Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Meting van doi: 10.3791/54581 Published: February 22, 2017

Abstract

HIV-1 envelopeiwitten aangrijpen verwante receptoren op het doelceloppervlak, waardoor virale celmembraan fusie gevolgd door de afgifte van het virale capside (CA) kern in het cytoplasma. Vervolgens het virale reverse transcriptase (RT), als onderdeel van een gelijknamige nucleoproteïne complex genaamd de Reverse Transcriptie Complex (RTC), zet het virale enkelstrengs RNA genoom in een dubbelstrengs DNA-kopieën (vDNA). Dit leidt tot de biogenese van andere nucleoproteïne complex, de zogenoemde pre-integratie complex (PIC), bestaande uit vDNA en geassocieerde virus eiwitten en gastheerfactoren. De PIC-geassocieerde virale integrase (IN) orchestrates de integratie van het vDNA in het chromosomale DNA in een tijd en ruimte gereguleerd tweestapswerkwijze. Ten eerste, de IN verwerkt de 3 'einden van het vDNA in het cytoplasma en anderzijds na de PIC traffics naar de kern, bemiddelt integratie van de verwerkte vDNA in het chromosomale DNA. De zuivere intercommunales geïsoleerdvan doelcellen acuut geïnfecteerd met HIV-1 zijn functioneel in vitro, aangezien zij bevoegd om de bijbehorende vDNA integreren in een heteroloog exogeen toegevoegde doelwit DNA. Dergelijke PIC-based in vitro integratie assays hebben aanzienlijk bijgedragen aan de afbakening van de mechanistische details van de retrovirale integratie en tot het ontdekken van IN-remmers. In dit rapport gaan we dieper in op een bijgewerkte HIV-1 PIC test die een geneste real-time kwantitatieve Polymerase Chain Reaction (qPCR) gebaseerde strategie hanteert voor het meten van de in vitro integratie activiteit van geïsoleerde inheemse foto's.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HIV-1 replicatie in de doelcel omvat meerdere stappen, lijnen ingedeeld in twee fasen: vroege en late events. De vroege gebeurtenissen beginnen als HIV-1 sequentieel aan het doelwit bindt celoppervlak receptor CD4 en één van de twee co-receptoren (CCR5 of CXCR4) 1. Bijgevolg is de virus-celmembranen zekering en het virale capside (CA) kern vrij in het cytoplasma 2. De CA kern bevat het virale genoom enkelstrengs RNA (ssRNA) en verscheidene eiwitten, zowel virale als cellulaire oorsprong. De CA-geassocieerde virale eiwitten omvatten Reverse Transcriptase (RT) en integrase (IN), twee enzymen die kritische stappen bemiddelen tijdens vroege gebeurtenissen in de virale replicatie. De RT en IN functie in de context van nucleoproteïne complexen, namelijk de reverse transcriptie complex (RTC) en het pre-integratie complex (PIC), respectievelijk 3, 4, 5 <sup>, 6. De uiteinden van het virale genoom ssRNA haven terminal repeat (R) elementen naast de unieke sequenties U5 (aan het 5 'uiteinde) en U3 (aan het 3' uiteinde). De RTC zet de virale ssRNA genoom in een dubbelstrengs (ds) DNA-kopie (vDNA). Dit reverse transcriptieproces leidt ook tot verdubbeling van de U5 en U3 sequenties, waardoor het genereren van lange terminale herhalingen (LTR) aan beide uiteinden van het vDNA 7, 8. Vervolgens de PIC-geassocieerde IN katalyseert twee opeenvolgende biochemische reacties die de integratie van het vDNA mogelijk in het gastheer chromosoom 9, 10, 11. Eerst, in het cytoplasma, IN multimeren grijpen zowel LTR 12 en klieven een dinucleotide van elk van de 3'-uiteinden. Deze 3'-end verwerking genereert een hydroxylgroep aan beide 3'-uiteinde (CA OH) van het vDNA.Vervolgens PIC traffics naar de kern, waarbij in gebruik het vDNA CA OH als nucleofiel op beide strengen van het chromosomale DNA geknipt in een versprongen wijze. Tegelijkertijd IN splits gecoördineerd beide uiteinden van het vDNA de resulterende fosfodiesterbindingen op tegenoverliggende strengen van het chromosomale DNA. Na deze strand transfer stap, de gastheercelmachinerie verwijdert de twee ongepaarde nucleotiden aan de 5 'einden van het vDNA en herstelt de daaropvolgende enkelstrengige openingen op de kruising van de integratieplaats. De vroege gebeurtenissen dus culmineren met de oprichting van een geïntegreerde DNA-kopie (provirus) van het HIV-1-genoom. Het provirus verschaft een geschikte omgeving voor efficiënte virale genexpressie, welke latere gebeurtenissen, zoals de expressie van het virus gecodeerde eiwitten initieert; assemblage van de onrijpe virus; en ontluikende, release, en rijping tot infectieuze virions 13.

Gezuiverd recombinant retrovirale IN bevoegd isuit te voeren, in vitro, zowel 3'-end verwerking en strand transfer activiteiten op exogeen geleverd LTR-achtige substraat DNA. Biochemische studies met dergelijke gezuiverde recombinant IN zijn kritische aspecten van vDNA integratie 14, 15, 16, 17 geopenbaard. Anders dan in natuurlijke infectie, het in vitro biochemische reactie ondersteunt onderling integratie van beide uiteinden van het substraat DNA in het doelwit DNA. Daarentegen retrovirale PICs geïsoleerd uit acuut geïnfecteerde cellen eensgezind beide uiteinden van de endogene vDNA integreren heterologe doelwit DNA. Dit leidde tot de wijdverbreide invoering en daaropvolgende verfijningen van I n Vitro Integratie (IVI) testen met behulp van geïsoleerde inheemse zuivere intercommunales.

In de eerste gerapporteerde retrovirale IVI assay, cytoplasmatische extracten uit cellen geïnfecteerd met recombinant MuisLeukemie virus (MLV) die het op E. coli supF gen in de LTR aan de grondslag van de activiteit en het DNA van een mutant defectief in lambda faag lytische groei exogeen geleverd als het doelwit DNA. Succesvolle integratie van het recombinante DNA MLV kopiëren in de faag-DNA en de daaruit voortvloeiende supF expressie leidde tot herstel van de-plaque-vormende vermogen van de recombinante fagen. Echter, deze experimentele strategie is arbeidsintensief en maatregelen integratie op een indirecte manier. Dergelijke restricties pakken, een Southern-blot gebaseerde indirecte eindlabeling assay, die de PIC-geassocieerde IVI activiteit als maat voor de endogene vDNA geïntegreerd exogeen gelineariseerde DNA bacteriofaag PhiX174 kwantificeert ontwikkeld 6, 7, 18. Hoewel deze werkwijze een directe maat integratiegebeurtenissen, relatief grote hoeveelheden PIC voorbereiding vereist, die nog een technisch uitdagendetrachten. Om dit te omzeilen, geneste PCR-gebaseerde testen die slechts geringe hoeveelheden PICs ontwikkeld 4, 5, 19.

In dit verslag we een bijgewerkte versie van beschrijven een geneste PCR-gebaseerde in vitro werkwijze ontwikkeld om de HIV-1 PIC-gemedieerde integratie activiteit tijdens natuurlijke infectie recapituleren. Deze methode gebruikt de cytoplasmatische extracten van HIV-1-geïnfecteerde doelcellen als bron van endogene PIC activiteit, gemeten met real-time kwantitatieve polymerasekettingreactie (qPCR). De procedures voor het isoleren van zuivere intercommunales en het meten van de integratie activiteiten worden aangepast, met wijzigingen, van protocollen, gepubliceerd door de Engelman laboratorium 20. In deze werkwijze wordt de PIC-geassocieerde integratie geïnitieerd door een exogeen lineaire doel DNA 21 en het DNA verkregen productenDeze integratie reactie worden gezuiverd en gebruikt als uitgangsmateriaal voor daaropvolgende PCR-kwantificering. In de eerste ronde conventionele PCR, wordt het virale DNA-doelwit knooppunten geamplificeerd met gebruikmaking van geschikte primers. In de tweede ronde qPCR, LTR-specifieke primers worden gebruikt om specifiek verrijken vDNA populatie van de eerste ronde PCR producten. Zie het protocol gedeelte voor een gedetailleerde beschrijving van deze methode.

In vitro onderzoeken met retrovirale PICs hebben geleid tot significante vooruitgang in ons begrip van het mechanisme van DNA retrovirale integratie en in de ontwikkeling van remmers in. Op basis van de recent toegenomen aandacht voor het in kaart brengen van HIV-1 integratie sites, het bepalen van de rol van virale en gastheer factoren in HIV-1 integratie en de ontwikkeling van nieuwe antivirale geneesmiddelen aan de bestrijding van resistentie tegen geneesmiddelen, overwegen we een toenemende belangstelling voor en het wijdverbreide gebruik van IVI assays , zoals die in dit rapport beschreven. Dit op zijn beurt zal leiden tottoekomstige verfijningen in de werkwijze, waardoor de omvang van de toepassingen te diversifiëren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. virusproductie

OPMERKING: Om hoge titers van besmettelijke HIV-1 te genereren, transfecteren de humane embryonale nier (HEK) cellijn 293T met een besmettelijke HIV-1 moleculaire kloon met behulp van een geactiveerde-dendrimeer gebaseerde transfectiereagens. Waargenomen is dat de calciumfosfaat transfectie methode levert vergelijkbare resultaten.

  1. In een Biosafety Level 2 (BSL2) lab zaden 3 x 10 6 293T cellen per 10 cm schaal in 8 ml Dulbecco's Modified Eagle Medium (DMEM) aangevuld met 10% foetaal runderserum (FBS), penicilline en streptomycine. Cultuur van de cellen in een ingesteld op 37 ° C incubator en 5% CO 2 O / N.
  2. De volgende dag, te transfecteren cellen per 10 cm schaal Verdun 8 ug plasmide DNA pNL4-3 (zie Materialen Table) tot een eindvolume van 300 ul DMEM zonder serum en antibiotica. Voeg 80 ul van het transfectiereagens, meng goed door pipetteren en incubeer bij kamertemperatuur5-10 min voor transfectie complexvorming.
  3. Verwijder het medium uit de gerechten door aspiratie en voeg 7 ml per gerecht van verse DMEM met serum en antibiotica.
  4. Voeg 1 ml DMEM met serum en antibiotica om de transfectie complex mengen door pipetteren en voeg dit mengsel aan de cellen. Zwenk de schaal gelijkmatige verdeling van de transfectie complexen vergemakkelijken.
  5. Onmiddellijk over de cellen aan de BSL3 lab, plaats in een incubator ingesteld op 37 ° C en 5% CO 2 en kweek van de cellen gedurende 48 uur.
  6. Verzamel de virus-bevattende weefselkweek supernatant met een pipet worden overgebracht naar een centrifugebuis. Centrifugeer bij 300 xg gedurende 5 minuten om de cellen en resten te pelleteren, en filtreer de bovenstaande vloeistof door een 0,45 urn poriegrootte spuitfilter.
  7. Om overdracht nucleïnezuren in deze celvrije viruspreparaat elimineren, behandelen met DNase 1 (20 ug / ml) bij 37 ° C gedurende 1 uur.
  8. Om de kwantificerenHIV-1 titer Gebruik de p24-specifieke enzyme-linked immunosorbent assay (ELISA), aangezien het een snelle en vatbaar werkwijze voor routinegebruik 22.
    OPMERKING: Opgemerkt wordt dat de p24 ELISA meet de fysische titer (aantal virusdeeltjes). Als alternatief, het meten van de-virus geassocieerde RT-activiteit (exogene RT-test) of virus besmettelijkheid (TZM-bl indicator cellijn op basis van besmettelijkheid assays) zullen exclusieve uitlezing van besmettelijke virusdeeltjes te bieden.

2. Virus Infectie van Sup-T1 Cells (BSL3 Lab)

  1. In een BSL2 lab, onderhouden Sup-T1-cellen tussen 1,0 x 10 6 en 2,0 x 10 6 cellen / ml in Roswell Park Memorial Institute (RPMI) medium aangevuld met 10% door warmte geïnactiveerd FBS, penicilline en streptomycine (splitsingsverhouding van 1 : 2 elke 2-3 d). Pool de Sup-T1-cellen uit de kweek kolven, meng goed door pipetteren, en bepaal de telling van levensvatbare cellen met behulp van een hemocytometer en de trypan blauw exclusie staining methode.
    1. Bereid het vereiste aantal porties van 80 x 10 6 cellen (per virusinfectie) in 50 ml conische centrifugebuizen.
    2. Centrifugeer de cellen in een swinging-bucket rotor bij 500 xg en 25 ° C gedurende 5 minuten. Zonder verwijdering van het celkweekmedium, breng de buisjes met gepelleteerde cellen aan de BSL3 laboratorium voor verdere verwerking. Zorgvuldig aspireren het celkweekmedium uit de buis zonder de celpellet.
  2. Voeg een geschikte hoeveelheid DNase I behandelde virus inoculum aan de cellen in de buis en meng door voorzichtig pipetteren. Voor 80 x 10 6 cellen, gebruik 30 ml DNase I behandelde virus (50 ug p24-equivalente virus).
    OPMERKING: Isolatie van functionele PICs vereist infecteren van de doelcellen met een zeer hoge multipliciteit van infectie (MOI).
  3. Verdeel het mengsel gelijkmatig tussen twee 6-well weefselkweek platen (dwz 12 x 2,5 ml porties, gebruik 2 platen per infecterenion).
  4. Voor spinoculation Plaats de kweekplaten in plaatdragers en centrifugeer met een swinging bucket rotor bij 480 xg en 25 ° C gedurende 2 uur.
  5. Incubeer de spinoculated cellen bij 37 ° C en 5% CO2 gedurende 5 uur.

3. Oogst en Lysis van geïnfecteerde cellen (BSL3 lab)

  1. Verzamel de cellen die corresponderen met elke besmetting van de kweekplaten in een 50 ml conische centrifugebuis (~ 30 ml in totaal).
  2. Oogst de cellen door centrifugatie bij 300 xg en 25 ° C gedurende 10 minuten. Zorgvuldig aspireren het supernatans van de buis (als alternatief, gebruik dan een pipet).
  3. Om resten virusdeeltjes Was vervolgens elke celpellet door toevoeging van 2 ml buffer K - / - (150 mM KCI, 20 mM HEPES, pH 7,6, 5 mM MgCl2) en centrifugeren van het monster bij 300 xg en 25 ° C 10 minuten. Vervolgens, zonder de pellet te verstoren, verwijder het supernatant door afzuigen of door een pipet.
  4. REPEAt stap 3.3.
  5. Verwijder eventueel resterende buffer voorzichtig met behulp van een micropipet. Resuspendeer elk celpellet in 2 ml ijskoude lysisbuffer K + / + (Buffer K - / - aangevuld met 0,025% digitonine, 1 mM DTT, 20 ug / ml aprotinine), meng de inhoud door voorzichtig pipetteren en overbrengen naar een 2 ml microcentrifugebuis.

4. Bereiding van cytoplasmatische zuivere intercommunales (BSL3 lab)

  1. Rock de monsters op een roterende schudder bij kamertemperatuur gedurende 10 min.
  2. Centrifugeer de monsters met de rotor voorgekoeld tot 4 ° C bij 1500 xg en 4 ° C gedurende 4 min.
  3. Zonder de pellet te verstoren voorzichtig het supernatant over te brengen naar een nieuwe microcentrifugebuis en centrifugeer bij 16.000 xg en 4 ° C gedurende 1 min.
  4. overdracht van de bovenstaande vloeistof voorzichtig een nieuwe microcentrifugebuis. Voeg RNase A (20 mg / ml) tot een eindconcentratie van 20 ug / ml (2 pl van 2 ml PICs) en incubeer de inhoud bij kamertemperatuur gedurende 30 min (zonder schommelen). </ Li>
  5. Sucrose voeg (60% w / v in buffer K - / -) tot een eindconcentratie van 7% en meng door voorzichtig pipetteren. Bereid porties (bijvoorbeeld 200 pl) van de zuivere intercommunales in microcentrifugebuizen, flash-vries in vloeibare stikstof, en plaats in een -80 ° C vriezer voor opslag op lange termijn.

5. In Vitro Integratie (IVI) Testen met behulp van HIV-1 intercommunales

  1. Bereid het doelwit DNA gebruikt in de IVI-test door het versterken van een 2,0 kb regio uit de PhiX174 plasmide DNA met PCR met behulp van op maat gemaakte primers, PhiX174-F en PhiX174-R.
    1. Monteer het PCR mengsel zoals beschreven in tabel 1. Voer PCR in een thermocycler met de thermale cycli voorwaarden aanbevolen in Tabel 2. Gel-zuiveren het PCR product met een gel-zuivering kit (na producent aanbevolen protocol), en bewaar het gezuiverde doelwit DNA als fracties bij -80 ° C tot gebruik.
  2. Voeg 600 ng doelwit DNA 200 - & #181; L portie van zuivere intercommunales, goed mengen en incubeer bij 37 ° C gedurende 45 min.
    Opmerking: IVI reacties weglaten doelwit DNA of met inbegrip van een integrase inhibitor (bijv Raltegravir) aanbevolen controle reacties.
  3. Stop de reactie door toevoeging IVI SDS, EDTA en proteïnase K tot eindconcentraties van 0,5%, 8 mM en 0,5 mg / ml, respectievelijk. Meng de inhoud grondig reactiemengsel en overnacht incuberen bij 56 ° C.
  4. De volgende dag, zuivert het totale DNA van de IVI reactie van fenol / chloroform extractie en ethanolprecipitatie. Voer alle stappen centrifugeren bij 16.000 xg en RT.
  5. Voeg een gelijk volume fenol de onteiwitte monster krachtig mengen door vortexen en centrifugeer gedurende 2 min. Verwijder voorzichtig de bovenste waterfase en overbrengen naar een nieuwe buis.
  6. Herhaal stap 5.5. Breng de bovenste waterige fase naar een nieuwe buis.
  7. Voeg een gelijk volume van 1: 1 fenol: chloroform mengsel, meng krachtig door vortexen en centrifugeren for 2 min. Breng de bovenste waterige fase naar een nieuwe buis.
  8. Voeg een gelijk volume chloroform, meng krachtig door vortexen en centrifugeer gedurende 2 min. Breng de bovenste waterige fase naar een nieuwe buis.
  9. DNA precipitaat, voeg glycogeen tot een eindconcentratie van 0,1 ug / ul, 3 M natriumacetaat tot een eindconcentratie van 0,3 M en 2,5 volumes 100% ethanol (ijskoud). Vortex om te mengen, centrifuge kort naar de inhoud te verzamelen, en zet de buis bij -80 ° CO / N.
  10. De volgende dag, centrifugeer het monster gedurende 30 min bij 16.000 xg en 4 ° C gedurende 30 minuten. Verwijder voorzichtig de bovenstaande vloeistof zonder de pellet te verstoren.
  11. Voeg 500 ul van 80% ethanol (ijskoud) aan de pellet en centrifugeer bij 16.000 xg en 4 ° C gedurende 10 minuten. Air-droog de DNA pellet bij kamertemperatuur en grondig mengen in 50 ul van nuclease-vrij water. Bewaar de DNA monsters bij -20 ° C.

6. PCR-tests voor het kwantificeren van PIC Activity

  1. Voer de eerste ronde conventionele PCR met behulp van primers gericht op de virale LTR en PhiX174 DNA (LTR en PhiX174 primers, respectievelijk) aan de verbindingspunten van de geïntegreerde HIV-1 DNA te amplificeren.
    1. Monteer de eerste ronde PCR mengsel zoals beschreven in Tabel 3. Monteer een master mix van alle componenten met uitzondering van het template-DNA, afzien 45-ul monsters in afzonderlijke PCR-buizen, en voeg 5 ul van template DNA of nuclease-vrij water (controle).
    2. Voer PCR in een thermocycler met de thermale cycli voorwaarden aanbevolen in Tabel 4.
  2. Voer de tweede ronde qPCR behulp van primers die een kort gebied van het virale LTR (LTR-R en LTR-U primers) flankeren selectief amplificeren van de geïntegreerde vDNA sequenties van de eerste-round PCR producten. Het bepalen van de geïntegreerde vDNA kopiëren nummers, genereert een standaardcurve met 10x seriële verdunningen van bekende kopie-aantallen (bijvoorbeeld, 10 0 - 10 8) van de HIV-1 moleculaire kloon.
    1. Monteer de tweede-ronde-qPCR mengsel zoals beschreven in Tabel 5. Monteer een master mix van alle componenten behalve het matrijs-DNA voorzichtig doseren 25 gl aliquots in het juiste aantal putten in een 96-wells PCR reactieplaat en voeg 5 ul van het gezuiverde eerste ronde PCR producten in nuclease-vrij water (controle). Voer alle qPCR reacties in drievoud.
    2. Laad de PCR-plaat in de real-time PCR-instrument en het uitvoeren van qPCR behulp van de fietsen voorwaarden aanbevolen in tabel 6.
    3. Analyseer de gegevens met behulp van geschikte software.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Isolatie van HIV-1 PICs

Een schema van het protocol voor de isolatie van HIV-1 PICs van acuut geïnfecteerde Sup-T1-cellen is weergegeven in Figuur 1. Dit protocol wordt afgeleid uit de door Engelman et al methoden. 19, 20. HIV-1 PICs zijn nucleoproteïne complexen die zijn samengevoegd geïnfecteerde cellen en omvatten de reverse getranscribeerd vDNA, virale eiwitten en cellulaire factoren 19, 20. De werkwijze beschreven in dit rapport gebruikt de cytoplasmatische extracten van HIV-1-geïnfecteerde cellen als bron van PIC geassocieerde integratieactiviteit.

In vitro integratie activiteit van HIV-1 PICs

figuur 2. Deze methode maakt gebruik van een geneste qPCR-based strategie voor het meten-PIC geassocieerd IVI-activiteit, en de procedures worden aangepast, met wijzigingen, van protocollen, gepubliceerd door de Engelman laboratorium 19, 20, 21. In deze werkwijze wordt de PIC-geassocieerde integratie geïnitieerd door een heteroloog lineaire doel DNA 21, en de DNA-producten die uit deze integratie reactiemengsel gezuiverd en gebruikt als uitgangsmateriaal voor daaropvolgende PCR-kwantificering. In de eerste ronde conventionele PCR, wordt het virale DNA-doelwit verbindingen geamplificeerd met behulp van geschikte primers. In de tweede ronde qPCR, LTR-specifieke primers worden gebruikt om specifiek verrijken vDNA populatie van de eerste ronde PCR producten. Zie het protocol sectie voor een gedetailleerde beschrijving van deze methode.

Representatieve resultaten van een assay IVI uitgevoerd middels HIV-1 PICs worden getoond in Figuur 3. Sup-T1-cellen (80 x 10 6 cellen / infectie) werden spinoculated met 30 ml DNase 1-behandelde HIV-1 (~ 50 ug p24 equivalent) in afwezigheid of aanwezigheid van 1 uM HIV-1 IN remmer Raltegravir 480 xg en 25 ° C gedurende 2 uur. De cellen werden vervolgens gekweekt gedurende 5 uur bij 37 ° C en 5% CO2. PIC's werden geïsoleerd zoals beschreven in het hoofdstuk protocol. De IVI reacties werden bij 37 ° C gedurende 45 minuten uitgevoerd, ieder vanuit 200 gl PICs en 600 ng van het doelwit DNA (een 2 kb DNA-fragment geamplificeerd uit PhiX174 DNA door PCR). De reacties werden eiwitvrij gemaakt proteinase K behandeling in aanwezigheid van SDS en EDTA bij 56 ° CO / N. De reactieproducten werden tweemaal geëxtraheerd met fenol, eenmaal met fenol: chloroform (1: 1) mengsel en eenmaalmet chloroform. Vervolgens werd het DNA-ethanol geprecipiteerd in de aanwezigheid van zout en het co-precipitaat glycogeen en het DNA pellet werd eenmaal met 80% ethanol gewassen. Het gezuiverde DNA werd opnieuw gesuspendeerd in 50 pl nuclease-vrij water. Een ingebedde qPCR strategie werd gebruikt om het aantal vDNA geïntegreerd in het DNA PhiX174 bepalen. In de eerste ronde conventionele PCR primers die complementair zijn aan sequenties bij de PhiX174 doel-DNA en virale LTR werden gebruikt om de geïntegreerde virale doel-DNA te amplificeren overgangen van 5 pi van de integratie reactie DNA-producten. In de tweede ronde qPCR, LTR-spanning primers werden gebruikt voor het amplificeren uitsluitend de HIV-specifieke DNA sequenties van 5 ul van de eerste ronde amplicon producten en van 10-voudige seriële verdunningen van bekende kopie-aantallen (8 10 -10 0) van de HIV-1 moleculaire kloon (Standards).

Alle qPCR reacties werden uitgevoerd in drievoud en van de gegevens were geanalyseerd met commerciële software. De waarden afgeleid van de standaarden werden uitgezet met een standaardkromme, waarvan de geïntegreerde vDNA kopie aantallen geïnterpoleerd genereren. Fout balken geven standaarddeviaties. Zoals in de figuur 3, de HIV-1 PICs krachtig integreren geassocieerde vDNA in het doel-DNA (baan 5). Belangrijk is dat de IVI efficiëntie van de zuivere intercommunales sterk verminderd in de reacties, aangevuld met de IN-remmer Raltegravir (Baan 6). Dit schrijft sterk de integratie activiteit gemeten in deze test om HIV-1 IN. Verder is de controlereacties die cytoplasmatische lysaten van geïnfecteerde cellen (baan 1), PICs alleen (baan 2), doel-DNA alleen (baan 3) en alleen buffer (baan 4) geen enkele integratieactiviteit vertonen. Bovendien heeft de controle die Taq polymerase in de eerste ronde PCR uitgesloten (Baan 7) niet amplificeren integratieproducten. Met name de gegevens van de PICs-alleen controle (laan 2) gaf aan dat de geneste qPCR strategie specificatiestisch meet de geïntegreerde vDNA maar niet de PIC-geassocieerde vDNA. Gezamenlijk tonen deze gegevens aan de meting van PIC-geassocieerde integratieactiviteit.

Figuur 1
Figuur 1: Schematische weergave van het protocol voor de bereiding van HIV-1-foto's. Klik hier om een grotere versie van deze figuur te bekijken.

Cytoplasmatische extracten die PIC's zijn geïsoleerd uit HIV-1-geïnfecteerde Sup-T1-cellen. Foto's worden gebruikt als bron van integratie activiteit in de in vitro integratie assay.

Figuur 2
Figuur 2: Schematische weergave van de in vitro m> Integratie Analyse van HIV-1 foto's. Klik hier om een grotere versie van deze figuur te bekijken.

Integratie testen werden uitgevoerd in vitro uitgevoerd met behulp van HIV-1 zuivere intercommunales en de heterologe doelwit PhiX174 DNA. De geïntegreerde HIV-1-DNA werd gemeten door een geneste PCR-strategie, waarbij de eerste ronde conventionele PCR amplificeert de integratie knooppunten waaruit vDNA-specifieke sequenties preferentieel geamplificeerd in een tweede ronde qPCR.

figuur 3
Figuur 3: HIV-1 PIC-geassocieerde vDNA integratieactiviteit. Klik hier om een grotere versie van deze figuur te bekijken.

"Fo: keep-together.within-page =" 1 "> Representatieve resultaten van de HIV-1 PIC-geassocieerde integratieactiviteit assay De geïntegreerde vDNA kopie aantallen werden bepaald door het uitzetten van waarden afgeleid uit een standaardcurve gegenereerd met behulp van 10x seriële verdunningen van. bekend aantal kopieën van een HIV-1 moleculaire kloon. Alle reacties werden uitgevoerd in drievoud en de gegevens werden geanalyseerd met behulp van commerciële software. foutbalken standaardafwijkingen.

bestanddeel Voorraad Eindvolume van 50 ul reactiemengsel
PhiX174 plasmide DNA 10 ng / ul 5,0 pl
GoTaq reactie buffer 5x 10,0 pl
dNTP nucleotide mix 10 mM elk 1,0 gl
PhiX174-F primer 10 uM 2,5 pl
PhiX174-R primer 10 uM 2,5 pl
GoTaq DNA Polymerase (5 U / pl) 0,25 pi
Nuclease-vrij gedestilleerd water - 28.75 pi

Tafel 1.

95 ° C = 2 min
Cyclus 34 herhalingen van:
95 ° C = 30 s
53 ° C = 30 s
72 ° C = 2 min
72 ° C = 10 min
4 ° C = Hold

Tafel 2.

bestanddeel Voorraad Eindvolume van 50 ul reactiemengsel
IVI reactie DNA-product - 5,0 pl
GoTaq reactie buffer 5x 10,0 pl
dNTP nucleotide mix 10 mM elk 1,0 gl
LTR primer 10 uM 2,5 pl
PhiX174 primer 10 uM 2,5 pl
GoTaq DNA Polymerase (5 U / pl) 0,25 pi
Nuclease-vrij gedestilleerd water - 28.75 pi

Tabel 3.

95 ° C = 5 min
Cyclus 23 herhalingen van:
94 ° C = 30 s
55 ° C = 30 s
72 ° C = 4 min
72 ° C = 10 min
4 ° C = Hold

Tabel 4.

<td> Taqman Probe
bestanddeel Voorraad Eindvolume van 30 pi reactiemengsel
1 st round PCR-producten - 5,0 pl
LTR-R primer 10 uM 0,9 pl
LTR-U primer 10 uM 0,9 pl
10 uM 0,3 pl
iQ Supermix 2x 15,0 pl
Nuclease-vrij gedestilleerd water - 7,9 pl

Tabel 5.

95 ° C = 3 min
Cyclus 39 herhalingen van:
94 ° C = 15 s
58 ° C = 30 s
72 ° C = 30 s
plaat lezen

Tabel 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Biochemische analyses van retrovirale pics kritische inzichten in het mechanisme van retrovirale DNA-integratie. Meting van de activiteit van retrovirale integratie PICs kan door plaquevorming assay, Southern blot-analyse en geneste qPCR. De experimentele strategie van plaque assay is omslachtig en maakt gebruik van een indirecte methode integratie 6, 7, 18 te meten. Southern-blot gebaseerde testen maatregel integratie direct maar vereisen relatief hoge bedragen van zuivere intercommunales 6, 7, 18.

Dit rapport beschrijft een geneste qPCR strategie voor het meten van HIV-1 PIC-geassocieerde integratieactiviteit in vitro. Het grote voordeel en betekenis van deze methode is de eis van betrekkelijk kleine hoeveelheden PIC preparaat per reactie 4, 5, 19. De belangrijkste stappen van deze werkwijze zijn de generatie van een hoge titer virus is geïnfecteerd en de behandeling van PIC preparaat. Hierbij moet worden opgemerkt dat de eerste ronde van PCR impliceert exponentiële amplificatie van de integratie knooppunten. Bijgevolg de kopie aantallen geïntegreerde vDNA bepaald in de tweede ronde qPCR semi-kwantitatieve en derhalve hebben de beperking van het niet geven een maat voor PIC-geassocieerde vDNA exemplaren. Echter, de PIC-geassocieerde vDNA bepaald door qPCR van het DNA gezuiverd uit PICs LTR-specifieke primers. De verhouding van de geïntegreerde vDNA kopiëren naar de corresponderende PIC geassocieerde vDNA kan informatie over de integratie efficiëntie van in vitro integratie reactie verschaffen. Deze werkwijze kan worden gemodificeerd door het opnemen van andere heterologe doelwit DNA keuze en andere primers integratie detecteren beide oriëntaties. Samengevat, de werkwijzehier beschreven meet de integratie activiteit van HIV-1 PICs kwantitatief en voor onderzoek de ontwikkeling van een goed begrip van de biochemische gegevens van retrovirale integratie kan worden aangenomen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren geen concurrerende financiële en niet-financiële belangen.

Acknowledgments

Dit werk wordt mede ondersteund door subsidies DA024558, DA30896, DA033892 en DA021471 van de NIDA / NIH op CD. We hebben ook de RCMI subsidie ​​G12MD007586 erkennen, de Vanderbilt CTSA verlenen UL1RR024975, de Meharry Translational Research Center (MeTRC) CTSA subsidie ​​U54 RR026140 van de NCRR / NIH, de U54 subsidie ​​MD007593 uit de NIMHD / NIH, en de Tennessee CFAR subsidie ​​P30 AI110527.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
Meting van<em&gt; In Vitro</em&gt; Integratie activiteit van HIV-1 Preintegration Complexen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter