğunu gösterdi. Klinik not örneğin morfolino-tedavi edilen hayvanlarda artmıştır yürüyüş ve koşu yeteneği gibi semptomların bir iyileşme göstermiştir. Kas sertliği, böylece, bu derecelendirme şeması 59 dahil kas atrofisi, yansıttığına inanılır. uyluk (arka bacak) kasların sertliği değerlendirildi; Onlar CXMD içinde hipertrofisi ziyade atrofi gösterirler çünkü ancak, biz kafatası sartorius kasları hariç. Arıtılmış köpekler göstermekalt sınıflandırma puanları ed ve 15 m koşu testinde hızlı kez vardı. 15 m testi Geliştirilmiş kez gelişmiş kas fonksiyonu 40 göstergesidir. Yüksek genel sınıflandırma skorları kötü sağlık ve artan kas atrofi göstermektedir.

bu sonuçlar umut verici olmakla birlikte, çok ekson atlama hala teknik klinik uygulanabilirliği vardır önce üstesinden gelinmesi gereken birçok zorluklar getirmektedir. Kardiyak doku nedeniyle hala kalp ve iskelet doku arasındaki hücresel ticaretine farkı AON, muhtemelen azalmış alımını gösterir. Toksik etki mevcut dozaj rejimleri altında hayvanların gözlenmiştir; AON kokteyl kullanımı, klinik denemelere hareket etmeden önce, ancak, daha fazla iş uzun dönemli bir toksisite değerlendirmek için yapılması gerekmektedir. Düzenleyici kurumlar benzersiz bir ilaç olarak her AON dizisi tanımlamak için AON kokteyl ilaçların rızasını kazanmak zordur. Bu bir kokteyl her dizi ayrı ayrı Safet için test edilmesi gerekir demektiry daha fazla zaman ve para gerektiren. klinik bir ortamda çok ekson atlama kullanımı için başka bir bariyer bilinmeyen işlevleri olan üretilen ara protein ürünlerinin büyük bir miktardır. Bu proteinler, potansiyel olarak tek tek mutasyona 22 bağlı olarak, önceden tahmin edilemeyen yan etkilere neden olabilir. Ayrıca, mevcut distrofik köpek modelleri içinde mevcut mutasyon desenleri sınırlıdır. Az sayıda doğal olarak oluşan mutasyonlar ve tüm mutasyonlar, çok ekson atlama çalışmak için yararlı değildir. Distrofik domuz modeli gelecek DMD ekson çalışmaları 33, 34 atlama için iyi bir alternatif olmayı vaat ediyor.

DMD köpek modelleri diğer DMD modeller üzerinde bazı avantajları var. Daha büyük bir hayvan modeli, klinik sınıflandırma olmak ve MRG daha detaylı analiz için izin mümkündür. köpekler, büyük hayvanlar olduğu da toksikolojik çalışmalar için daha uygundur ve daha yakın fare modeli ile karşılaştırıldığında, insan hastalığı gösterir. köpek mMODELLERİ ayrıca insanlarda 23, 34, 45 daha benzer DMD gen dizileri var.

Teknik açıdan zor olsa da, çoklu-ekson atlama yaklaşım sonuçta DMD hastalarının 24>% 90 yararlanabilir. Tek ekson atlama hastaların küçük bir alt kümesi için geçerlidir bu, o tek ekson atlama için çok daha iyi bir alternatif haline getirmektedir. Buna ek olarak, çoklu-ekson atlama kısaltılmış distrofin protein işlevselliğini optimize silme desenleri seçmek için bize sağlayacaktır. 55 derece hafif belirtileri veya asemptomatik bireylerde 14,19,60-63 ile ilişkilidir - örneğin, DMD silinmesi 45 ekzon. Ekzon 45 çoklu ekzon atlatma - 55 daha önce vPMOs 22,26 sistemik enjeksiyonları bir ekson 52 delesyon (mdx52) ile DMD bir fare modelinde gösterilmiştir. Kokteyl vPMOs kullanımı da kas distrofisi diğer formları, örneğin kanıtlanmıştırFukuyama konjenital müsküler distrofi (FCMD) olarak. FCMD olarak anormal mRNA bölünmesi retrotranspozon girişinin sebep olduğu edildiği ekson yakalama, kaynaklanır. vPMOs hem bir FCMD fare modelinde ve insan hücre çizgileri 64 uç uca birleşen şeklinin kurtarmak için gösterilmiştir. yüksek etkinlik ve düşük toksisite sergileyen yeni nesil AON kimyaları klinik uygulama içine çok ekson atlama yaklaşımının etkili çevirisini kolaylaştıracaktır. Buna ek olarak, çok-ekzon atlatma potansiyel olarak disferlinopatilerin 24, 65 gibi başka genetik bozukluklar, tatbik edilebilir.

Materials

Name Company Catalog Number Comments
2'OMePS Transfection of Dog Myoblasts 
3 ml 6-well plates IWAKI 5816-006
Dulbecco’s modified Eagle’s medium (DMEM)  Gibco 11965-092
Fetal bovine serum (FBS)  HyClone SH30071.01
Penicillin  Sigma-Aldrich  P4333  200 U/ml 
Lipofectin  Invitrogen  18292-011 Total volume of 100 ml in opti-MEM media at a ratio of 2:1 for lipofectin. 
10 ml lipofectin for 5 mg RNA. 
2’OMePS Eurogentec  Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC). 
Horse Serum  Gibco 16050-114 2%
streptomycin  Sigma-Aldrich P4333  200 μg/ml
Bovine serum albumin (BSA)  Sigma-Aldrich A9418 
Insulin
Morpholino transfection of dog myoblasts
All material from MePS Transfection of Dog Myoblasts for culturing
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
Endo-Porter Gene-tools
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
Chloroform Sigma-Aldrich P3803 200 μl 
1.5 ml Tubes  Eppendorf 22363204
Centrifuge  Beckman-Coulter
75% Ethanol  Sigma-Aldrich 34852
UV Spectrometer 
Forward primer in exon 5  Invitrogen CTGACTCTTGGTTTGATTTGGA                          
1.5 μl 10 μM
Reverse primer in exon 10  Invitrogen TGCTTCGGTCTCTGTCAATG                            
1.5 μl 10 μM
dNTPs Clontech 3040
One-Step RT-PCR kit  Qiagen  210210
Thermo-cycler Scinco
Complementary DNA (cDNA) Sequencing 
Gel extraction kit  Qiagen  28704
Centrifuge 
Terminator v3.1 Cycle Sequencing Kit  Applied Biosystems  4337454
Intramuscular injections or open muscle biopsy
Surgical Tools Scissors, scalpel, needle, surgical thread 
Vet Ointment 
Iodophors  webtextiles 12190-71-5
chlorohexidine Peridex 12134
Surgical Drapes 
Scrubs
Facial Mask 
Surgical Gloves 
Head Covering 
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
27 G Needles TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225
buprenorphine hydrochloride
Tongue Depressor 
cephalexin 15 to 30 mg/kg 
cefazolin 15 to 30 mg/kg 
buprenorphine  0.01 mg/kg
buprenorphine hydrochloride  0.02 mg/kg
Systemic Injections
Syringe infusion pump  Muromachi 
22 G Indwelling needles TERUMO SG3-2225 
27 G Needles  TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225 
Saline Ohtsuka-Pharmaceutical 28372
Clinical Grading of Dogs
Video Camera 
Stop watch 
Magnetic resonance imaging (MRI) 
3 Tesla MRI l 
18 cm diameter/18 cm length human extremity coil
Muscle sampling and preparation (necropsy)
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Tragacanth gum 10-20 ml
Liquid Nitrogen 
Cork Discs Iwai-kagaku  101412-806
Dry Ice
Tweezers
Poly-L-lysine–coated slides Fisher 22-037-216
Cryostat Microsystem  Leica  cm1900 
Immunohistochemistry 
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
DYS2 Novocastra  NCL-DYS2  1:150 dilutions
Alexa 594 goat antimouse IgG1  Invitrogen A-21125 1:2,500 dilutions
Alexa 594 goat antimouse IgG2  Invitrogen A-11005 1:2,500 dilutions
DAPI  Invitrogen D1306 Contains mounting agent
Goat Serum  Invitrogen 10000C 15%
PBS
Moisture chamber  Scientific Devise Laboratory  197-BL
Chamber slide  Lab-tek  154453
Cover Glasses  Fisher 12-540A
Hydrophobic barrier pen 
Fluorescent microscope  594 nm at 20X magnification. 
Western Blotting 
Distillied Water 
Hand Homogenizer 
2× Laemmli SDS-loading buffer  0.1 M Tris–HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue 
SDS gels  Bio-Rad  161-1210 5% resolving
SDS gels Invitrogen  Invitrogen, WG1601BOX 3-8%
PVDF membrane  GE 10600021
Methanol
Running buffer (10×)  250 mM of Tris-Base, 1,920 mM of Glycine
Running buffer (1×) 10% 10× buffer, 20% methanol 
0.05% PBS/Tween 20 (PBST)  2,000 ml              
3× 200 ml for washing
PBST/5% milk powder  100 ml
Protein Assay Kit BCA T9650
Tween 20  Sigma  P5927
Urea Sigma  U5378
Beta Mercaptoethanol  Millipore ES-007-E
SDS Sigma L3771
Tris-Acetate Sigma
Tris HCl Sigma T3253
Glycerol Sigma G8773
Loading/sample buffer for Western blotting NuPage Invitrogen NP007
NaCl Sigma S3014
PMSF Sigma P7626
Protease cocktail inhibitor  Roche 11836153001
Cathode Buffer 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer 0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer 0.3 M Tris base + 20% Methanol
desmin antibody  Abcam ab8592
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
ImageJ Software

DOWNLOAD MATERIALS LIST

References

  1. Duchenne, A. The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J. 14, (2), 541-542 (1867).
  2. Zellweger, H., Antonik, A. Newborn screening for Duchenne muscular dystrophy. Pediatrics. 55, (1), 30-34 (1975).
  3. Echigoya, Y., Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 24, 57-68 (2014).
  4. Bushby, R. F., Birnkrant, D. J., et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology. 9, (1), 77-93 (2010).
  5. Eagle, M., Baudouin, S. V., Chandler, C., Giddings, D. R., Bullock, R., Bushby, K. Survival in Duchenne muscular dystrophy: improvements in life expectancy since 1967 and the impact of home nocturnal ventilation. Neuromuscul. Disord. 12, (10), 926-929 (2002).
  6. Heald, A., Anderson, L. V., Bushby, K. M., Shaw, P. J. Becker muscular dystrophy with onset after 60 years. Neurology. 44, (12), 2388-2390 (1994).
  7. Stöllberger, C., Finsterer, J. Worsening of heart failure in Becker muscular dystrophy after non-steroidal anti-inflammatory drugs. Med. J. 98, (4), 478-480 (2005).
  8. Passamano, L., et al. Improvement of survival in Duchenne Muscular Dystrophy: retrospective analysis of 835 patients. Acta Myol. 31, (2), 121-125 (2012).
  9. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, (6), 919-928 (1987).
  10. Koenig, M., et al. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50, (3), 509-517 (1987).
  11. Takeshima, Y., et al. Mutation spectrum of the dystrophin gene in 442 Duchenne/Becker muscular dystrophy cases from one Japanese referral. JHG. 55, (6), 379-388 (2010).
  12. White, S. J., et al. Duplications in the DMD gene. Hum. Mutat. 27, 938-945 (2006).
  13. Yokota, T., Duddy, W., Echigoya, Y., Kolski, H. Exon skipping for nonsense mutations in Duchenne muscular dystrophy: too many mutations, too few patients. Expert Opin. Biol. Ther. 12, (9), 1141-1152 (2012).
  14. Yokota, T., Duddy, W., Partridge, T. Optimizing exon skipping therapies for DMD. Acta Myol. 26, (3), 179-184 (2007).
  15. Magri, F., et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol. 258, (9), 1610-1623 (2011).
  16. Yoshida, H. H., Ishikawa-Sakurai, M. Biochemical evidence for association of dystrobrevin with the sarcoglycan- sarcospan complex as a basis for understanding sarcogly- canopathy. Hum. Mol. Genet. 9, (7), 1033-1040 (2000).
  17. Bies, R. D., Caskey, C. T., Fenwick, R. An intact cysteine-rich domain is required for dystrophin function. J. Clin. Invest. 90, (2), 666-672 (1992).
  18. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2, (1), 90-95 (1988).
  19. Aoki, Y., Yokota, T., Wood, M. J. Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int. 2013, (402369), (2013).
  20. Cirak, V. A. -G., Guglieri, M., et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. The Lancet. 378, (9791), 595-605 (2011).
  21. Goemans, N. M., et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 364, (16), 1513-1522 (2011).
  22. Echigoya, Y., et al. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol Ther Nucleic Acids. 4, (2015).
  23. Hoffman, E. P., et al. Restoring dystrophin expression in Duchenne muscular dystrophy muscle progress in exon skipping and stop codon read through. Am J Pathol. 179, (1), 12-22 (2011).
  24. Aartsma-Rus, A., et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 74, (1), 83-92 (2004).
  25. Aartsma-Rus, A., Kaman, W. E., Weij, R., Tden Dunnen, J., van Ommen, G. J., van Deutekom, J. C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol. Ther. 14, (3), 401-407 (2006).
  26. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109, (34), 13763-13768 (2012).
  27. McClorey, G., Iversen, P. L., Moulton , H. M., Fletcher, S., Wilton, S. D. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13, (19), 1373-1381 (2006).
  28. Sharp, N. J., et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 13, (1), 115-121 (1992).
  29. Shimatsu, Y., et al. Canine X-linked muscular dystrophy in Japan (CXMDJ). Exp Anim. 52, (2), 93-97 (2003).
  30. Nguyen, F., Cherel, Y., Guigand, L., Goubault Leroux, I., Wyers, M. Muscle lesions associated with dystrophin deficiency in neonatal golden retriever puppies. J Comp Pathol. 126, (2-3), 100-108 (2002).
  31. Nakamura, A., Takeda, S. Mammalian models of Duchenne Muscular Dystrophy: pathological characteristics and therapeutic applications. J Biomed Biotechnol. 2011, (184393), (2011).
  32. Yokota, T., et al. A renaissance for anti-sense oligonucleotide drugs in neurology: Exon-skipping breaks new ground. Arch. Neurol. 66, 32-38 (2009).
  33. Aartsma-Rus, A., et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 30, (3), 293-299 (2009).
  34. Yu, X., Bao, B., Echigoya, Y., Yokota, T. Dystrophin-deficient large animal models: translational research and exon skipping. Am. J. Transl. Res. 7, (8), 1214-1231 (2015).
  35. Yin, H., Moulton, H., Betts, C., Wood, M. CPP-directed oligonucleotide exon skipping in animal models of Duchenne muscular dystrophy. Methods Mol Biol. 683, 321-338 (2011).
  36. Moulton, H. M., Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta. 1798, (12), 2296-2303 (2010).
  37. Morcos, P. A., Li, Y., Jiang, S. Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques. 45, (6), 613-614 (2008).
  38. Betts, C., et al. A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Mol Ther Nucleic Acids. 14, (1), e38 (2012).
  39. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5, (8), e12239 (2010).
  40. Yokota, T., et al. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol. 65, (6), 667-676 (2009).
  41. Melacini, P., et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromuscul. Disord. 6, (5), 367-376 (1996).
  42. Guncay, A., Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have we come and what does the future hold. Future Med. Chem. 7, (13), 1631-1635 (2015).
  43. Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Research Council (US) Committee on Pain and Distress in Laboratory Animals. Distress in Laboratory Animals . National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK32658 (1992).
  44. Guide for the Care and Use of Laboratory AnimalsPhysical Restraint. National Research Council (US) Institute for Laboratory Animal Research. National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050 (1996).
  45. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science. 297, 1007-1013 (2002).
  46. Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).
  47. Fairbrother, W. I. 11, Goldstein, P. RESCUE-ESE Web Server. MIT Burge Lab. Available from: http://genes.mit.edu/burgelab/rescue-ese/ (2016).
  48. Yokota, T., Hoffman, E., Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 709, 299-312 (2011).
  49. Jenuth, J. P. The NCBI. Publicly available tools and resources on the Web. Methods Mol Biol. 132, 301-312 (2000).
  50. Yokota, T., et al. Extensive and Prolonged Restoration of Dystrophin Expression with Vivo-Morpholino-Mediated Multiple Exon Skipping in Dystrophic Dogs. Nucleic Acid Ther. (2012).
  51. Summerton, J. E. Endo-Porter: a novel reagent for safe, effective delivery of substances into cells. Ann. N. Y. Acad. Sci. 1058, 62-75 (2005).
  52. Mangram, A. J., et al. Guideline for Prevention of Surgical Site Infection. Am J Infect Control. 27, 97-134 (1999).
  53. Reichman, D. E., Greenberg, J. A. Reducing Surgical Site Infections. A Review . Rev Obstet Gynecol. 2, 212-221 (2009).
  54. Mizuno, H., Nakamura, A., Aoki, Y., Ito, N., Kishi, S., Yamamoto, K., Sekiguchi, M., Takeda, S., Hashido, K. Identification of muscle-specific microRNAs in serum of muscular dystrophy animal models: promising novel blood-based markers for muscular dystrophy. PloS one. 6, (2011).
  55. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 145-154 (2005).
  56. Evans, H., de Lahunta, A. Guide to the Dissection of the Dog. SAUNDERS. (2009).
  57. Girish, V., Vijayalakshmi, A. Affordable image analysis using NIH Image/ImageJ. Indian J Cancer. 41, (47), (2004).
  58. Bearer, E. L., et al. Overview of image analysis, image importing, and image processing using freeware. Current protocols in molecular biology. 14, (2003).
  59. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 24, 145-1454 (2005).
  60. Beroud, C., et al. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 28, 196-202 (2007).
  61. Ferreiro, V., et al. Asymptomatic Becker muscular dystrophy in a family with a multiexon deletion. Muscle Nerve. 39, 239-243 (2009).
  62. Nakamura, A., et al. Follow-up of three patients with a large in-frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci. 15, 757-763 (2008).
  63. Yokota, T., Pistilli, E., Duddy, W., Nagaraju, K. Potential of oligonucleotide-mediated exon-skipping therapy for Duchenne muscular dystrophy. Expert Opin Biol Ther. 7, 831-842 (2007).
  64. Taniguchi-Ikeda, M., et al. Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy. Nature. 478, 127-131 (2011).
  65. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3, 144-176 (2013).
Köpek X-bağlantılı Musküler Distrofi Kokteyl Antisens oligonükleotidleri kullanılarak atlanıyor Çok ekson
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).More

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter