Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

måling af doi: 10.3791/54581 Published: February 22, 2017

Abstract

HIV-1-kappeproteiner engagere beslægtede receptorer på målcellen overflade, hvilket fører til viral-cellemembranen fusion efterfulgt af frigivelsen af ​​det virale capsid (CA) kerne ind i cytoplasmaet. Efterfølgende den virale reverse transkriptase (RT), som en del af en navnebror nukleoprotein kompleks betegnes revers transkription Complex (RTC), konverterer det virale enkeltstrenget RNA-genom ind i en dobbeltstrenget DNA-kopi (vDNA). Dette fører til biogenesen af ​​anden nukleoprotein kompleks, betegnet præ-integration komplekset (PIC), sammensat af vDNA og associerede virusproteiner og vært faktorer. PIC-associeret viral integrase (IN) orchestrates integrering af vDNA i værtens kromosomale DNA i en tidsmæssigt og rumligt reguleret totrinsproces. For det første har i processer 3'-enderne af vDNA i cytoplasmaet, dels efter PIC trafikker til kernen, den medierer integration af det forarbejdede vDNA i det kromosomale DNA. De ansvarlige isoleretfra målceller akut inficeret med HIV-1 er funktionelle in vitro, da de er kompetente til at integrere den tilknyttede vDNA til et exogent tilsat heterologt mål-DNA. En sådan PIC-baserede in vitro integration analyser har bidraget væsentligt til at afgrænse de mekanistiske detaljer i retroviral integration og til at opdage IN hæmmere. I denne rapport, vi uddybe en opdateret HIV-1 PIC assay, der anvender en indlejret real-time kvantitativ polymerasekædereaktion (qPCR) -baseret strategi til måling af in vitro-integration aktivitet af isolerede indfødte ansvarlige.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HIV-1-replikation i målcellen involverer flere trin, generelt inddeles i to faser: tidlige og sene begivenheder. De tidlige begivenheder begynder, når HIV-1 sekventielt binder til målet celleoverfladereceptoren CD4 og en af de to co-receptorer (CCR5 eller CXCR4) 1. Følgelig virus-celle membraner lunte, og det virale capsid (CA) kerne frigives til cytoplasmaet 2. CA kerne indeholder det virale genomiske enkeltstrenget RNA (ssRNA) og adskillige proteiner, både virale og cellulære oprindelse. Ca-associerede virale proteiner indbefatter revers transkriptase (RT) og integrase (IN), to enzymer, der medierer kritiske trin i de tidlige begivenheder i virusreplikation. RT og IN-funktionen i forbindelse med nukleoprotein komplekser, nemlig revers transkription Complex (RTC) og præ-integration komplekset (PIC), henholdsvis 3, 4, 5 <sup>, 6. Enderne af det virale genom ssRNA harbour terminale gentagelse (R) elementer støder op til de unikke sekvenser U5 (ved 5'-enden) og U3 (ved 3 'enden). RTC konverterer det virale ssRNA genomet i en dobbeltstrenget (ds) DNA-kopi (vDNA). Denne revers transkription proces resulterer også i overlapning af U5 og U3 sekvenser, hvorved der genereres lange terminale gentagelser (LTR) ved begge ender af vDNA 7, 8. Efterfølgende PIC-associerede IN katalyserer to sekventielle biokemiske reaktioner, der muliggør integrationen af vDNA i værtskromosomet 9, 10, 11. Først, i cytoplasmaet, IN multimerer engagere både LTR'er 12 og spalte en dinukleotid fra hver af de 3'-terminale ender. Dette 3'-end behandling genererer en hydroxylgruppe ved hver 3'-ende (CA OH) i vDNA.Dernæst PIC trafikker til kernen, hvor i anvender vDNA CA OH som en nukleofil til at skære begge strenge af det kromosomale DNA i en forskudt måde. Samtidig IN splejsninger koordineret begge ender af vDNA til de resulterende phosphodiesterbindinger på modsatte strenge af det kromosomale DNA. Efter denne streng transfer trin, værtscellen maskiner fjerner to uparrede nukleotider i 5'enderne af vDNA og reparationer de følgende enkeltstrengede huller ved krydset af integrationen site. De tidlige begivenheder således kulminere med etableringen af ​​et integreret DNA-kopi (provirus) af HIV-1-genomet. Proviruset tilvejebringer et egnet miljø for effektiv viral genekspression, som initierer senere begivenheder, herunder ekspressionen af ​​virus-kodede proteiner; samling af umodne virus; og spirende, frigivelse, og modning i infektiøse viruspartikler 13.

Renset rekombinant retroviral IN er kompetent til atudføre, in vitro, både 3'-end forarbejdning og streng transferaktiviteter på eksogent leveret LTR-lignende substrat DNA. Biokemiske undersøgelser under anvendelse sådan oprenset rekombinant IN har afsløret kritiske aspekter af vDNA integration 14, 15, 16, 17. Men i modsætning til i naturlig infektion, dette in vitro biokemisk reaktion understøtter ikke samordnede integration af begge ender af substrat-DNA ind i mål-DNA. I modsætning hertil retrovirale PIC'er isoleret fra akut inficerede celler samordnet for at integrere begge ender af det endogene vDNA til heterolog mål-DNA. Dette førte til udbredt anvendelse og efterfølgende justeringer af I n Vitro Integration (IVI) analyser ved hjælp isolerede indfødte ansvarlige.

I den første rapporterede retrovirale IVI assay cytoplasmatiske ekstrakter fra celler inficeret med en rekombinant murinLeukæmi Virus (MLV) huser E. coli supF-genet i sin LTR tjent som kilden til IN-aktivitet, og DNA'et af en mutant lambda-fag defekt i lytisk vækst blev eksogent leveret som target-DNA'et. Vellykket integration af det rekombinante MLV DNA kopiere, i fag-DNA'et og den efterfølgende supF ekspression førte til restaurering af plaque-dannende evne af de rekombinante fager. Men denne eksperimentelle strategi er besværlig og foranstaltninger integration på en indirekte måde. For at imødegå sådanne forbehold, blev en Southern blot-baserede indirekte ende-mærkning assay, der kvantificerer PIC-associerede IVI aktivitet som et mål for den endogene vDNA integreret i eksogen lineariserede bakteriofag phiX174 DNA, udviklet 6, 7, 18. Selv om denne metode giver et direkte mål for integration begivenheder, er relativt høje mængder af PIC forberedelse kræves, som stadig er et teknisk udfordrendebestræbelse. For at omgå dette, blev indlejrede PCR-baserede analyser, der kræver kun beskedne mængder af PIC'er udviklet 4, 5, 19.

I denne rapport beskriver vi en opdateret version af et nested PCR-baserede in vitro-metode udviklet til at rekapitulere HIV-1 PIC-medieret integration aktivitet forekommer under naturlig infektion. Denne metode anvender cytoplasmatiske ekstrakter af HIV-1-inficerede målceller som en kilde til endogen PIC-aktivitet, som måles med en real-time kvantitativ polymerasekædereaktion (qPCR). Procedurerne for at isolere ansvarlige og måle deres integrationsaktiviteter tilpasses, med modifikationer, fra protokoller offentliggjort af Engelman laboratoriet 20. Ved denne fremgangsmåde er PIC-associerede integration aktivitet initieres ved at tilvejebringe en eksogen lineær mål-DNA 21, og DNA, der stammer fradenne integration reaktion oprenses og anvendes som udgangsmateriale til efterfølgende PCR-baserede kvantificering. I første runde konventionel PCR er de virale-mål-DNA junctions amplificeret ved anvendelse af passende primere. I anden runde qPCR, er LTR-specifikke primere anvendes til specifikt at berige vDNA befolkning fra første runde PCR-produkter. Se afsnittet protokol for en detaljeret beskrivelse af denne metode.

In vitro studier med retrovirale ansvarlige har ført til betydelige fremskridt i vores forståelse af mekanismen for retroviral DNA integration og i udviklingen af IN-hæmmere. Baseret på den seneste øget fokus på kortlægning af HIV-1 integration sites, bestemme rolle af virale og vært faktorer i HIV-1 integration, og udvikle nye antivirale lægemidler til bekæmpelse af resistens, vi forestiller en øget interesse i og udbredt brug af IVI assays , som den er beskrevet i denne rapport. Dette vil igen, vil føre tilfremtidige forbedringer i metoden, og dermed diversificere omfanget af dets applikationer.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Virus Production

BEMÆRK: For at generere høje titre af infektiøs HIV-1, transficere humane embryoniske nyre (HEK) cellelinie 293T med en infektiøs HIV-1 molekylære klon ved anvendelse af en aktiveret dendrimer-baserede transfektionsreagens. Det er blevet observeret, at calciumphosphat-transfektion metode giver sammenlignelige resultater.

  1. I en biosikkerhedsniveau 2 (BSL2) lab, frø 3 x 10 6 293T celler pr 10 cm skål i 8 ml Dulbeccos Modified Eagle Medium (DMEM) suppleret med 10% kalvefosterserum (FBS), penicillin og streptomycin. Dyrke cellerne i en inkubator indstillet til 37 ° C og 5% CO 2 O / N.
  2. Den næste dag, til transfektion af celler i hver 10 cm skål, fortyndes 8 ug pNL4-3 plasmid-DNA (se Materialer tabel) til et slutvolumen på 300 pi DMEM mangler serum og antibiotika. Der tilsættes 80 ul af transfektionsreagens, bland godt ved pipettering, og inkuberes ved stuetemperatur i5 - 10 min til transfektion kompleksdannelse.
  3. Fjern mediet fra skålene ved aspiration, og der tilsættes 7 ml pr skål af frisk DMEM indeholdende serum og antibiotika.
  4. Der tilsættes 1 ml DMEM indeholdende serum og antibiotika til transfektion kompleks, blandes ved pipettering, og denne blanding til cellerne. Vend forsigtigt fadet for at lette jævn fordeling af transfektionskomplekser.
  5. Overdrage cellerne til BSL3 lab, sted i en inkubator indstillet til 37 ° C og 5% CO2, og dyrke cellerne i 48 timer.
  6. Opsaml virusholdige vævskultursupernatant med en pipette og derefter overføre det til et centrifugerør. Centrifugeres ved 300 xg i 5 min for at pelletere celler og debris, og derefter filtreres supernatanten gennem et 0,45 um porestørrelse sprøjtefilter.
  7. For at eliminere enhver fremførsel plasmid-DNA i denne celle-frit præparat virus, behandl med DNase 1 (20 ug / ml) ved 37 ° C i 1 time.
  8. At kvantificereHIV-1 titer bruge p24-specifikke enzymmaerket (ELISA), da det er en hurtig og medgørlige metode til rutinemæssig brug 22.
    BEMÆRK: Det skal bemærkes, at p24 ELISA måler den fysiske titer (antal viruspartikler). Alternativt vil måle virus-associeret RT-aktivitet (exogent RT-assay) eller virusinfektivitetsprøve (TZM-bl indikatorcelleline-baserede infektivitetsbestemmelser) give eksklusiv udlæsning af infektiøse viruspartikler.

2. Virus Infektion af Sup-T1 Cells (BSL3 Lab)

  1. I en BSL2 lab, vedligeholde Sup-T1 celler mellem 1,0 x 10 6 og 2,0 x 10 6 celler / ml i Roswell Park Memorial Institute (RPMI) medium suppleret med 10% varmeinaktiveret FBS, penicillin og streptomycin (split-forhold på 1 : 2 hver 2 - 3 i d). Samle Sup-T1-celler fra dyrkningskolber, bland godt ved pipettering, og bestemme antal levedygtige celler ved anvendelse af et hæmocytometer og trypanblåteksklusion staining metode.
    1. Forbered det nødvendige antal portioner af 80 x 10 6 celler (pr virusinfektion) i 50 ml koniske centrifugerør.
    2. Centrifuger cellerne i en svingende spand-rotor ved 500 xg og 25 ° C i 5 minutter. Uden at fjerne celledyrkningsmediet, overføre rør indeholdende pelleterede celler til BSL3 laboratorium for yderligere behandling. aspireres forsigtigt celledyrkningsmediet fra røret uden at forstyrre cellepelleten.
  2. Tilsæt en passende mængde af DNase I-behandlet virus inokulum til cellerne i røret og bland godt ved forsigtig pipettering. For 80 x 10 6 celler, bruge 30 ml DNase I-behandlet virus (50 ug p24-ækvivalent virus).
    BEMÆRK: Isolering af funktionelle PIC'er kræver inficere målcellerne med meget høje infektionsmultipliciteter (MOI).
  3. Fordel blandingen jævnt mellem to 6-brønds vævskulturplader (dvs. 12 x 2,5-ml portioner; bruge 2 plader pr inficereion).
  4. For spinoculation, placere dyrkningspladerne i plade bærere og centrifuge under anvendelse af en svingende spand-rotor ved 480 xg og 25 ° C i 2 timer.
  5. Inkubér spinoculated celler ved 37 ° C og 5% CO2 i 5 timer.

3. Høst og Lysis af inficerede celler (BSL3 lab)

  1. Pool cellerne svarende til hver infektion fra dyrkningspladerne I et 50 ml konisk centrifugerør (~ 30 ml i alt).
  2. Cellerne høstes ved centrifugering ved 300 xg og 25 ° C i 10 minutter. aspireres forsigtigt supernatanten fra røret (alternativt, brug en pipette).
  3. At fjerne enhver resterende viruspartikler, vask hver cellepellet ved tilsætning af 2 ml puffer K - / - (150 mM KCI, 20 mM HEPES, pH 7,6, 5 mM MgCl2) og centrifugering af prøven ved 300 xg og 25 ° C i 10 min. Derefter, uden at forstyrre pelleten fjernes forsigtigt supernatanten ved aspiration eller ved anvendelse af en pipette.
  4. Repeat trin 3.3.
  5. Fjern forsigtigt eventuelt resterende puffer ved anvendelse af en mikropipette. Resuspender hver cellepellet i 2 ml iskold lysepuffer K + / + (Buffer K - / - suppleret med 0,025% digitonin, 1 mM DTT, 20 ug / ml aprotinin) og blandes indholdet ved forsigtig pipettering, overføres opløsningen til en 2 ml mikrocentrifugerør.

4. Fremstilling af cytoplasmatiske ansvarlige (BSL3 lab)

  1. Rock prøverne på et roterende rysteapparat ved stuetemperatur i 10 min.
  2. Centrifugeres prøverne, med rotoren forafkølet til 4 ° C, ved 1.500 xg og 4 ° C i 4 min.
  3. Uden at forstyrre pelleten, omhyggeligt overføre supernatanten til et frisk mikrocentrifugerør og centrifugeres ved 16.000 xg og 4 ° C i 1 min.
  4. overføre omhyggeligt supernatanten til et frisk mikrocentrifugerør. Tilføj RNase A (20 mg / ml) til en slutkoncentration på 20 ug / ml (2 pi i 2 ml PIC'er) og inkuber indholdet ved stuetemperatur i 30 minutter (ingen vipning). </ Li>
  5. Tilføj saccharose (60% vægt / volumen i buffer K - / -) til en endelig koncentration på 7% og bland godt ved forsigtig pipettering. Forbered delprøver (f.eks 200 ul) af de ansvarlige i mikrocentrifugerør, flash-freeze i flydende nitrogen, og sted i en -80 ° C fryser for langtidsopbevaring.

5. In vitro Integration (IVI) assays under anvendelse af HIV-1-PIC'er

  1. Forbered mål-DNA'et, der anvendes i IVI assayet ved amplifikation af en 2,0 kb region fra phiX174 plasmid-DNA med PCR under anvendelse af skræddersyede primere, phiX174-F og phiX174-R.
    1. Saml PCR-blandingen som beskrevet i tabel 1. Udfør PCR i et termisk cykliseringsapparat ved anvendelse af de termiske cykliseringsbetingelser anbefalet i tabel 2. Gel-oprensning af PCR-produktet ved anvendelse af en gel-oprensningskit (efter producent-anbefalede protokol), og opbevar det oprensede mål-DNA som alikvoter ved -80 ° C indtil anvendelse.
  2. Tilføj 600 ng mål-DNA til 200 - & #181; L aliquot af PIC'er, bland godt, og der inkuberes ved 37 ° C i 45 minutter.
    Bemærk: IVI reaktioner udeladelse mål-DNA eller herunder en integraseinhibitor (f.eks Raltegravir) anbefales kontrol reaktioner.
  3. Stop IVI reaktionen ved tilsætning SDS, EDTA og proteinase K til slutkoncentrationer på 0,5%, 8 mM, og 0,5 mg / ml. Bland reaktionsindholdet grundigt og inkuber natten over ved 56 ° C.
  4. Den næste dag, oprense det totale DNA fra IVI reaktionen ved phenol / chloroform-ekstraktion og ethanolfældning. Udfør alle centrifugeringstrin ved 16.000 xg og RT.
  5. Tilsættes et lige så stort volumen phenol til afproteiniserede prøve, der blandes grundigt ved hvirvelbehandling og centrifugeres i 2 min. Fjern forsigtigt den øverste vandige fase og overføre det til et nyt rør.
  6. Gentag trin 5.5. Overfør den øvre vandige fase til et nyt rør.
  7. Tilsættes samme mængde af 1: 1 phenol: chloroform-blanding, der blandes grundigt ved hvirvelbehandling og centrifugeres for 2 min. Overfør den øvre vandige fase til et nyt rør.
  8. Tilsættes et lige så stort volumen chloroform, blandes grundigt ved hvirvelbehandling og centrifugeres i 2 min. Overfør den øvre vandige fase til et nyt rør.
  9. Til udfældning DNA tilsættes glycogen til en slutkoncentration på 0,1 ug / pi, 3 M natriumacetat til en slutkoncentration på 0,3 M, og 2,5 volumener 100% ethanol (iskold). Vortex at blande, centrifugeres kort for at samle indholdet, og placer røret ved -80 ° CO / N.
  10. Den næste dag, centrifugeres prøven i 30 minutter ved 16.000 xg og 4 ° C i 30 minutter. Fjern forsigtigt supernatanten uden at forstyrre bundfaldet.
  11. Der tilsættes 500 pi af 80% ethanol (iskold) til pelleten, og der centrifugeres ved 16.000 xg og 4 ° C i 10 minutter. Lufttør DNA-pelleten ved stuetemperatur og grundigt resuspender i 50 ul nuklease-frit vand. Opbevar DNA-prøver ved -20 ° C.

6. PCR Analyser til kvantificering PIC aktivitet

  1. Udfør første runde konventionel PCR under anvendelse af primere rettet mod den virale LTR og phiX174 DNA (LTR og phiX174 primere, henholdsvis) for at forstærke forbindelserne af den integrerede HIV-1-DNA.
    1. Saml første runde PCR-blandingen som beskrevet i tabel 3. Saml en master blanding af alle komponenter undtagen template-DNA'et, dispensere 45-pi alikvoter i separate PCR-rør, og der tilsættes 5 pi af template DNA eller nuklease-frit vand (kontrol).
    2. Udfør PCR i et termisk cykliseringsapparat ved anvendelse af de termiske cykliseringsbetingelser anbefalet i tabel 4.
  2. Udfør anden runde qPCR anvendelse af primere, som flankerer en kort region af det virale LTR (LTR-R og LTR-U-primere) til selektivt amplificere de integrerede vDNA sekvenser fra den første-round PCR-produkter. For at bestemme de integrerede vDNA kopiere numrene, danne en standardkurve ved anvendelse af 10x seriefortyndinger af kendte kopiantal (f.eks 10 0 - 10 8) af HIV-1 molekylære klon.
    1. Saml anden runde qPCR-blanding som beskrevet i tabel 5. Saml en master blanding af alle komponenter undtagen template-DNA'et, omhyggeligt dispensere 25 pi alikvoter i et passende antal af brønde i en 96-brønds PCR-reaktion plade, og derefter tilsættes 5 pi det urensede første runde PCR-produkter eller nuklease-frit vand (kontrollere). Udføre alle qPCR reaktioner i tre eksemplarer.
    2. Indlæse PCR-plade i real-time PCR instrument og udføre qPCR under anvendelse af de cykliseringsbetingelser, der anbefales i tabel 6.
    3. Analysere dataene ved anvendelse af en egnet software.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Isolering af HIV-1-PIC'er

En skematisk af den anvendte protokol til isolering af HIV-1-PIC'er fra akut inficerede Sup-T1-celler er afbildet i figur 1. Denne protokol er afledt af fremgangsmåderne beskrevet af Engelman et al. 19, 20. HIV-1-PIC'er er nukleoprotein komplekser, der er samlet i inficerede celler og er sammensat af revers-transkriberet vDNA, virale proteiner og cellulære faktorer 19, 20. Fremgangsmåden beskrevet i denne rapport metode bruger de cytoplasmiske ekstrakter af HIV-1-inficerede celler som kilden til PIC-associeret integration aktivitet.

In vitro integration af HIV-1-PIC'er

figur 2. Denne metode udnytter en indlejret qPCR-baseret strategi til måling af PIC-associeret IVI aktivitet, og procedurerne tilpasses, med modifikationer, fra protokoller offentliggjort af Engelman laboratorium 19, 20, 21. Ved denne fremgangsmåde er PIC-associerede integration aktivitet initieres ved at tilvejebringe en heterolog lineær mål-DNA 21, og DNA, der stammer fra denne integration reaktion oprenses og anvendes som udgangsmateriale til efterfølgende PCR-baserede kvantificering. I første runde konventionel PCR er de virale-mål-DNA junctions amplificeret under anvendelse af passende primere. I anden runde qPCR, er LTR-specifikke primere anvendes til specifikt at berige vDNA befolkning fra første runde PCR-produkter. Se protokollen sfdeling for en detaljeret beskrivelse af denne metode.

Repræsentative resultater fra en IVI-assay udført under anvendelse af HIV-1-PIC'er er vist i figur 3. Sup-T1-celler (80 x 10 6 celler / infektion) blev spinoculated med 30 ml DNase 1-behandlede HIV-1 (~ 50 ug p24 ækvivalent) i fravær eller nærvær af 1 uM HIV-1 IN inhibitor Raltegravir ved 480 xg og 25 ° C i 2 timer. Celler blev efterfølgende dyrket i 5 timer ved 37 ° C og 5% CO2. PIC'er blev isoleret som beskrevet i protokollen sektion. De IVI reaktioner blev udført, med hver 200 pi PIC'er og 600 ng af mål-DNA (et 2 kb DNA-fragment amplificeret fra phiX174 DNA ved PCR), ved 37 ° C i 45 minutter. Reaktionerne blev deproteiniseret ved proteinase K-behandling i nærvær af SDS og EDTA ved 56 ° CO / N. Reaktionsprodukterne blev ekstraheret to gange med phenol, én gang med en phenol: chloroform (1: 1) blanding, og en gangmed chloroform. Efterfølgende blev DNA'et ethanol-præcipiteret i nærværelse af salt og co-fældningsmiddel glycogen, og DNA-pelleten blev vasket en gang med 80% ethanol. Det oprensede DNA blev resuspenderet i 50 pi af nuklease-frit vand. En nested qPCR strategi blev anvendt til at bestemme antallet af vDNA integreret i phiX174 DNA. I første runde konventionel PCR blev primerne komplementære til sekvenser på phiX174 mål-DNA og viral LTR region anvendt til at amplificere de integrerede virale-mål-DNA junctions fra 5 pi af integration reaktionsprodukter DNA-produkter. I den anden runde qPCR blev LTR-spænder primere anvendes til udelukkende amplificere HIV-specifikke DNA-sekvenser fra 5 pi af de første-runde amplicon produkter og fra 10 gange serielle fortyndinger af kendte kopiantal (10 8 -10 0) af HIV-1 molekylære klon (Standards).

Alle qPCR reaktioner blev udført i tre eksemplarer og data were analyseres ved hjælp af kommerciel software. De værdier udledt fra standarderne blev afbildet til at generere en standardkurve, fra hvilken de integrerede vDNA kopiere tal blev interpoleret. Fejl- søjler repræsenterer standardafvigelser. Som vist i figur 3, de HIV-1-PIC'er robust integrere den tilknyttede vDNA i mål-DNA (bane 5). Vigtigt er det, blev IVI effektivitet ansvarlige stærkt reduceret i reaktioner suppleret med IN-hæmmer Raltegravir (Bane 6). Dette attributter kraftigt integrationen aktivitet målt i dette assay for HIV-1 IN. Endvidere kontrol- reaktioner indeholdende cytoplasmatiske lysater fra ikke-inficerede celler (bane 1), ansvarlige alene (bane 2), mål-DNA alene (bane 3), og puffer alene (bane 4) viste ingen integration aktivitet. Desuden har den kontrol, som udelukkede Taq polymerase i første runde PCR (bane 7) ikke forstærke integration produkter. Især data fra ansvarlige-alone kontrol (bane 2) viste, at det indlejrede qPCR strategi specifitisk måler den integrerede vDNA men ikke PIC-associerede vDNA. Tilsammen viser disse data målingen af ​​PIC-associeret integration aktivitet.

figur 1
Figur 1: Skematisk repræsentation af protokollen for udarbejdelse af HIV-1 PIC'er. Klik her for at se en større version af dette tal.

Cytoplasmatiske ekstrakter indeholdende billeder er isoleret fra HIV-1-inficerede Sup-T1-celler. Disse billeder er anvendt som kilde til integration aktivitet i in vitro integration assay.

Figur 2
Figur 2: Skematisk repræsentation af in vitro m> Integration Assay af HIV-1-PIC'er. Klik her for at se en større version af dette tal.

Integrations- assays blev udført in vitro under anvendelse af HIV-1-PIC'er og det heterologe mål phiX174 DNA. Den integrerede HIV-1-DNA blev målt ved en nested PCR strategi, hvor den første runde konventionel PCR forstærker integration kryds hvorfra vDNA-specifikke sekvenser er fortrinsvis amplificeret i en anden runde-qPCR.

Figur 3
Figur 3: HIV-1 PIC-associerede vDNA Integration Activity. Klik her for at se en større version af dette tal.

"FO: keep-together.within-side =" 1 "> Repræsentative resultater af HIV-1 PIC-associeret integration aktivitetsassay De integrerede vDNA kopiere blev bestemt ved at afbilde værdier udledt fra en standardkurve genereret under anvendelse 10x serielle fortyndinger af. kendte kopiantal af en HIV-1 molekylære klon. Alle reaktioner blev udført i tre eksemplarer, og dataene blev analyseret under anvendelse af kommerciel software. Fejlsøjler repræsenterer standardafvigelser.

Komponent lager Slutvolumen til 50 pi reaktion
phiX174 plasmid-DNA 10 ng / pl 5,0 uL
GoTaq reaktionsbuffer 5x 10,0 uL
dNTP nukleotid mix 10 mM af hver 1,0 pi
phiX174-F primer 10 uM 2,5 uL
phiX174-R primer 10 uM 2,5 uL
GoTaq DNA Polymerase (5 U / pl) 0,25 uL
Nuclease-free destilleret vand - 28,75 uL

Tabel 1.

95 ° C = 2 min
Cyklus 34 gentagelser af:
95 ° C = 30 s
53 ° C = 30 s
72 ° C = 2 min
72 ° C = 10 min
4 ° C = Hold

Tabel 2.

Komponent lager Slutvolumen til 50 pi reaktion
IVI reaktion DNA-produkt - 5,0 uL
GoTaq reaktionsbuffer 5x 10,0 uL
dNTP nukleotid mix 10 mM af hver 1,0 pi
LTR primer 10 uM 2,5 uL
phiX174 primer 10 uM 2,5 uL
GoTaq DNA Polymerase (5 U / pl) 0,25 uL
Nuclease-free destilleret vand - 28,75 uL

Tabel 3.

95 ° C = 5 min
Cyklus 23 gentagelser af:
94 ° C = 30 s
55 ° C = 30 s
72 ° C = 4 min
72 ° C = 10 min
4 ° C = Hold

Tabel 4.

<td> Taqman Probe
Komponent lager Slutvolumen i 30 pi reaktion
1 m runde PCR-produkter - 5,0 uL
LTR-R primer 10 uM 0,9 uL
LTR-U primer 10 uM 0,9 uL
10 uM 0,3 uL
iQ Supermix 2x 15,0 uL
Nuclease-free destilleret vand - 7,9 uL

Tabel 5.

95 ° C = 3 min
Cyklus 39 gentagelser af:
94 ° C = 15 s
58 ° C = 30 s
72 ° C = 30 s
plade Læs

Tabel 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Biokemiske analyser af retrovirale PIC'er har givet kritiske indsigt i mekanismen for retroviral DNA-integration. Måling af integration aktivitet af retrovirale PIC'er kan opnås ved plakdannelse assay Southern blot-analyse, og nested qPCR. Den eksperimentelle strategi af plak-assay er besværlig og udnytter en indirekte metode til måling af integration 6, 7, 18. Southern blot assays foranstaltning integration direkte, men kræver relativt store mængder af PIC'er 6, 7, 18.

Denne rapport beskriver en indlejret qPCR strategi for måling af HIV-1 PIC-associeret integration aktivitet in vitro. Den største fordel og betydningen af denne fremgangsmåde er kravet om relativt lave mængder PIC forberedelse per reaktion 4, 5, 19. De mest kritiske trin ved denne metode er dannelsen af ​​en høj titer virus til infektion og håndtering af PIC præparat. Det skal her bemærkes, at den første runde af PCR involverer eksponentiel forstærkning af integrationsindsatsen vejkryds. Følgelig kopi antal integrerede vDNA fastlagt i anden runde qPCR er semikvantitative og dermed har begrænsningen af ​​ikke at give et mål for PIC-associeret vDNA kopier. Imidlertid kan PIC-associerede vDNA bestemmes ved qPCR af DNA oprenset fra PIC'er med LTR-specifikke primere. Forholdet mellem de integrerede vDNA kopiere numre til den tilsvarende PIC-associerede vDNA kan give oplysninger om integrationen effektiviteten af en in vitro integration reaktion. Denne metode kan ændres ved at inkorporere andre heterolog mål-DNA af valg og andre primere til at opdage integration på begge orienteringer. Sammenfattende fremgangsmådenbeskrevet her måler integrationen aktiviteten af ​​HIV-1-PIC'er kvantitativt og kan videreudvikles til forskning udvikle en forståelse af de biokemiske detaljer i retroviral integration.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer nogen konkurrerende finansielle og ikke-finansielle interesser.

Acknowledgments

Dette arbejde er delvist støttet af tilskud DA024558, DA30896, DA033892, og DA021471 fra Nida / NIH til CD. Vi anerkender også RCMI tilskud G12MD007586, Vanderbilt CTSA give UL1RR024975, den Meharry Translationel Research Center (MeTRC) CTSA tilskud U54 RR026140 fra NCRR / NIH, at U54 tilskud MD007593 fra NIMHD / NIH, og Tennessee CFAR tilskud P30 AI110527.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
måling af<em&gt; In vitro</em&gt; Integration aktivitet af HIV-1 Preintegration komplekser
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter